Ảnh hưởng của vi sinh vật tới thực vật

MỤC LỤC MỞ ĐẦU 5 Chương 1 – TỔNG QUAN 7 1.1. Xylanase và ứng dụng trong công nghệ sản xuất thức ăn chăn nuôi 7 1.1.1. Xylanase và sự phân hủy sinh học xylan 7 1.1.2. Ứng dụng xylanase trong sản xuất thức ăn chăn nuôi 9 1.2. Nấm mốc và ứng dụng của công nghệ chuyển gen 10 1.2.1. Giới thiệu về nấm mốc 10 1.2.2. Agrobacterium và ứng dụng trong công nghệ chuyển gen thực vật và nấm 12 1.2.3. Chuyển gen vào nấm mốc thông qua A. tumefaciens 17 1.2.3.1. Kỹ thuật chuyển gen vào nấm mốc A. niger 17 Chương 2 – NGUYÊN LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 24 2.1. Nguyên liệu 24 2.1.1. Nguyên liệu 24 2.1.2. Hóa chất 24 2.1.3. Thiết bị 26 2.2. Phương pháp nghiên cứu 26 2.2.1. Các phương pháp sử dụng để nối ghép gen 26 2.2.2. Biến nạp vào tế bào E. coli và A. tumefaciens 30 2.2.3. Phương pháp điện di trên gel agarose 32 2.2.4. Nhân gen bằng kỹ thuật PCR 33 2.2.5. Phương pháp tách chiết DNA plasmid lượng nhỏ 34 2.2.6. Phân tích DNA plasmid tái tổ hợp bằng enzyme giới hạn 36 2.2.7. Xác định trình tự gen và xử lý số liệu bằng các phần mềm chuyên dụng 37 2.2.8. Phương pháp nuôi nhiễm A. tumefaciens và A. niger 38 Chương 3 – KẾT QUẢ VÀ BÀN LUẬN 41 3.1.1. Lắp ghép xylB vào vector trung gian 44 3.1.2. Lắp ghép cấu trúc biểu hiện hph vào vector trung gian 50 3.1.3. Kiểm tra sự có mặt của cấu trúc biểu hiện xylB và hph trong vector trung gian (pKS_xylB_hph) 56 3.2. Thiết kế Ti plasmid mang hai cấu trúc biểu hiện xylB và hph 57 3.2.1. Lắp ghép đoạn gen mang hai cấu trúc biểu hiện xylB và hph trong vector trung gian vào Ti plasmid 57 3.2.2. Kiểm tra sự có mặt của xylB và hph trong vector tái tổ hợp Ti plasmid 58 3.3. Tạo chủng vi khuẩn A. tumefaciens mang vector biểu hiện pCB_xylB_hph 62 3.3.1. Biến nạp Ti plasmid tái tổ hợp vào A. tumefaciens 62 3.3.2. Kiểm tra sự có mặt của xylB và hph trong Agrobacterium 62 3.4. Kết quả chuyển vector biểu hiện xylB và hph vào A. niger thông qua A. tumefaciens 64 3.4.1. Kết quả nuôi nhiễm 64 3.4.2. Chọn lọc thể nấm chuyển gen trên môi trường kháng sinh 67 KẾT LUẬN 69 KIẾN NGHỊ 70 TÀI LIỆU THAM KHẢO 71

doc74 trang | Chia sẻ: lvcdongnoi | Ngày: 26/01/2013 | Lượt xem: 1776 | Lượt tải: 1download
Bạn đang xem nội dung tài liệu Ảnh hưởng của vi sinh vật tới thực vật, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
uẩn. 2.2.8. Phương pháp nuôi nhiễm A. tumefaciens và A. niger * Chuẩn bị nấm sợi A. niger để thu bào tử Cấy ria từ ống giữ chủng A. niger trong glycerol ở – 80°C lên đĩa nuôi cấy có chứa môi trường PDA. Dịch còn lại giữ ở – 20°C. Ủ đĩa nuôi cấy ở 30°C trong 3 ngày, trong tối. Thu hoạch bào tử nấm: bổ sung 5 ml nước muối sinh lý vô trùng và dùng que trải gạt nhẹ nhàng lên bề mặt thạch để thu bào tử. Chuyển bào tử qua màng lọc vào ống falcon 15 ml và tiếp tục bổ sung thêm 5ml nước muối sinh lý. Ly tâm 10 phút, 8000 v/p, ở nhiệt độ phòng, bỏ dịch nổi và hòa tan cặn trong 1ml nước muối sinh lý. Xác định nồng độ bào tử và pha loãng đến nồng độ cuối cùng là 107 bào tử/ml bằng môi trường IM. * Chuẩn bị chủng A. tumefaciens A. tumefaciens mang Ti plasmid tái tổ hợp được cấy ria lên môi trường LC có bổ sung kháng sinh rifampicin 50 mg/ml để ngăn ngừa sự lây nhiễm các vi khuẩn khác và bổ sung đồng thời cả kanamycin 50 mg/ml để chọn lọc A. tumefaciens có mang Ti plasmid tái tổ hợp. Ủ đĩa ở 28°C trong 2 ngày Nhặt 2 khuẩn lạc trên đĩa nuôi cấy cho vào 20 ml môi trường LC đã bổ sung 50 mg/ml rifampicin và 50 mg/ml kanamycin, nuôi lắc ở 28°C, 250 v/p trong 24 giờ. Ly tâm dich nuôi cấy trong Eppendorf 1.5 ml trong 10 phút, 6000 v/p ở nhiệt độ phòng. Bỏ dịch nổi, thu cặn và tiếp tục rửa cặn bằng cách hòa tan cặn trong 250 µl dung dịch IM. Ly tâm 6000 v/p trong 5 phút ở nhiệt độ phòng, bỏ dịch nổi. Hòa tan cặn trong 5 ml dung dịch IM có chứa 5µl AS nồng độ 0.2M Ủ dịch nuôi cấy ở 28°C từ 4 giờ – 5 giờ, lắc 100 v/p. Đo OD600nm và pha loãng ra nồng độ cuối cùng là 0.8 (4.108 – 5.108 vi khuẩn/ml). * Nuôi nhiễm A. tumefaciens và A. niger: Trộn 100 µl tế bào A. tumefaciens (OD600nm = 0.8) và 100 µl bào tử nấm (nồng độ = 107 bào tử/ml). Sử dụng kẹp vô trùng đặt màng lọc lên đĩa petri có chứa môi trường thạch IM đã bổ sung AS 0.2M. Dùng pipet hút 200 µl hỗn hợp bào tử nấm và vi khuẩn lên trên màng lọc và trải đều bằng que trải. Ủ đĩa ở 24°C trong 3 ngày. * Chọn lọc nấm chuyển gen: Dùng kẹp vô trùng chuyển màng lọc có hỗn hợp dịch nuôi cấy lên đĩa môi trường PDA đã bổ sung cefotaxim (50 mg/ml) và hygromycin (50 mg/ml) Ủ đĩa ở 30°C trong 3 ngày, trong tối cho đến khi xuất hiện bào tử. Nhặt khuẩn lạc sang môi trường chọn lọc để làm sạch và phân lập riêng rẽ từng bào tử. Giữ chủng và tiến hành các thí nghiệm kiểm tra cần thiết Chương 3 – KẾT QUẢ VÀ BÀN LUẬN Gen mã hóa xylanase muốn được chuyển vào nấm mốc A. niger thông qua A. tumefaciens thì phải được gắn vào giữa hai vùng biên phải và trái (LB và RB) của T – DNA trên Ti plasmid. Để giải phóng T – DNA có đoạn DNA ngoại lai, A. tumefaciens được nuôi chung với bào tử nấm trong môi trường có bổ sung chất cảm ứng AS, cảm ứng gen vir để chuyển gen mong muốn sang tế bào chủ. Nấm mốc chuyển gen được chọn lọc dựa trên đặc tính của đoạn DNA ngoại lai hoặc biểu hiện ra sản phẩm protein. Thông thường, cơ thể chuyển gen được chọn lọc trên môi trường có bổ sung kháng sinh thích hợp [8]. Tiến hành khảo sát một số vector pCAMBIA1300, chúng tôi lựa chọn Ti plasmid vector pCB1300 vì vùng T – DNA của vector này có vị trí nhận biết của nhiều enzyme giới hạn phù hợp với chiến lược thiết kế vector đã đặt ra. Để tạo chủng Agrobacterium làm nguyên liệu chuyển gen vào nấm, việc đầu tiên là thiết kế Ti plasmid vector biểu hiện, vector này được kí hiệu pCB_xylB_hph gen mã hóa xylanase (xylB) và gen kháng hygromycin B (hph). Vector tái tổ hợp Ti plasmid được kiểm tra bằng cắt enzyme giới hạn hoặc PCR hoặc giải trình tự gen trước khi chuyển vào Agrobacterium. Chủng vi khuẩn A. tumefaciens mang vector biểu hiện pCB_xylB_hph được nuôi nhiễm với bào tử nấm A. niger. Nấm chuyển gen sẽ được tiếp tục chọn lọc trên môi trường có bổ sung chất kháng sinh thích hợp. Toàn bộ quy trình thiết kế vector biểu hiện gen mã hóa xylanase trong nấm mốc được thể hiện chi tiết qua sơ đồ sau: 3.1. Thiết kế vector trung gian (pKS_xylB_hph) mang hai cấu trúc biểu hiện xylB và hph 3.1.1. Lắp ghép xylB vào vector trung gian Để thiết kế vector trung gian pKS_xylB_hph, xylB và hph được lắp ghép vào vector trung gian pKS–. Tuy nhiên, cấu trúc biểu hiện xylB và hph trong nấm mốc lại nằm trên vector pAN7.1 – GluA. Do vậy, hai cấu trúc trên được đưa lần lượt vào vector trung gian. Trước hết là tiến hành thiết kế vector trung gian mang cấu trúc biểu hiện xylB dựa trên vector pAN7.1 – GluA, tạo thành vector tái tổ hợp được kí hiệu là pAN_xylB. 3.1.1.1. Thiết kế vector tái tổ hợp pAN_xylB mang xylB Muốn gen hoạt động và biểu hiện ra sản phẩm protein, gen phải nằm trong một kết cấu hoàn chỉnh gồm đoạn khởi đầu ở phía trước và đoạn kết thúc ở phía sau gen, đoạn khởi đầu và kết thúc này sẽ điều khiển gen hoạt động trong tế bào chủ thích hợp [6, 22, 39]. Bởi vậy, để xylB biểu hiện được, trình tự DNA mang mã di truyền của xylB phải được lắp ghép đúng chiều vào giữa đoạn khởi đầu và đoạn kết thúc trên vector pAN7.1 – GluA [22]. Trước hết, trình tự của xylB được nối ghép vào vector tách dòng pJET1.2 để nhân lên lượng lớn, sau đó vector tái tổ hợp được cắt bằng enzyme Bgl II để thu lại đoạn gene mang trình tự xylB làm nguyên liệu lắp ghép vào vector pAN7.1 – GluA. Để có thể nối ghép xylB vào vector pAN7.1 – GluA, vector pAN7.1 – GluA phải được cắt mở vòng bằng enzyme giới hạn. Giữa đoạn khởi đầu và đoạn kết thúc điều khiển khiển hoạt động của xylB có vị trí nhận biết của enzyme giới hạn Bam HI, do đó enzyme Bam HI được sử dụng để cắt vector pAN7.1 – GluA. Kb M 1 2 ~ 8,3 kb ~ 0,7 kb 8 0, 75 0,5 Hình 3. 2: Điện di đồ kiểm tra sản phẩm tinh sạch của vector pAN7.1 – GluA và gen mã hóa xylanase M: Marker 1 kb 1: Sản phẩm cắt của vector pAN7.1 – GluA bằng enzyme Bam HI 2: Sản phẩm cắt của gen mã hóa xylanase bằng enzyme Bgl II Vector pAN7.1 – GluA được mở vòng bằng Bam HI nên sản phẩm cắt thu được trên điện di đồ (Hình 3. 2) là một băng duy nhất có kích thước khoảng 8,3 kb. Sản phẩm cắt enzyme của gen mã hóa xylanase có kích thước khoảng 0,7 kb. Hai đoạn DNA này có kích thước phù hợp với lý thuyết. Do đó, chúng sẽ được tinh sạch và nối ghép với nhau nhờ T4 DNA ligase. Do trình tự nhận biết điểm cắt của Bgl II tương đồng với trình tự cắt của Bam HI nên chúng có thể nối ghép dễ dàng. Sản phẩm nối ghép được biến nạp vào E. coli để thu lượng lớn DNA plasmid tái tổ hợp. Trước tiên, các tế bào trong dịch nuôi cấy được thu nhận bằng cách ly tâm thu tủa. Tiếp đó chúng được xử lý bằng dung dịch I (có tác dụng rửa sạch tế bào), sau đó phá màng tế bào bằng dung dịch II. Các cấu trúc của tế bào cũng như các liên kết hydro trong phân tử bị phá vỡ. SDS cùng với EDTA trong dung dịch II còn có vai trò ức chế các nuclease do EDTA liên kết các ion Mg2+ (yếu tố cần thiết cho hoạt động của các nuclease), vì vậy ngăn không cho các nuclease phân giải DNA trong quá trình tách chiết. Tế bào vi khuẩn E. coli có chứa hai dạng DNA: DNA nhiễm sắc thể của E. coli và DNA plasmid nên việc tách riêng, làm sạch DNA plasmid là rất quan trọng. DNA plasmid được tách riêng dựa trên sự khống chế thời gian xử lý các dung dịch I, II, III. DNA nhiễm sắc thể có kích thước phân tử lớn lại liên kết chặt chẽ với protein trong phức chất nucleoprotein nên khoảng thời gian ngắn không kịp thoát ra ngoài. Trong khi đó, các phân tử DNA plasmid mạch vòng đã được giải phóng ra môi trường. Khi môi trường được xử lý tiếp với dung dịch III thì pH môi trường trở về khoảng acid yếu gắn với điểm đẳng điện của DNA. Vì vậy, DNA plasmid dễ bị kết tủa bằng cồn và được kiểm tra kích thước bằng phương pháp điện di trên gel agarose 0,8%. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Hình 3. 3: Điện di đồ kiểm tra plasmid tái tổ hợp mang xylB 1 – 15: Plasmid tái tổ hợp của các dòng khuẩn lạc (kí hiệu pAN_xylB từ (1 – 15)) 16: Đối chứng – vector pAN7.1 – GluA Theo lý thuyết, các plasmid mang đoạn gen ngoại lai sẽ có kích thước lớn hơn plasmid không được chèn thêm đoạn gen ngoại lai (hay được gọi là plasmid gốc). Do vậy, độ cao thấp của các băng trên hình ảnh điện di sản phẩm tách plasmid so với băng đối chứng là cơ sở ban đầu để dự đoán dòng nào đã được chèn thêm đoạn DNA ngoại lai. Trên điện di đồ (Hình 3.3), hầu hết DNA plasmid tái tổ hợp đều cao hơn so với DNA plasmid đối chứng. 4 plasmid có thứ tự từ giếng 1 – 4 tương ứng với các dòng khuẩn lạc có kí hiệu pAN_xylB1; pAN_xylB2, pAN_xylB3 và pAN_xylB4 được tinh sạch và dùng làm khuôn cho PCR sử dụng cặp mồi đặc hiệu cho xylB: XylB – F và XylB – R kiểm tra sự có mặt của xylB trong vector pAN – GluA. Kb M 1 2 3 4 5 ~ 0,7 kb 0,7 Hình 3. 4: Điện di đồ kiểm tra sự có mặt của xylB trong vector tái tổ hợp pAN_xyB bằng PCR M:Marker 1 kb 1 – 5: Sản phẩm PCR của dòng khuẩn lạc pAN_xylB6– 10 Trên điện di đồ (Hình 3. 4), các băng ở giếng 1 – 5 tương ứng với dòng khuẩn lạc pAN_xylB(6 – 10), đều có kích thước khoảng 0,7 kb, bằng với kích thước lý thuyết của gen xylB. Do đó, chúng tôi khẳng định đã nối ghép thành công xylB vào vector pAN7.1 – GluA. PCR được sử dụng để kiểm tra chiều gắn của đoạn xylB trên vector pAN - GluA. Tuy nhiên, PCR bằng cặp mồi đặc hiệu của xylB không thể phân biệt được chiều gắn của xylB vì chúng chỉ nhân lên đúng trình tự của xylB. Kỹ thuật cắt enzyme giới hạn cũng không thể áp dụng được bởi không lựa chọn được enzyme phù hợp. Chính vì thế chúng tôi đã thiết kế mồi SeqXylB – F kết hợp với mồi XylB – R để kiểm tra chiều gắn của xylB bằng kỹ thuật PCR. Mồi SeqXylB – F sẽ bắt cặp với trình tự trên đoạn khởi đầu GpdA của xylB, mồi XylB – R sẽ bắt cặp trên trình tự xylB. Nếu xylB lắp ghép đúng chiều vào giữa đoạn khởi đầu và đoạn kết thúc thì kích thước sản phẩm PCR sẽ khoảng 1,2 kb; ngược lại nếu lắp không đúng chiều PCR sẽ không có sản phẩm. Kb M 1 2 3 4 5 ~ 1,2 kb 1.5 1 Hình 3. 5: Điện di đồ kiểm tra chiều gắn của xylB trong vector tái tổ hợp pAN_xylB bằng PCR sử dụng cặp mồi Seq – F và XylB – R M: Marker 1 kb 1 – 5: Sản phẩm PCR của các dòng pAN_xylB (6 – 10) Sản phẩm PCR của plasmid tái tổ hợp ở giếng số 1 và giếng số 3 (Hình 3. 5) tương ứng với dòng khuẩn lạc có kí hiệu pAN_xylB1 và pAN_xylB3 xuất hiện băng đặc hiệu với kích thước khoảng 1,2 kb. Kích thước này đúng bằng kích thước lý thuyết. Như vậy, chúng tôi đã chọn được dòng plasmid tái tổ hợp mang xylB lắp đúng chiều vào giữa đoạn khởi đầu và đoạn kết thúc trên vector pAN7.1 – GluA. Dòng plasmid pAN_xylB6 và pAN_xylB8 được nuôi lượng lớn và giữ chủng nhằm phục vụ cho các nghiên cứu sau. 3.1.1.2. Lắp ghép xylB trong vector pAN_xylB vào vào vector trung gian Sản phẩm để nối ghép vào vector trung gian pKS– là cấu trúc gồm: đoạn khởi đầu + xylB + đoạn kết thúc (GpdA + xylB + TrypC) hay còn gọi là cấu trúc biểu hiện xylB, cấu trúc này có kích thước khoảng 4,2 kb. Enzyme Eco RI và Sma I được dùng để cắt hoàn toàn cấu trúc (GpdA + xylB + TrypC) trên vector tái tổ hợp pAN_xylB. Theo lý thuyết, sản phẩm cắt enzyme thu được 4 băng, trong đó có hai băng có kích thước tương đương nhau, khoảng 4, 2 kb nên rất khó phân tách. Đó là hai đoạn tương ứng với đoạn gen có cấu trúc biểu hiện xylB và một đoạn khác cũng cắt từ vector pAN_xylB. Vì vậy, plasmid tái tổ hợp cần tiếp tục được kiểm tra lại bằng kỹ thuật PCR và kỹ thuật cắt enzyme giới hạn. Sau khi lựa chọn một số dòng cao hơn đối chứng âm (vector pAN7.1 – GluA). DNA plasmid của các dòng khuẩn lạc này được tinh sạch và kiểm tra sự có mặt của cấu trúc biểu hiện xylB trong vector tái tổ hợp pKS_xylB bằng PCR sử dụng cặp mồi SeqXylB – F và XylB – R. Kb M 1 2 3 4 1,5 1 ~ 1,2 kb Hình 3. 6: Điện di đồ kiểm tra sự có mặt của cấu trúc biểu hiện xylB trên vector trung gian bằng PCR M: Marker 1 kb 1 – 4: Sản phẩm PCR của các dòng khuẩn lạc pKS_xylB(1, 3, 8, 9)) Trên điện đồ (Hình 3. 6), sản phẩm PCR rất đặc hiệu với kích thước khoảng 1,2 kb, sáng và rất đặc hiệu phù hợp với tính toán lý thuyết. Như vật, chúng đã chuyển thành công gen mã hóa xylanase vào vector trung gian pKS-. Như vậy, chúng đã chuyển thành công gen mã hóa xylanase vào vector trung gian và vector này bước đầu được kí hiệu là pKS_xylB. Các plasmid tái tổ hợp được kiểm tra bằng cắt enzyme Sma I và Eco RI. Hai enzyme có điểm cắt ngoại, tức là điểm cắt ở hai đầu đoạn gen ngoại lai trên vector tái tổ hợp pKS_xylB. Theo lý thuyết, sản phẩm cắt enzyme của plasmid tái tổ hợp pKS_xylB sẽ có kích thước khoảng 3 kb và 4,2 kb. pKS pKS pKS M Kb ~ 4,2 kb ~ 3 kb 6 2,5 Hình 3. 7: Điện di đồ kiểm tra plasmid tái tổ hợp pKS_xylB bằng enzyme Sma I và Eco RI M: Marker 1 kb P: plasmid tái tổ hợp pKS_xylB9 pKS: Sản phẩm cắt của khuẩn lạc pKS_xylB bằng enzyme Sma I và Eco RI Vì cấu trúc GpdA promoter + xylB gene + TrypC terminator được cắt bằng Sma I và Eco RI để nối ghép vào vector KS- cũng đã được cắt bằng hai enzyme tương tự nên điểm cắt của hai enzyme này không bị mất đi. Do đó vector tái tổ hợp KS_xylB có thể dễ dàng được kiểm tra sự có mặt của xylB bằng cách cắt kiểm tra bằng Sma I và Eco RI. Sản phẩm cắt enzyme của tất cả các mẫu được kiểm tra trên hình ảnh điện di (Hình 3. 7) đều gồm 2 băng có kích thước phù hợp với tính toán lý thuyế: 4,2 kb (kích thước của đoạn gen ngoại lai (GpdA promoter + xylB gene + TrypC terminator) và khoảng 3 kb (kích thước của vector KS-)). Như vậy, chúng tôi khẳng định đã chuyển thành công cấu trúc (GpdA promoter + xylB gene + TrypC terminator) vào vector trung gian. 3.1.2. Lắp ghép cấu trúc GluA promoter + hph gene + TrypC terminator vào vector trung gian Cấu trúc (GluA promoter + xylB gene + TrypC terminator) đã được lắp ghép thành công vào vector trung gian, tạo thành vector tái tổ hợp pKS_xylB. Tuy nhiên, việc chọn lọc/ sàng lọc các thể tái tổ hợp thông thường cần sự có mặt của các gen chỉ thị như các gen kháng kháng sinh [20]. Trên cơ sở vector pAN7.1 – GluA nhận được từ Phòng Công nghệ sinh học enzyme, chúng tôi tiến hành thiết kế vector tái tổ hợp mang gen kháng kháng sinh (hph) để làm nguyên liệu lắp ghép tiếp vào vector trung gian. 3.1.2.1. Thiết kế vector tái tổ hợp pJET_hph Hph không thể lắp ghép trực tiếp vào vector trung gian vì theo chiến lược thiết kế vector đã đề ra, cấu trúc biểu hiện gen mã hóa xylanase và gen kháng hygromycin B nằm trên vector trung gian sẽ được chuyển vào Ti plasmid bằng cách cắt mở vòng Ti plasmid và vector trung gian bằng enzyme Kpn I do không chọn được enzyme khác thích hợp. Do đó, hai đầu của đoạn gen có cấu trúc biểu hiện xylB và hph trên vector trung gian phải là vị trí nhận biết của Kpn I. Trên vector trung gian đã được ghép nối với xylB chỉ có một điểm cắt của Kpn I. Muốn xuất hiện điểm cắt thứ hai của Kpn I, chúng tôi phải chuyển qua một vector pKS– khác và tạo thành vector tái tổ hợp có kí hiệu pKS_hph. Trên vector pKS– cũng có điểm cắt của Kpn I, tuy nhiên nếu chuyển trực tiếp cấu trúc biểu hiện hph từ vector tái tổ hợp pKS_hph sang vector trung gian sẽ làm mất điểm cắt của Kpn I, hoặc vẫn chỉ có một điểm cắt của Kpn I và vector trung gian được tạo thành sẽ rất khó để tinh chế và nối ghép với Ti plasmid vector vì không có enzyme nào thích hợp cho cả hai vector trên. Do vậy, cấu trúc biểu hiện hph nằm trên vector tái tổ hợp pKS_hph được tách dòng bằng vector pJET1.2. * Lắp ghép hph vào vector pKS– Vector pAN – GluA được cắt bằng enzyme Sma I và Hind III để thu đoạn gen gồm (đoạn khởi đầu GluA + hph + đoạn kết thúc TrypC) và nối ghép với vector nhận pKS– cũng được cắt bằng hai enzyme tương tự. Sản phẩm nối ghép được biến nạp vào E. coli. Các DNA plasmid sẽ được điện di trên gel agarose 0,8 % cùng với đối chứng âm (vector pKS– không có đoạn chèn), một số plasmid đại diện ở các mẫu cao hơn đối chứng âm được dùng để kiểm tra sự có mặt của hph bằng kỹ thuật PCR bằng cặp mồi đặc hiệu của hph: hph1 và hph2. kb M 1 2 3 4 5 6 7 8 9 0,6 Hình 3. 8: Điện di đồ kiểm tra sự có mặt của hph trong vector tái tổ hợp pKS_hph bằng kỹ thuật PCR M: Marker 100bp 1 – 9: sản phẩm PCR của plasmid tái tổ hợp pKS_hph (kí hiệu pKS_hph (1 – 9) Sản phẩm PCR của tất cả các dòng khuẩn lạc đều xuất hiện một băng duy nhất có kích thước khoảng 0,6 kb (Hình 3. 8). Kích thước này phù hợp với kích thước lý thuyết. Do đó, chúng tôi khẳng định đã chuyển được hph vào vector pKS–. DNA của các dòng plasmid tái tổ hợp pKS_hph (1 – 3) được dùng làm khuôn để tổng hợp cấu trúc gen bao gồm (đoạn khởi đầu GluA + hph + đoạn kết thúc TrypC) bằng kỹ thuật PCR sử dụng cặp mồi M13. Sản phẩm PCR nhận được là cấu trúc gồm (đoạn khởi đầu GluA + hph + đoạn kết thúc TrypC) và sản phẩm PCR được dùng làm đoạn chèn vào vector pJET1.2. * Lắp ghép hph trong vector tái tổ hợp pKS_hph vào vector pJET1.2 Theo lý thuyết, sản phẩm PCR khi sử dụng cặp mồi M13 với khuôn là DNA plasmid pKS_hph có kích thước khoảng 2,5 kb. ~2,5kb kb 3 2,5 kb M 1 2 3 Hình 3. 9: Điện di đồ kiểm tra sản phẩm PCR bằng mồi M13 của các plasmid tái tổ hợp pKS_hph 1 – 3: Sản phẩm PCR của các dòng khuẩn lạc (kí hiệu pKS_hph (1–3)) M: Marker 1 kb Kết quả PCR bằng cặp mồi M13 (Hình 3. 9) thu được một băng đặc hiệu có kích thước khoảng 0,6 kb. Sản phẩm PCR được nhân lên bằng enzyme đầu bằng, do đó chúng tôi đã gắn vào vector tách dòng đầu bằng pJET1.2 của hãng Fermentas được sử dụng rộng rãi tại các phòng thí nghiệm trên thế giới. Vector này chứa điểm khởi đầu sao chép nên có khả năng sao chép độc lập với hệ gen của tế bào chủ E.coli. Trên vector có gen kháng chất kháng sinh (bla), nên chỉ có những tế bào nào có mang vector này mới có thể sống được trong môi trường có ampicillin. Đồng thời trên vector pJET1.2 còn chứa gen gây chết eco47IR mã hoá cho enzyme phân huỷ DNA nhân khi tồn tại trong tế bào vật chủ. Vì vậy vector gắn thêm đoạn ngoại lai sẽ làm lệch khung đọc của gen khiến enzyme được tổng hợp không còn hoạt tính như trước nữa. Thêm vào đó, vùng MCS (Multiple Cloning Site) của vector có chứa điểm nhận biết của nhiều enzyme hạn chế như Kpn I, Xho I, Xba I…nhằm phục vụ cho việc cắt kiểm tra sau khi đã tách dòng. Ngoài ra, trên vector mang trình tự hai mồi pJET1.2 xuôi và ngược nằm về hai phía của điểm gắn sản phẩm PCR cho phép nhân đoạn PCR được gắn vào sau tách dòng với số lượng lớn, phục vụ cho việc xác định trình tự gen. Sản phẩm PCR của cấu trúc biểu hiện gen hph được tiến hành gắn với vector pJET1.2, sau đó biến nạp các sản phẩm nối ghép vào tế bào khả biến E.coli chủng DH5α (là loại vi khuẩn được dùng khá phổ biến tại các phòng thí nghiệm vì chúng có khả năng tái bản cao). Các tế bào khả biến sau đó được nuôi cấy trên môi trường LB đặc có bổ sung amp (50 µg/ml) ở 37˚C qua đêm. Kết quả chúng tôi thu được rất nhiều khuẩn lạc và đã tiến hành tách chiết DNA plasmid của các khuẩn lạc này. Sau khi sơ bộ sàng lọc các dòng mang plasmid kích thước lớn hơn vector pJET1.2 (Hình 3. 10), chúng tôi đã xử lý enzyme giới hạn Sma I và Not I với 3 dòng khuẩn lạc pJET_hph (1 – 3). 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Hình 3. 10: Điện di đồ kiểm tra plasmid tái tổ hợp pJET_hph mang cấu trúc (đoạn khởi đầu GluA + hph + đoạn kết thúc TrypC) 1 – 23: DNA plasmid của các dòng khuẩn lạc (kí hiệu là pJET_hph (1 – 23) 24: Đối chứng – vector pJET1.2 Vì ghép nối GluA promoter + hph + TrypC ter vào vector pJET1.2, chúng đã được xử lý với enzyme Sma I và Not I nên điểm cắt của hai enzyme không bị mất đi, chúng trở thành điểm cắt ở hai đầu của đoạn gen ngoại lai chèn vào vector pJET1.2. Trên điện di đồ (Hình 3. 11), sản phẩm cắt của các dòng tái tổ hợp pJET_hph (1 – 3) bằng enzyme Sma I và Not I đều gồm 2 đoạn tương ứng với hai băng có kích thước là 2,5 kb (kích thước của cấu trúc (đoạn khởi đầu GluA + gen hph + đoạn kết thúc TrypC) và 3 kb (kích thước của vecotr pJET1.2). Do đó, chúng tôi khẳng đã lắp ghép thành công cấu trúc biểu hiện gen kháng hygromycin B (GluA promoter + gen hph + TrypC ter) trong vector tái tổ hợp pKS_hph vào vector pJET1.2. Plasmid tái tổ hợp pJET_hph được nuôi lượng lớn để dùng làm nguyên liệu cho thiết kế vector trung gian mang gen mã hóa xylanase và gen kháng hygromycin B pKS_xylB_hph. Kb M 1 2 3 3 2,5 ~ 3 kb ~ 2,5 kb Hình 3. 11: Điện di đồ kiểm tra plasmid tái tổ hợp pJET1_hph bằng cắt enzyme Sma I và Not I M: Marker 1 kb 1 – 3: Sản phẩm cắt của các dòng khuẩn lạc (kí hiệu pJET_hph (1 – 3) bằng Sma I và Not I 3.1.2.2. Lắp ghép cấu trúc biểu hiện hph trong vector tái tổ hợp pJET_hph vào vector trung gian Cấu trúc biểu hiện xylB đã được nối ghép vào vector trung gian mà không làm mất điểm cắt của Sma I và Not I. Hơn nữa, điểm cắt của Kpn I trên vector tái tổ hợp pJET_hph cũng sẽ không bị mất nếu cắt vector tái tổ hợp pJET_hph bằng enzyme Not I vì Not I nằm phía sau Kpn I. Do đó, vector tái tổ hợp pJET1.2 và vector trung gian được cắt bằng enzyme Sma I và Not I, sau đó nối ghép lại với nhau bằng T4 DNA ligase. Sản phẩm nối ghép được biến nạp vào tế bào E. coli. DNA plasmid của các dòng khuẩn lạc đã được tách chiết và kiểm tra sự có mặt của gen mã hóa xylanase và gen kháng hygromycin B bằng kỹ thuật PCR và kỹ thuật cắt enzyme. 3.1.3. Kiểm tra sự có mặt của cấu trúc biểu hiện xylB và hph trong vector trung gian (pKS_xylB_hph) Theo lý thuyết, khi xử lý vector trung gian đã mang cả hai xylB và hph bằng Kpn I, sản phẩm cắt thu được là hai đoạn có kích thước 6,4 kb và 3 kb, trong đó 6,4 kb là kích thước tương ứng với hai cấu trúc biểu hiện xylB và hph và 3 kb là kích thước của vector pKS-. Phản ứng cắt enzyme được thực hiện ở điều kiện nhiệt độ 37°C trong 1,5 giờ. ~ 6,4 ~ 3 kb 1 M 2 3 kb 6 3 Hình 3. 12: Điện di sản đồ sản phẩm cắt plasmid tái tổ hợp pKS_xylB_hph bằng enzyme Kpn I DNA plasmid pKS_xylB_hph M: Marker 1 kb 2 – 3: Sản phẩm cắt của plasmid tái tổ hợp có kí hiệu pKS_xylB_hph(9, 18) bằng enzyme Kpn I Vì kích thước của sản phẩm cắt enzyme lớn, DNA plasmid được điện di cùng để làm đối chứng. Nhờ vậy dễ dàng phân biệt được sản phẩm cắt enzyme trong những trường hợp xử lý enzyme không hoàn toàn hoặc enzyme không hoạt động. Trên điện di đồ (Hình 3. 12), sản phẩm cắt enzyme của 2 dòng plasmid trên giếng số 2 và giếng số 3 gồm hai băng rất rõ nét. Một băng có kích thước khoảng 3 kb (kích thước của vector pKS–); một băng có kích thước 6,4 kb (kích thước của cả cấu trúc biểu hiện xylB và hph có trong vector trung gian). Kích thước này hoàn toàn phù hợp với kích thước lý thuyết. Để khẳng định chính xác trình tự được chuyển vào là trình tự xylB và trình tự hph, dòng plasmid tái tổ hợp có kí hiệu pKS_xylB_hph9 được tiếp tực kiểm tra bằng kỹ thuật PCR. Kb M 1 2 ~ 0,7 kb ~ 0,6 kb 0,6 Hình 3. 13: Điện di đồ kiểm tra sự có mặt của xylB và hph trong vector trung gian pKS_xylB_hph9 M: Marker 100 bp 1: Sản phẩm PCR của hph 2: Sản phẩm PCR của gen xylB Sản phẩm PCR của xylB và hph rất đặc hiệu (Hình 3. 13) và có kích thước đúng bằng kích thước lý thuyết: xylB có kích thước khoảng 0,7 kb và hph có kích thước khoảng 0,6 kb. Do vậy, chúng tôi khẳng định đã thiết kế thành công vector trung gian pKS_xylB_hph mang hai cấu trúc biểu hiện xylB và hph. Dòng plasmid tái tổ hợp có kí hiệu pKS_xylB_hph được nuôi lượng lớn để dùng cho các nghiên cứu thiết kế vector biểu hiện gen mã hóa xylanase. 3.2. Thiết kế Ti plasmid mang hai cấu trúc biểu hiện xylB và hph 3.2.1. Lắp ghép đoạn gen mang hai cấu trúc biểu hiện xylB và hph trong vector trung gian vào Ti plasmid Để thiết kế Ti plasmid tái tổ hợp, vector pCAMBIA1300 được sử dụng làm vector nhận và đoạn chèn được thu nhận lại từ vector trung gian có kí hiệu pKS_xylB_hph cùng được cắt bằng enzyme Kpn I. Kpn I có vị trí cắt ở hai đầu của hai cấu trúc biểu hiện xylB và hph nằm trên vector trung gian, do đó khi xử lý vector trung gian bằng Kpn I, chúng tôi sẽ thu được đoạn gen mong muốn để nối ghép với vector pCB1300, tạo thành vector biểu hiện. Vector này có cấu trúc bao gồm: (đoạn khởi đầu GpdA + xylB + đoạn kết thúc TrypC) và (đoạn khởi đầu GluA + hph + đoạn kết thúc TrypC). Đoạn DNA chèn và vector nhận sau khi được cắt bằng enzyme giới hạn Kpn I và thu lại nhờ tinh chế sản phẩm trên gel agarose sẽ được nối ghép với nhau bằng phản ứng lai dưới sự hỗ trợ của enzyme T4 DNA ligase. Ti plasmid tái tổ hợp tạo thành mang hai cấu trúc biểu hiện gen mã hóa xylanase và gen kháng hygromycin B, có kích thước phân tử khoảng 15,4 kb. Kích thước này lớn hơn so với kích thước của vector pCB1300 do vậy, dưới điện trường, DNA plasmid của Ti plasmid tái tổ hợp pCB_xylB_hph sẽ di chuyển chậm hơn so với DNA plasmid của vector pCB1300. Một số khuẩn lạc được nhặt nuôi trong môi trường LB lỏng có bổ sung kháng sinh kanamycin (50 mg/ml) ở 37°C qua đêm, sau đó kiểm tra DNA plasmid để lựa chọn các dòng cao hơn trên hình ảnh điện ảnh di để tiến hành kiểm tra sự có mặt của xylB trong Ti plasmid tái tổ hợp. 3.2.2. Kiểm tra sự có mặt của xylB và hph trong vector tái tổ hợp Ti plasmid Dòng khuẩn lạc có kí hiệu pCB_xylB_hph lần lượt được cắt kiểm tra bằng một enzyme là Kpn I, Bgl II và kết hợp hai enzyme Bgl II và Nco I. Enzyme giới hạn Kpn I để dùng để cắt vector trung gian pKS_xylB_hph với mục đích tinh chế đọan gen cần nối ghép với vector pCB1300 và vector nhận pCB1300 cũng được cắt mở vòng bằng Kpn I nên điểm cắt của Kpn I không bị mất. Vì vậy, khi xử lý DNA plasmid tái tổ hợp pCB_xylB_hph bằng enzyme giới hạn Kpn I, kết quả thu được là hai đoạn gen có kích thước là 9 kb và 6,4 kb tương ứng với kích thước của pCB1300 và đoạn gen mang hai cấu trúc biểu hiện xylB và hph. Trên hình ảnh điện di (Hình 3. 14), sản phẩm cắt DNA plasmid tái tổ hợp bằng enzyme Kpn I gồm hai băng với kích thước phù hợp với tính toán lý thuyết. Vector pCB1300 được dùng để làm đối chứng chỉ có một băng duy nhất với kích thước khoảng 9 kb. Như vậy, chúng tôi khẳng định đã chuyển được toàn bộ kết cấu gen mã hóa xylanase và gen kháng hygromycin B vào Ti plasmid. ~15,4 ~10,7 ~ 9 ~ 6,4 ~ 4,7 1 2 3 4 5 6 M 7 8 kb Hình 3. 14: Điện di đồ sản phẩm cắt enzyme của Ti plasmid tái tổ hợp mang hai cấu trúc biểu hiện gen xylB và hph 1: Vector pCB1300 đối chứng 2: Ti plasmid pCB_xylB_hph đối chứng 3: pCB1300 cắt bằng Kpn I 4: Plasmid pCB_xylB_hph cắt bằng Kpn I 5: pCB1300 cắt bằng Bgl II 6: Plasmid pCB_xylB_hph cắt bằng Bgl II M: Marker 1 kb 7: Plasmid pCB_xylB_hph cắt bằng Bgl II và Nco I 8: pCB1300 cắt bằng Bgl II và Nco I Tiến hành khảo sát thêm một số điểm cắt của enzyme giới hạn trên vector tái tổ hợp pCB1300_xylB_hph, enzyme Bgl II và Nco I được dùng để cắt điểm cắt nội trên đoạn gen mang hai cấu trúc (GpdA promoter + xylB gene +trypC terminator) và (GluA promoter + hph gene + TrypC terminator). Vì Bgl II có vị trí nhận biết trên gen mã hóa xylB, nên Bgl II sẽ cắt mở vòng vector tái tổ hợp pCB1300_xylB_hph. Vector pCB1300 không có vị trí cắt của Bgl II do đó, DNA plasmid của pCB1300 sẽ không bị cắt, trên điện di đồ vẫn là sản phẩm DNA plasmid tái tổ hợp. Tương tự, Nco I có vị trí nhận biết trên gen mã hóa hph nên khi xử lý DNA plasmid tái tổ hợp bằng Bgl II và Nco I, kết quả sẽ gồm hai băng có kích thước khoảng 10,6 kb và 4,7 kb. Đồng thời, vector pCB1300 được cắt cùng với Ti plasmid tái tổ hợp pCB_xylB_hph để làm đối chứng. Với cả hai phương án xứ lý bằng enzyme giới trên đều không có điểm cắt trên vector pCB1300 do đó dễ dàng nhận thấy sự khác biệt giữa sản phẩm cắt của vector pCB1300 và vector lasmid tái tổ hợp pCB1300_xylB_hph trên điện di đồ. Như vậy, chúng tôi có thể khẳng định đã chuyển được đoạn gen mang hai cấu trúc biểu hiện xylB và hph vào vector pCB1300. DNA plasmid tái tổ hợp được tách chiết lượng lớn và tinh sạch cho phản ứng xác định trình tự. Đoạn gen quan tâm được xác định trình tự theo phương pháp Sanger trên máy xác định trình tự tự động ABI Avant 3100. Trình tự nucleotide của mỗi mẫu được xác định cả hai chiều xuôi và chiều ngược. Trình tự được xử lý bằng các phần mềm ABI PRIMS 3100 Avant Data Collection v1.0 và DNA Sequencing Analysis v5. 2. Trình tự gen thu được tiếp tục được so sánh với các trình tự chuẩn trong ngân hàng gen Quốc tế EMBL/ Genbank/ DDBJ hoặc các trình tự ban đầu của gen nhờ các phần mềm Seqscrape v2. 6 và Bioedit v7. 0. 9 để kiểm tra độ chính xác của trình tự gen. 10 20 30 40 50 60 ....|....|....|....|....|....|....|....|....|....|....|....| XylB ATGCTCACCAAGAACCTTCTCCTCTGCTTTGCCGCGGCTAAGGCTGCTCTGGCTGTCCCC M L T K N L L L C F A A A K A A L A V P 70 80 90 100 110 120 ....|....|....|....|....|....|....|....|....|....|....|....| XylB CACGACTCTGTCGCCCAGCGTTCGGATGCCTTGCACATGCTCTCTGAGCGCTCGACCCCG H D S V A Q R S D A L H M L S E R S T P 130 140 150 160 170 180 ....|....|....|....|....|....|....|....|....|....|....|....| XylB AGCTCGACCGGCGAGAACAACGGCTTCTACTACTCCTTCTGGACCGACGGCGGTGGCGAC S S T G E N N G F Y Y S F W T D G G G D 190 200 210 220 230 240 ....|....|....|....|....|....|....|....|....|....|....|....| XylB GTGACCTACACCAACGGAGATGCTGGTGCCTACACTGTTGAGTGGCCCAACGTGGGCAAC V T Y T N G D A G A Y T V E W P N V G N 250 260 270 280 290 300 ....|....|....|....|....|....|....|....|....|....|....|....| XylB TTTGTCGGTGGAAAGGGCTGGAACCCCGGAAGTGCGCAGGACATCACCTACAGCGGCACC F V G G K G W N P G S A Q D I T Y S G T 310 320 330 340 350 360 ....|....|....|....|....|....|....|....|....|....|....|....| XylB TTCACCCCTAGCGGCAACGGCTATCTCTCCGTCTATGGCTGGACCACTGACCCCCTGATC F T P S G N G Y L S V Y G W T T D P L I 370 380 390 400 410 420 ....|....|....|....|....|....|....|....|....|....|....|....| XylB GAGTACTACATCGTCGAGTCCTACGGCGACTACAACCCCGGCAGTGGAGGCACATACAAG E Y Y I V E S Y G D Y N P G S G G T Y K 430 440 450 460 470 480 ....|....|....|....|....|....|....|....|....|....|....|....| XylB GGCACCGTCACCTCGGACGGATCCGTTTACGATATCTACACGGCTACCCGTACCAATGCT G T V T S D G S V Y D I Y T A T R T N A 490 500 510 520 530 540 ....|....|....|....|....|....|....|....|....|....|....|....| XylB GCTTCCATTCAGGGAACCGCTACCTTCACTCAGTACTGGTCCGTCCGCCAGAACAAGAGA A S I Q G T A T F T Q Y W S V R Q N K R 550 560 570 580 590 600 ....|....|....|....|....|....|....|....|....|....|....|....| XylB GTTGGCGGAACTGTTACCACCTCCAACCACTTCAATGCTTGGGCTAAGCTGGGAATGAAC V G G T V T T S N H F N A W A K L G M N 610 620 630 640 650 660 ....|....|....|....|....|....|....|....|....|....|....|....| XylB CTGGGTACTCACAACTACCAGATCGTGGCTACCGAGGGTTACCAGAGCAGTGGATCTTCG L G T H N Y Q I V A T E G Y Q S S G S S 670 ....|....|....|... XylB TCCATCACTGTTCAGTAA S I T V Q * Hình 3. 15: Trình tự gen và trình tự amino acid của gen xylanase Chúng tôi sử dụng phần mềm Bioedit để phân tích và so sánh trình tự giải mã được của xylB với các trình tự gen này đã công bố trên ngân hàng gen EMBL. Kết quả, đoạn gen đã được giải mã có độ dài 678 bp, mã hóa cho 205 amino acid (23 kDa). Như vậy, gen mã hóa xylanase được chuyển vào nấm sẽ là mã hóa enzyme xylanase thuộc họ 11. Đây là những enzyme rất đặc hiệu trong việc phân hủy xylan [13, 29]. Như vậy, chúng tôi đã thiết kế thành công Ti plasmid tái tổ hợp mang hai cấu trúc biểu hiện gen xylanase và gen kháng hygromycin B. Vector này còn được gọi là vector biểu hiện gen mã hóa xylanase. 3.3. Tạo chủng vi khuẩn A. tumefaciens mang vector biểu hiện pCB_xylB_hph 3.3.1. Biến nạp Ti plasmid tái tổ hợp vào A. tumefaciens Để tạo ra được nguyên liệu chuyển gen thực vật, Ti plasmid tái tổ hợp pCB_xylB_hph phải được chuyển vào một tế bào để làm ổn định nguồn gen. Hơn nữa, tế bào sinh vật này phải có khả năng chuyển gen quan tâm vào vật chủ mong muốn. Cho đến nay, chuyển gen nhờ Agrobacterium đã và đang được áp dụng rộng rãi trong chuyển gen vào thực vật và một số vi sinh vật chẳng hạn như nấm, vi khuẩn. Các nghiên cứu trên thế giới về thiết kế vector tái tổ hợp biểu hiện trong nấm thường sử dụng đoạn khởi đầu GpdA promoter. GpdA là một promoter đặc hiệu cho nấm. Promoter này có nguồn gốc từ A. nidulans và A. bisporus [22]. Phương pháp biến nạp được sử dụng phổ biến là sốc nhiệt tuy nhiên hiệu suất không cao bằng phương pháp xung điện. Hơn nữa vector biểu hiện có kích thước lớn do đó chúng tôi đã lựa chọn phương pháp xung điện để biến nạp vào A. tumefaciens và sử dụng chủng vi sinh vật này làm nguyên liệu chuyển gen vào nấm sợi. Chủng A. tumefaciens được sử dụng là chủng có mang một loại plasmid trợ giúp (helper plasmid) mà trên plasmid có mang gen kháng ampicillin, plasmid này hỗ trợ chuyển T – DNA vào tế bào chủ, do đó trên môi trường chọn lọc cho A. tumefaciens, ngoài rifamycin, chúng tôi còn bổ sung thêm kháng sinh ampicillin để chọn lọc cho chủng có mang plasmid trợ giúp. Sau khi biến nạp, tế bào mang vector biểu hiện được chọn lọc trên môi trường YEB đặc có bổ sung kháng sinh rifamycin, ampicillin để chọn lọc A. tumefaciens và kanamycin để chọn lọc A. tumefaciens có mang plasmid tái tổ hợp. 3.3.2. Kiểm tra sự có mặt của xylB và hph trong Agrobacterium Các dòng plasmid tái tổ hợp trước tiên được cắt kiểm tra bằng enzyme giới hạn Kpn I. Các khuẩn lạc A. tumefaciens có chứa Ti-plasmid tái tổ hợp tạo được nhờ xung điện được phát hiện bằng phương pháp chọn lọc trên môi trường đặc hiệu, tách chiết DNA plasmid và tiếp tục được biến nạp trở lại tế bào E. coli và tiến hành các thí nghiệm phân tích phân tử tiếp theo. Sở dĩ cần phải thực hiện bước biến nạp trở lại DNA plasmid vào trong tế bào vi khuẩn E. coli vì số lượng bản sao của plasmid tái tổ hợp này trong tế bào Agrobacterium rất ít, không đủ để tiến hành các thí nghiệm kiểm tra sự có mặt của các kết cấu gen đưa vào. Các plasmid dự đoán có mang vector biểu hiện pCB1300_xylB_hph được tinh sạch và dùng làm khuôn cho phản ứng PCR với hai cặp mồi nhân xylB và hph. Kết quả PCR trên hình 3. 16 cho thấy, chúng tôi đã đưa được plasmid tái tổ hợp pCB_xylB_hph vào trong tế bào A. tumefaciens. Các dòng sau biến nạp được dùng làm nguyên liệu để chuyển vào nấm. 0,6 ~ 0,7 1 2 3 4 5 6 7 M kb Hình 3. 16: Điện di đồ kiểm tra sự có mặt của xylB trong Agrobacteirum bằng PCR 1–7: Sản phẩm PCR của plasmid tái tổ hợp tách từ Agrobacterium M: Marker 100 bp Vì cấu trúc biểu hiện gen xylB đã được chuyển cùng với cấu trúc biểu hiện gen hph vào A. tumefaciens. Do vậy, dòng plasmid tái tổ hợp tách từ Agrobacterium tiếp tục được kiểm tra bằng PCR sử dụng cặp mồi đặt hiệu của gen hph. Trên điện đồ (Hình 3. 17) sản phẩm PCR rất đặc hiệu với kích thước khoảng 0,6 kb. PCR là phương pháp đơn giản, hiệu quả và nhanh chóng để xác định chính xác cấu trúc của gen đã chuyển vào Agrobacterium. 1 2 3 4 5 6 7 M kb ~ 0,6 kb 0,6 Hình 3. 17: Điện di đồ kiểm tra sự có mặt của hph trong Agrobacteirum bằng PCR 1–7: Sản phẩm PCR của gen hph M: Marker 100 bp Như vậy, chúng tôi đã tạo được chủng Agrobacterium CV58C1 - pGV2260 mang vector biểu hiện pCB_xylB_hph. Các dòng khuẩn lạc sau khi kiểm tra sẽ được lưu giữ để làm nguyên liệu chuyển gen vào nấm. 3.4. Kết quả chuyển vector biểu hiện xylB và hph vào A. niger thông qua A. tumefaciens 3.4.1. Kết quả nuôi nhiễm Nồng độ bào tử thích hợp để nuôi nhiễm với Agrobacterium khoảng 108 bào tử/ml. Tế bào Agrobacterium đã được hoạt hóa trong môi trường IM lỏng có bổ sung AS. Nhờ sự có mặt của chất cảm ứng AS, các gen vir trở nên hoạt hóa, và quá trình chuyển gen vào nấm mốc được diễn ra dưới sự hỗ trợ của các gen vir. Bào tử nấm và tế bào Agrobacterium được nuôi nhiễm theo nhiều tỷ lệ khác nhau: 1: 1; 1: 3 và 1: 5. Hỗn hợp Agrobacterium và A. niger được trải đều lên màng lọc đã được đặt sẵn trên bề mặt của hai loại môi trường, môi trường IM đặc có bổ sung AS và môi trường IM đặc không bổ sung AS. Đĩa nuôi nhiễm được ủ ở 24 °C trong 3 ngày. Kết quả thu được rất khác nhau trên các đĩa nuôi nhiễm với tỷ lệ khác nhau. Ở đĩa nuôi nhiễm theo tỷ lệ 1:1 và 1: 3 xuất hiện ít nấm, chúng phát triển không đều so với đĩa nuôi nhiễm theo tỷ lệ 1: 5 (Hình 3. 18). Theo Beijersbergen và các tác giả khác (2001), tỷ lệ nuôi nhiễm giữa A. niger và Agrobacterium là 1 : 1 [9]; theo Sugui và các tác giả khác (2004), tỷ lệ nuôi nhiễm A. fumigatus và Agrobacterium là 1 : 10 [16]. Sau 3 ngày nuôi cấy ở 37°C, bào tử nấm đã xuất hiện tương đối nhiều trên tất cả các đĩa nuôi cấy. Sự phát triển mạnh của bào tử nấm có thể do nồng độ bào tử nấm ban đầu bổ sung trong giai đoạn nuôi nhiễm quá cao, hoặc thời gian nuôi cấy quá dài và ở nhiệt độ cao. Điều này có thể khắc phục được bằng cách giảm nồng độ bào tử nấm nuôi nhiễm, giảm thời gian và nhiệt độ nuôi nhiễm [11]. A B B Hình 3. 18: Kết quả nuôi nhiễm Agrobacterium và A. niger trên hai loại môi trường khác nhau A: Môi trường IM có bổ sung AS B: Môi trường IM không bổ sung AS. Đĩa nuôi nhiễm được nuôi ở 24°C trong 3 ngày kết quả thu được không cao. Nguyên nhân có thể do nhiệt độ và thời gian cho quá trình nuôi nhiễm chưa tối ưu. Theo Beijersbergen và các tác giả khác (2001), điều kiện nuôi nhiễm giữa A. niger và Agrobacterium là 2 ngày ở nhiệt độ phòng [9]. Theo Michielse và các tác giả khác (2008), nhiệt độ tối ưu cho quá trình nuôi nhiễm là từ 20°C – 25°C [11, 12]. Song, có thể nhiệt độ nuôi nhiễm khác nhau khi sử dụng các loài nấm khác nhau, chẳng hạn như, theo nghiên cứu của Sugui và các tác giả khác (2004), nhiệt độ tối ưu cho giai đoạn nuôi nhiễm Agrobacterium và A. awamori là 24°C trong 2 ngày [16]. Tỷ lệ bào tử nấm xuất hiện trên môi trường nuôi nhiễm có bổ sung AS mọc tốt hơn so với môi trường không bổ sung AS. Kết quả này hoàn toàn phù hợp với nhiều nghiên cứu về chuyển gen vào nấm nhờ Agrobacterium trên thế giới [9, 11, 12]. Theo Beijersbergen và các tác giả khác (2001), AS ảnh hưởng rõ rệt lên hiệu suất nuôi nhiễm giữa A. niger và Agrobacterium. Trên môi trường chọn lọc thể chuyển gen đã không xuất hiện khuẩn lạc nào nếu trong giai đoạn nuôi nhiễm không được bổ sung thêm AS. Ngược lại, nếu giai đoạn nuôi nhiễm có bổ sung AS thì xuất hiện 5 - 6 khuẩn lạc trên môi trường chọn lọc bằng kháng sinh kháng hygromycin B [9]. Kết quả này cũng tương tự với kết quả của Wang và các tác giả khác (2008) khi nghiên cứu chuyển gen vào nấm P. digitatum thông qua Agrobacterium [17]. Theo nghiên Michielse và cs (2008), AS ảnh hưởng và cần thiết trong giai đoạn cùng nuôi, bởi nó cảm ứng gen vir chuyển T – DNA vào tế bào chủ, mặc dù AS không thật sự cần thiết trong giai đoạn chuẩn bị nguyên liệu nuôi nhiễm [9, 11]. Mặc dù hiệu suất chuyển gen vào nấm sợi thông qua Agrobacterium có thể bị ảnh hưởng bởi nhiều yếu tố, tuy nhiên, rõ ràng có thể thấy AS làm giảm hiệu suất chuyển gen. Do vậy, bổ sung AS trong giai đoạn nuôi nhiễm là cần thiết để đạt hiệu suất chuyển gen cao nhất [9, 11, 12]. Khảo sát ảnh hưởng của màng lọc lên hiệu suất nuôi nhiễm, chúng tôi thử nghiệm hai loại màng lọc là cellulose và nitrocellulose. Kết quả là bảo tử đều mọc trên cả hai loại màng lọc, tuy nhiên chúng có sự phân bố khác nhau. Trên đĩa được sử dụng màng cellulose, nấm phát triển tốt hơn và mọc đều hơn trên khắp bề mặt giấy, trên đĩa được sử dụng màng nitrocellulose, nấm phát triển yếu hơn và thành từng cụm với màu đen sẫm so với đĩa nuôi nhiễm dùng màng cellulose. Qua kết quả nuôi nhiễm trên hai loại màng lọc, nuôi nhiễm trên màng cellulose nấm mọc tốt hơn so với màng nitrocellulose. Mặc dù màng lọc nitrocellulose được sử dụng phổ biến nhất trong nuôi nhiễm với A. tumefaciens và nấm sợi [16], song trong một số nghiên cứu, hiệu suất chuyển gen rất thấp khi dùng màng nitrocellulose [12]. Không chỉ vậy, theo nghiên cứu của Sugui và các tác giả khác (2004), hiệu suất nuôi nhiễm trên màng nitrocellulose thấp hiệu suất nuôi nhiễm trên cellulose, chẳng hạn như nuôi nhiễm Agrobacterium với A. fumigatus trên màng nitrocelluse đã không xuất hiện khuẩn lạc nào [16]. Tuy nhiên, theo Michielse và các tác giả khác (2005), hiệu suất chuyển gen thấp hơn khi nuôi nhiễm trên màng nitrocellulose hoặc Hybon C, ví dụ như khi nuôi nhiễm Agrobacterium và A. infestans trên màng nitrocellulose, kết quả là không xuất hiện khuẩn lạc nào nhưng kết quả lại hoàn toàn ngược lại khi thay màng nitrocellulose bằng màng Nytran hoặc Hybon N+ [12]. Nguyên nhân của sự khác nhau trên đến nay vẫn chưa được biết rõ, song có thể thành phần hóa học của màng lọc ảnh hưởng đến sự phân bố và phát triển của Agrobacterium và bào tử nấm cũng như ức chế sự tương tác để vận chuyển T – DNA dẫn đến làm giảm hiệu suất chuyển gen [16]. 3.4.2. Chọn lọc thể nấm chuyển gen trên môi trường kháng sinh Các đĩa nuôi nhiễm theo tỷ lệ 1 : 5 trên môi trường có bổ sung AS sẽ được dùng cho nghiên cứu chọn lọc thể nấm chuyển gen trên môi trường chọn lọc có bổ sung kháng sinh hyhromycin và cefotaxim. Màng lọc từ các đĩa nuôi nhiễm được tiếp tục sang môi trường chọn lọc PDA có bổ sung hygromycin (50mg/ml) và cefotaxim (50 mg/ml). PDA là môi trường đặc hiệu cho sự phát triển của nấm và hygromycin B là kháng sinh ức chế sự phát triển của nấm [18]. Màng lọc được chuyển sang môi trường chọn lọc và đĩa được ủ ở 37°C trong 3 ngày. Chúng tôi mới chỉ chọn được một khuẩn lạc duy nhất xuất hiện trên đĩa. Để sống sót trên môi trường có hygromycin, khuẩn lạc này chắc chắn phải mang gen kháng hygromycin, hơn nữa phải kháng lại cả cefotaxim vì cefotaxim là chất kháng sinh ức chế sự phát triển của Agrobacterium [11]. Do đó có thể khẳng định, khuẩn lạc trên không phải là Agrobacterium mà là dòng khuẩn lạc của nấm mang gen kháng hygromycin B. Kết quả nuôi nhiễm trong nghiên cứu tương đối thấp so với hiệu suất chyển gen của các nghiên cứu khác trên thế giới. Hiệu suất chuyển gen vào P. digitatum nhờ vi khuẩn Agrobacterium rất cao, từ 97% – 100% [17]. Kết quả nuôi nhiễm không cao có thể do giai đoạn chuẩn bị vật liệu chủng giống không tốt, hoặc do chủng giống Agrobacterium không phù hợp với A. niger. Theo Beijersbergen và các tác giả khác (2001), chuyển gen vào nấm mốc A. niger, chủng Agrobacterium được sử dụng để nuôi nhiễm là LBA1100 [9]. Chuyển gen vào nấm mốc A. awamori, chủng Agrobacterium được sử dụng là các chủng có kí hiệu LBA100a, LBA1119 hay EHA105, LBA1126 [12]. Nhiều nghiên cứu chứng minh, chuyển gen vào nấm thông qua Agrobacterium A281 có hiệu suất cao hơn so với các chủng khác, chẳng hạn như chuyển gen vào Criphonectria paratosis thông qua Agrobacterium A281 có hiệu suất cao hơn Agrobacterium LBA4404 [12]. Sự phát triển mạnh của nấm cũng có thể ảnh hưởng đến hiệu suất chuyển gen do sự cạnh tranh dinh dưỡng. Hơn nữa, chủng nấm để nuôi nhiễm khi được chuẩn bị mới sẽ cho hiệu suất cao hơn so với vật liệu bảo quản trong thời gian dài [1]. Bào tử nấm dùng trong nuôi nhiễm đã được bảo quản ở 4°C trong 1 tuần, do đó có thể đây cũng là nguyên nhân ảnh hưởng đến kết quả nuôi nhiễm. Ngoài ra, giai đoạn xử lý Agrobacterium để thu cặn tế bào cũng có thể ảnh hưởng đến Ti plasmid, dẫn đến hiệu suất nuôi nhiễm thấp. Nấm chuyển gen sau khi chọn lọc trên môi trường có bổ sung kháng sinh hygromycin B sẽ tiếp tục được nuôi lượng lớn trong môi trường DPA lỏng để thu cặn tế bào. DNA tổng số tách từ khuẩn lạc này được dùng làm khuôn cho phản ứng PCR. Trên hình ảnh điện di, sản phẩm PCR cuả gen kháng hygromycin B thu được rất đặc hiệu, tương ứng với kích thước 0,6 kb. Điều này cho thấy, chúng tôi đã chuyển thành công thành công vector biểu hiện vào nấm mốc A. niger thông qua vi khuẩn A. tumefaciens. Hiện nay, chuyển gen nhờ vi khuẩn Agrobacterium không chỉ giới hạn ở một số loài nấm thuộc chi Aspergillus [3] mà nó còn được áp dụng trên nhiều loài nấm khác nhau như P. digitatum, M. circinelloides, C. albicals [1, 2, 38]. Trong nghiên cứu, A. niger được sử dụng làm tế bào chủ để chuyển gen bởi nó là loài an toàn, cho năng suất và chất lượng enzyme xylanase, và đây là loài rất phổ biến trong tự nhiên[8]. KẾT LUẬN Đã thiết kế thành công vector biểu hiện (Ti plasmid tái tổ hợp) được kí hiệu là pCB_xylB_hph mang gen mã hóa xylanase và gen kháng hygromycin B trên cơ sở vector trung gian pKS_xylB_hph. Đã tạo được chủng vi khuẩn Agrobacterium mang vector biểu hiện gen mã hóa xylanase pCB_xylB_hph để làm nguyên liệu chuyển gen vào nấm. Bước đầu xây dựng quy trình nuôi nhiễm A. tumefaciens mang Ti plasmid tái tổ hợp pCB_xylB_hph và bào tử nấm A. niger. Bước đầu chọn lọc được nấm mốc A. niger chuyển gen trên môi trường chọn lọc bằng kháng sinh hygromycin B. KIẾN NGHỊ Tiếp tục hoàn thiện quy trình chuyển gen mã hóa xylanase vào nấm mốc A. niger thông qua A. tumefaciens. Kiểm tra nấm chuyển gen bằng kỹ thuật PCR sử dụng cặp mồi đặc hiệu cho hph và xylB. Xác định hoạt tính của enzyme xylanase trong môi trường có bổ sung cơ chất thích hợp. TÀI LIỆU THAM KHẢO Tiếng Việt Lê Trần Bình, Phan Văn Chi, Nông Văn Hải, Trương Nam Hải, Lê Quang Huấn (2003), Áp dụng kỹ thuật sinh học phân tử trong nghiên cứu tài nguyên sinh vật Việt Nam, Nhà xuất bản Khoa học và Kỹ thuật Hà Nội. Lê Trần Bình, Hồ Hữu Nhị, Lê Thị Muội (1997), Công nghệ sinh học thực vật trong cải tiến giống cây trồng, Nhà xuất bản Nông nghiệp, tr. 72 – 74. Lê Thị Thu Hiền (2003), “Tạo chủng vi khuẩn Agrobacterium tumefaciens mang gen kháng côn trùng để chuyển vào cây trồng”, Luận văn Tiến sĩ sinh học, Viện Công nghệ sinh học, Hà Nội. Nguyễn Sỹ Lê Thanh, Quyền Đình Thi (2009), “Nhân dòng và phân tích trình tự gen mã hóa xylanase từ A. niger DSM1957”, Báo cáo Hội nghị Công nghệ Sinh học toàn quốc, Nhà xuất bản Đại học Thái Nguyên, tr. 701 – 704. Nguyễn Thị Thu Thủy, Nguyễn Văn Thuật, Đỗ Thị Tuyên, Quyền Đình Thi (2009), “Biểu hiện và đánh giá tính chất hóa lý của xylanase tái tổ hợp từ chủng A. oryzae VTCC – F187 trong Pichia pastoris GS115”, Báo cáo Hội nghị Sinh học toàn quốc, Nhà xuất bản Đại học Thái Nguyên, tr. 710 – 714. Tiếng Anh Alasdair D. I., Bruun R. T. (2000), Promoter, Patent WO 0078975. Angeles J. G. C., Laurena A. C., Tecson M. E. M. (2005) “Extraction of genomic DNA from the lipid – polysaccharide, and polyphenol – rich coconut (Cocos nucifera L.)”, Plant Molecular Biology Reporter, 23, pp. 297a – 297. Krisana A., Rutchadaporn S., Jarupan G., Lily E., Sutip T., Kanyawim K. (2004), “Endo–1,4–ß–xylanase B from Aspergillus cf.niger BCC14405 isolated in Thailand: purification, characterization and gene isolation”, Journal of Biochemistry and Molecular Biology, 38 (1), pp. 17 – 23. Beijersbergen (2001), United States Patent, US 6.255.155 B1. Ruiz – Diez B. (2002), “Strategies for the transformation of filamentous fungi: A reviews”, Journal of Applied Microbiology, 92, pp. 189 – 195. Michielse B. C, Hooykaas P. J. J., van den Hondel C. A. M. J. J. , Ram F. J. A. (2008), “Agrobacterium – mediated transformation of the filamentous fungus Aspergillus awamori”, Protocol. Michielse B. C., Hooykaas P. J. J., van den Hondel C. A. M. J. J., Ram F. J. A. (2005), “Agrobacterium – mediated transformation as a tool for functional genomics in fungi”, Review article. Chantasingh D., Pootanakit K., Champreda V., Kanokratana P., Eurwilaichitr L. (2005), “Cloning, expression, and characterization of a xylanase 10 from Aspergillus terreus (BCC129) in Pichia pastoris”, Protein Expression and Purification, 46, pp. 143 – 149. Holster M., De Waele D., Depicker A., Messens E., Van Montagu M., Schell J. (1987), “Transfection and transformation of A. tumefaciens”, Molecular and General Genetics 163, pp. 181–187. Nyilasi I. (2004), “Investigation of the application of the Agrobacterium – mediated transformation in Zygomycetes”, Acta Biologica Szegediensis, 48 (1–4): 73. Sugui A. Z, Chang C. Y., Kwon–Chung K.J. (2004), “Agrobacterium tumefaciens – mediated transformation of Aspergillus fumigatus: an efficient tool for insertional mutagenesis and targeted gene disruption”, Applied and Environmental Microbiology, 71 (4), pp. 1798 – 1802. Wang Z-Y., Li H-Y. (2008), “Agrobacterium tumefaciens – mediated genetic transformation of the phytopathogenetic fungus Penecillium digitatum”, Journal of Zhejiang University SCIENCE B, 9(10), pp. 823–828. Nyilas I., Acs K., Papp T., Nagy E., Vagvolgyi C. (2005), “Agrobacterium tumefaciens – mediated transformation of Mucor circinellnoides”, Fonia Microbiology, 50 (5), pp. 415 – 420. Hanif M. (2004), Chracterization of small GTPase Cdc42 from the ectomycorrhizal fungus Suillus bovinus and Agrobacterium tumefaciens – mediated transformation of fungi, University of Helsinki. Kheng P. P., Omar C. I. (2004), “Xylanase production by a local fungal isolate, Aspergillus niger USM AI 1 via solid state fermentation using palm kernel cake (PKC) as substrate”, Songklanakarin Journal Science Technology, 27 (2), pp. 325 – 336. Deng P., Li D., Cao Y., Lu W., Wang C. (2006), “Cloning of a gene encoding an acidophilic endo – ß – 1,4 – xylanase obtained from Aspergillus niger CGMCC1067 and constitutive xpression in Pichia pastoris”, Enzyme and Microbial Technology, 39, pp. 1096 – 1102. Romaine (2005), United States Patent, US 6, 964, 866 B2. Beg Q. K., Kapoor M., Mahajan L., Hoondal G. S.(2001), “Microbial xylanase and their industrial application: A review”, Applied Microbial Biotechnology, 56, pp. 326– 338. Sambrook J., Fritsch E.F., Maniatis T. (2001), "Molecular Cloning: A laboratary manual". Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Stewart C.N.Jr., Via L.E.(1993) A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR applications, BioTechniques, 14, pp. 748–751. Stanton B Gelvin, (2003), “Agrobacterium mediated plant transformation: the biology behind the “Gene – Jockeying” tool”, Microbiology and Molecular Biology Reviews, 67(1), pp. 16 – 37. Cosson T., Pe’rez A.M., Vendrell, Gonza’lez Teresa B., Rene D., Taillade P., Brufau J. (1999), “Enzymatic assays for xylanase and ß–glucanase feed enzyme”, Animal Feed Science and Technology, 77, pp. 345 – 353. Krengel U., Dijkstra W. B. (1996), “Three – dimensional structure of endo – 1,4 – ß – xylanase I from Aspergillus niger: Molecular basis for its low pH optimum”, Journal of Molecular Biology, 263, pp. 70 – 78. Degefu Y. (2003), Cloning and characterization of xylanase gene from phytopathogenetic fungi with a special reference to Helminthosporium turcicum, the cause of the northern leaf blight of maize, University of Helsinki. Lu L., Yang Z., Yuan H. (2008), “Production, purification and characterization of an alkaliphilic endo–ß–1,4–xylanase from a microbial community EMSD5”, Enzyme and Microbial Technology, 43, pp. 343 – 348. Olempska–Beer Z. S., Merker R. I., Ditto M.D., Dinovi M. J. (2006), “Food – processing enzymes from recombinant microorganism – a revew”, Regulatory Toxicology and Pharmacology, 45, pp. 144 – 158. Zuccarello G. C., Critchley A. T., Smith J., Sieber V., Lhonneur G.B., West J.A. (2006) Systematics and genetic variation in commercial Kappaphycus and Eucheuma (Solieriaceae, Rhodophyta), Journal of Applied Phycology.  HYPERLINK "" ] 35.  HYPERLINK "" 

Các file đính kèm theo tài liệu này:

  • docAnh huong cua vi sinh vat toi thuc vat.doc
Luận văn liên quan