Chẩn đoán virus cúm gia cầm (avian influenza hoặc bird flu) bằng kỹ thuật gen

Cần thực hiện xét nghiệm này một cách phù hợp với những hướng dẫn nêu trong Bộ thuốc thử xét nghiệm bệnh cúm của TCYTTG. Làm sạch tế bào biểu mô khỏi chất nhầy nhiễm bẩn bằng cách quay ly tâm, cố định, và hãm màu với kháng thể đơn dòng đặc hiệu. Tế bào biểu mô hô hấp nhiễm bệnh trong bệnh phẩm lâm sàng rất không ổn định và dễ bị phá huỷ; do đó cần giữ chúng lạnh trên nước đá trong quá trình xử lý và không ly tâm trên 500g. Cần có cảphim chứng có tế bào bị nhiễm virut cúm A(H3) và A(H1) (và, nếu có, tế bào bị nhiễm virut H5), và tế bào không bị nhiễm để cho phép kiểm soát thích hợp kháng thể đơn dòng và liên hợp, và để giúp diễn giải việc hãm màu cụthể.

pdf26 trang | Chia sẻ: lylyngoc | Ngày: 05/11/2013 | Lượt xem: 2230 | Lượt tải: 2download
Bạn đang xem nội dung tài liệu Chẩn đoán virus cúm gia cầm (avian influenza hoặc bird flu) bằng kỹ thuật gen, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
1 TIỂU LUẬN CHẨN ĐOÁN VIRUS CÚM GIA CẦM (AVIAN INFLUENZA HOẶC BIRD FLU) BẰNG KỸ THUẬT GEN 2 I. Đặt vấn đề Virus cúm là thành viên chính của họ orthomyxoviridae và là căn nguyên gây bệnh cúm. Bệnh cúm là một nhiễm trùng đường hô hấp cấp tính tạo thành dịch do virus Virus cúm đã gây nhiều vụ dịch lớn trên thế giới với tỉ lệ tử vong cao. Có 3 týp vi rút cúm là A, B và C, trong đó vi rút cúm A hay gây đại dịch.Bệnh cúm gia cầm đã bùng phát trở lại ở một số địa phương nước ta. Cúm gia cầm là bệnh truyền nhiễm nguy hiểm nhất hiện nay đối với ngành chăn nuôi, bệnh diễn biến phức tạp, thường ở thể quá cấp và cấp tính gây chết nhanh chóng, hàng loạt khi nhiễm phải, làm thiệt hại lớn cho người chăn nuôi. Việc xác định các bệnh nhân đang nằm viện bị H5N1 là khó khăn, nhất là khi không biết được mối liên hệ dịch tễ và khi có các triệu chứng không đặc hiệu. trong những năm gần đây, nhờ sự phát triển của công nghệ gen và công nghệ sinh hoc...nhiều phương pháp chẩn đoán mới đã được xây dựng, áp dụng trong chẩn đoán virus, cho phép xác định kết quả nhanh. những phương pháp mới này có ưu điểm là nhanh,đơn giản, nhạy, chính xác và chi phí thấp... II. Virus cúm gia cầm 1.Giới thiệu về virus cúm gia cầm Cúm gà hay Cúm gia cầm là một loại bệnh truyền nhiễm gây ra bởi các virus thường chỉ gây bệnh cho gia cầm ( gồm cả chim) và có thể xâm nhiễm một số loài có vú. Tuy nhiên, các virus cúm gia cầm cũng có thể gây bệnh cho người, thậm chí gây tử vong. Virus H5N1 là một loại virus cúm gia cầm đặc biệt, mà gần đây đã lan truyền rộng rãi ở nhiều quốc gia. Virus này được phát hiện lần đầu tiên là tại Ý vào thập niên 1900 và giờ đây phát hiện ở hầu hết các nơi trên thế giới Virus cúm có tên khoa học là avian influenza (AI) thuộc nhóm virus cúm A của họ Orthomyxociridae đây là những retrovirus, mang vật liệu di truyền là những đoạn phân tử RNA, sợi đối mã (sợi âm tính). Dòng H5N1 gây bệnh trên chim, được gọi là HPAIA(H5N1) được viết tắt từ cụm từ “ highly pathogenic avian influenza virus of type A of subtype H5N1”, là tác nhân gây ra cúm H5N1, được gọi với tên thông thường là cúm gia cầm hay cúm chim. Dòng virus này gây dịch bệnh ở nhiều loại chim, đặc biệt ở vùng Đông Nam Á. Loại này có tính “Epizootic” (gây bệnh cho nhiều loại đông vật, và hàng trăm ngàn gia súc khác). Vì độc lực và khả năng gây chết người cao của HPAI A(H5N1), sự hiện diện theo địa phương, việc tăng nhanh số lượng các ký chủ và khả năng đột biến đang diễn tiến đáng ngại, virus H5H1 trở thành mối đe dọa về một đại dịch khủng khiếp nhất trên toàn cầu và hàng tỷ đô la đã được đổ ra để nghiên cứu về H5N1 và chuẩn bị cho khả năng tiềm tàng của một đại dịch cúm. 3 2.Những đại dịch cúm trong lịch sử loài người Ngược lại lịch sử, đã có những ghi chép về các đại dịch cúm vào đầu những năm 1500. Có thể kể ra đây vụ dịch được coi là đầu tiên trong y văn xảy ra vào năm 1580 ở châu Âu sau đó lan sang châu Á và châu Phi. Thế kỷ 17 cũng ghi nhận có một số đại dịch cúm xảy ra. Sang thế kỷ 18, các vụ dịch cũng xảy ra vào các năm 1729-1730, 1732-1733 và 1781-1782. Sang thế kỷ 19, có ba vụ dịch năm vào những năm 1830 - 1831, 1833 - 1834, 1889 - 1890. Đặc biệt, đại dịch xảy ra năm 1889 bắt đầu ở Nga và lan tràn rất nhanh sang toàn bộ châu Âu. Đại dịch cúm Nga này lan sang Bắc Mỹ vào tháng 12/1889. Có khoảng một triệu người đã chết trong đại dịch này. Thế kỷ 20 đã chứng kiến 3 đại dịch cúm khủng khiếp, cướp đi sinh mạng của hàng triệu người trên toàn thế giới. Đại dịch đầu tiên được gọi là cúm Tây Ban Nha. Lúc đầu, người ta không biết chủng virus nào đã gây ra đại dịch này. Sau nhiều cố gắng của các nhà khoa học, gần đây, chúng ta đã dựng lại được cấu trúc của chủng virut này và đó chính là chủng H1N1. Dịch bắt đầu vào tháng 8/1918 đến năm 1919 và được coi là đại dịch có số người tử vong lớn nhất từ trước tới nay (hơn 50 triệu người chết). Trong số các nạn nhân, có 17 triệu người ở Ấn Độ, 500.000 người ở Mỹ và 200.000 ở Anh. Bệnh nhân tử vong rất nhanh chỉ trong vòng vài ngày sau khi bị bệnh. Hơn một nửa số nạn nhân là người trưởng thành, trẻ tuổi và khỏe mạnh. Đại dịch lần thứ hai - cúm châu Á bắt đầu ở Trung Quốc vào cuối tháng 2/1957 và lan sang Mỹ vào tháng 6 cùng năm. Chủng virut H2N2 đã gây tử vong cho 70.000 người ở Mỹ và hơn một triệu người khác trên toàn thế giới. Đại dịch thứ 3 và là đại dịch gần đây nhất xảy ra sau đó khoảng 10 năm, 1968-1969. Lần này, số người tử vong ít hơn hai lần trước. Thủ phạm của vụ dịch là chủng virut H3N2. Virus được phát hiện đầu tiên ở Hồng Kông, sau đó lan sang Mỹ vào cuối năm 1968. Qua nghiên cứu cấu trúc và đặc điểm của virut, các nhà khoa học thấy rằng, các chủng virus gây ra hai vụ dịch về sau này là sự tái hợp của một số virut có nguồn gốc từ người và một virus có nguồn gốc từ gia cầm. Trong vụ dịch 1957-1958, chủng virus gây bệnh đã lấy 3 đoạn gen của virut cúm từ vịt hoang dại tái hợp với 5 đoạn gen của chủng virus lưu hành trong quần thể người. Sang vụ dịch năm 1968-1969, chủng H3N2 đã thay đổi cấu trúc các protein hemaglutinin nhưng không thay đổi cấu trúc của neuramidase, nên chủng virus này được coi là có độc lực yếu hơn hai chủng của hai vụ dịch trước. 3.Cấu tạo virus cúm gia cầm 4 3. Cấu tạo của virus cúm A virus_di_tipo_a Mô hình virut cúm H5N1 virus typ-A Dưới kính hiển vi điện tử,. Virus cúm hình cầu, Đường kính khoảng 100-120nm. Các hạt virus cúm có cấu trúc phức tạp. Các protein capsid virut cúm, cùng với ARN, tạo thành nucleocapsid đối xứng xoắn. Vỏ của virus cúm được cấu tạo bởi hai lớp lipid, trên bề mặt hai lớp lipid đó có những vị trí trồi lên giống như những gai. Các gai này cấu tạo bởi glycoprotein và có hai loại hemaglutinin và neuraminidase ký hiệu là H và N. Mỗi cấu trúc H và N dài 8-10nm, cách nhau 8nm. Hemaglutinin có chức năng giúp virus bám vào các receptor trên bề mặt tế bào cảm thụ và đó là yếu tố quyết định kháng nguyên rất quan trọng trong sản xuất vacxin. Chức năng của neuraminidase chưa được hiểu rõ hoàn toàn, nhưng nhiều nghiên cứu cho thấy chúng bổ sung cho chức năng của hemaglutinin, thúc đẩy sự lắp ráp và giải phóng của virus từ tế bào cảm thụ. Hai cấu trúc glycoprotein H và N xác định kháng nguyên đặc hiệu của từng týp virus. Hiện nay có 16 cấu trúc kháng nguyên H và 9 cấu trúc kháng nguyên N khác nhau đặc hiệu cho từng thứ týp của virut cúm. Chúng được ký hiệu kháng nguyên H1-H16, và N1-N9. Protein M2 của virut chỉ có ở một số ít các chủng virut cúm A. Chúng có tác dụng điều hòa pH bên trong hạt virut. Nó có vai trò cởi bỏ lớp vỏ của virut trong giai đoạn đầu nhân lên trong tế bào cảm thụ. Chức năng này bị bất hoạt bởi các thuốc chống virut như amantadine và rimantadine. Cấu trúc ARN của cúm A và B phân làm 8 đoạn gen, còn cúm C phân làm 7 đoạn. Mỗi đoạn gen có vai trò mã hóa cho các thông tin di truyền đặc trưng của virut đó. ARN của virut được bao bọc bởi các nucleoprotein và vỏ 5 bao của virut. Dựa vào sự khác biệt về kháng nguyên của các nucleoprotein, protein M, các virut cúm được phân loại thành cúm A, B và C. Virut cúm B và C không phân chia thành các thứ týp. Tất cả các virut gây bệnh cúm ở chim được xếp vào loại virut cúm A. Các thứ týp của virut cúm A được phân loại dựa vào sự khác biệt của các yếu tố H và N. Các thứ týp H và N khác nhau của các virut cúm có thể gây bệnh cho người và nhiều động vật khác nhau. Ví dụ: H1N1 gây bệnh cho người và cũng gây bệnh được cho lợn, H1N3 có thể gây bệnh cho cá voi, H3N2 gây bệnh cho người; H4N5 gây bệnh cho hải cẩu... Như các loại cúm gia cầm khác, H5N1 có những dòng "độc lực cao" (HP) và "độc lực thấp" (LP). Virus HPAI có độc tính rất cao và tỷ lệ gây chết trong bầy gia cầm bị nhiễm thường gần 100%. Virus LPAI (Virus cúm gia cầm độc lực thấp) có độ độc không đáng kể, nhưng những virus này có thể cung cấp nguyên bản cho dòng virus độc lực cao. Dòng H5N1 hiện tại là nguyên nhân gây chết ở các loài chim trên khắp thế giới là một dòng HPAI; các dòng hiện tại khác của H5N1, bao gồm cả dòng Bắc Mỹ không gây bệnh ở bất kỳ loài nào, là những dòng LPAI. Tất cả các dòng HPAI được xác định đến giờ đều có liên quan đến phân nhóm H5 và H7. Điều khác biệt là sự phát sinh bệnh liên quan đến các loài gia cầm chứ không phải con người. Thông thường một loài virus cúm gia cầm độc lực cao thì không gây bệnh nặng trên cả người và những loài không phải gia cầm. Dòng H5N1 chết người hiện tại lại có dấu hiệu gây chết bất thường cho nhiều loài, bao gồm cả những loài như mèo nhà, vốn chưa từng mắc bệnh cúm với bất cứ loại virus cúm nào trước đây 4.Cấu trúc di truyền và các typ liên quan Kí tự N trong H5N1 là viết tắt của “"Neuraminidase", H5N1 là phân nhóm của loài virus cúm A thuộc Chi “Influenzavirus” A trong họ Orthomyxoviridae Giống như các phân nhóm cúm A khác, phân nhóm H5N1 là một virus RNA, nó có 8 đoạn gen mạch RNA dương viết tắt là PB2, PB1, PA, HA, NP, NA, MP và NS HA là ký hiệu của hemagglutinin, một loại kháng nguyên glycoprotein được tìm thấy trên bề mặt virus cúm và chịu trách nhiệm liên kết virus với tế bào vật chủ. NA là lý hiệu của neuraminidase, một kháng nguyên enzym tan nhầy được tìm thấy trên bề mặt virus cúm. Enzym này có vai trò hỗ trợ giải phóng các tiểu virus khỏi tế bào vật chủ. Mạch RNA của hemagglutinin (HA) và neuraminidas (NA) có cấu trúc protein khiến chúng trở thành mục tiêu của các loại thuốc chống virus và các kháng thể. HA và NA cũng được dùng để làm cơ sở cho việc đặt tên các phân nhóm cúm A. Nó trở thành ký tự H và N trong tên H5N1. Các virus cúm A rõ ràng có khả năng tiềm tàng gây bệnh và gây chết người và các động vật khác. Các phân nhóm virus cúm A đã được khẳng định trên người đã gây ra số lượng người chết ở tầm cỡ đại dịch. Đối với dòng virus cúm gia cầm có độc lực thấp (LPAIH5N1) còn gọi là H5N1 Bắc Mỹ thường hiện trong các loại chim hoang dã. Trong hầu hết các trường hợp, nó chỉ gây ra những bệnh nhẹ hoặc những dấu hiệu không đáng chú ý ở các loài chim. Nó không gây bệnh trên người. điều lo lắng duy nhất về dòng này là nó có thể truyền sang gia cầm và biến đổi thành dòng có độc lực cao. Trong cấu trúc của virus H5N1 có 8 phân tử ARN với các chức năng như sau: - 1 gen HA: điều khiển quá trình tổng hợp hemagglutinin( chất ngưng kết hồng cầu). có 16 loại gen HA, trong đó chỉ có H1,H2,H3 tìm thấy ở các virus gây bệnh cho người. virus mang gen H5,H7,H9 có thể lây từ chim qua người. gen H16 được phát hiện năm 2005 tại Bắc Âu. - 1 gen NA: điều khiển quá trình tổng hợp neuraminidase( enzym tan nhầy), có 9 loại gen NA, trong đó chỉ có N1,N2 tìm thấy ở các virus gây bệnh cho người. Các gen HA và NA đặc trưng cho loại virus, các gen này vẫn đang được hình thành thêm. 6 - 1 gen NP điều khiển quá trình tổng hợp nucleoprotein (giúp phân biệt 3 loại A,B,C) - 1 gen M: điều khiển quá trình tổng hợp matrix protein - 1 gen NS: điều khiển quá trình tổng hợp non-structural protein - 3 gen còn lại là PA,PB1,PB2 là các thành phần tạo nên RNA polymerase Vậy có thể có 144 phân nhóm virus loại A (16 gen HA * gen NA). Virus H5N1 thuộc dòng virus cúm loại A có gen HA là H5 và gen NA1 là N1. để tiêu diệt H5N1 người ta tác động vào các gen HA và NA gây ảnh hưởng đến quá trình tổng hợp các protein đặc hiệu của virus. Đây là cơ chế tác động của tamiflu. Gen Kích thước (nt) Polypeptide Chức năng 1 2341 PB2 Là tiểu đơn vị của polymerase (RNA transcriptase), nhận diện mũ chụp M7- GpppXm Nm của RNA tế bào chủ 2 2341 PB1 Là tiểu đơn vị xúc tác của polymerase (RNA transcriptase) 3 2233 PA Là tiểu đơn vị của polymerase (RNA transcriptase), tham gia tổng hợp RNA. 4 1778 HA Gắn kết virút vào thụ thể của tế bào (làm đông máu) (Hemagglutinin) 5 1565 NP Nucleo rotein: là thành phần của phức hiên mã, vận chuyển vRNA giữa nhân và tế bào chất. 6 1413 NA Phóng thích virút (Neuraminidase) M1 Protein nề , là thành phần chính của virion. 7 1027 M2 Protein nội màng, kênh ion. 7 5.Các tính chất của virus Sức đề kháng với các tác nhân lý hóa học: - Hạt virus bị phá hủy bởi ether và deoxycholate natri do nó có 20-30% lipid. - Ph thích hợp nhất là 6,5 – 7,9 - Virus chiệu nhiệt kém: ở 56oC – 60oC tính xâm nhiễm bị phá hủy trong một vài phút, nhưng hoạt tính ngưng kết hồng cầu vẫn được duy trì. Virus cúm có thể sống và truyền bệnh Bản chất của virus cúm là lipoprotein nên có sức đề kháng yếu và dễ bị mất hoạt bởi bức xạ mặt trời mặt trời có chứa tia tử ngoại , bởi nhiệt độ trên 56oC (trong vòng vài chục phút) và bởi các chất dung môi hòa tan lipid, chất khử trùng như formaldehyde, chloramin, cồn…tuy nhiên, virus cúm thường lẫn trong dịch xuất tiết của đường hô hấp và được bao bọc trong màng nhầy của chất này nên có thể sống lâu hơn ở môi trường bên ngoài, nhất là trong mùa lanh. Trong điều kiện này, nó có thể duy trì hoạt lực ở môi trường nhiều giờ hoặc 1-2 ngày. Với virus H5N1, có thể là đã thích ứng cao trên các loài chim hoang dã nên khả năng tồn tại ở môi trường có thể cao hơn:trong phân gia cầm tới hàng tháng, trong sản phẩm gia cầm bảo quản lạnh tới hàng năm. Chúng chỉ bị diệt ở 70oC trong 30 phút, hoặc ở môi trường acid, kiềm sau nhiều giờ. 6. khả năng gây bệnh của virus Virus cúm type A,B,C là tác nhân gây bệnh cúm ở người với những đặc điểm rất đặc biệt như: tính cảm thụ cao, thời gian ủ bệnh rất ngắn từ 1-2 ngày, bệnh diễn tiến nhanh chóng, gây ra một sức miễn dịch cao nhưung không lâu bền, lây truyền trực tiếp qua đường hô hấp. đó là những nguyên nhân làm cho bệnh cúm dễ lan tràn thành các vụ dịch lớn. a.sự lan truyền của virus trong cơ thể Virus vào cơ thể bằng đường hô hấp, nó xâm nhiễm các tế bào niêm mạc đương hô hấp trên gây thương tổn niêm mạc làm xuất hiện các phản xạ ho và hắt hơi. Quá trình phát triển của virus ở đường hô hấp trên dẫn tới sự phá hủy của các tổ chức liên bào, mở đường cho virus vào đường phế quản và vào phổi hay cũng có thể mở đường cho các vi khuẩn gây xâm nhiễm thứ phát khi các tổ chức tế bào đã mất hết khả năng tự vệ bình thường của nó. Đó là các thể viêm phổi do virus hay các biến chứng khác do nhiễm khuẩn thứ phát. Sơ đồ cách thức vi-rút cúm A tấn công vào tế bào của người bệnh và tiếp tục sinh sôi nảy nở NS1 Vận chuyển mRNA ra tế bào chất, dịch mã, là protein kháng interferon. 8 890 NS2 Vận chuyển RNP ra khỏi nhân 8 Định danh thủ phạm cúm gia cầm Vi-rút H5N1 nhìn dưới kính hiển vi điện tử b.hình ảnh lâm sàng Thường gặp là thể điển hình với các đặc điểm là: sau 1-2 ngày ủ bệnh xuất hiện sốt 38oC, rét run, sốt, đau khắp mình mẩy, suy nhược, tổn thương bộ máy hô hấp,khó thở, tím tái,cảm giác hụt hơi,thiếu hơi,giảm độ bão hòa oxi máu, tiêu chảy, phân nước, nhiều lần, bệnh khởi phát nhanh nhưng mệt mỏi kéo dài. Ngoài ra có thể gặp thể nặng với các triệu chứng của bệnh phế quản: phế viêm do virus hoặc nhiễm các vỉ khuẩn tụ cầu, liên cầu, phế cầu, Klebsiella pneumoniae… thường gặp ở người già và trẻ nhỏ với tỷ lệ tử vong cao. c.dịch tễ học Tiếp xúc trực tiếp với gia cầm như gà, vịt, chim bị bệnh trong vòng 7 ngày trước đó hoặc sống ở vùng gia cầm bị bệnh hơcj có tiếp xúc với người bị bệnh cúm. Bệnh lây trực tiếp qua đường hô hấp, thường gây dịch lớn, nhất là type A. dịch cúm thường xảy ra vào mùa đông xuân: vì bệnh cúm là bệnh của đường hô hấp, vị trí đột nhập đầu tiên của virus cúm là các tế bào đường hô hấp. trong điều kiện lạnh và ẩm thấp, các tế bào hô hấp của người dễ bị tổn thương, tạo diều kiện tốt cho bệnh cúm phát triển. Sau khi nhiễm bệnh cúm sẽ có miễn dịch đặc hiệu type kéo dài từ 6 tháng đến 3 năm. các type H và N khác nhau của các virus cúm có thể gây bệnh 9 cho người và nhiều động vật khác nhau. Một số thứ type thường gây bệnh ở người như H3N2, H1N1…riêng thứ type H5N1 của virus cúm A là loại bệnh ở gia cầm nhưng hiện nay đã vượt qua rào cản giới hạn thụ thể đặc hiệu loài để gây nhiễm ở động vật có vú và cả người. từ năm 1997 đến nay, dịch cúm A (H5N1) xảy ra liên tiếp ở nhiều nước Châu Á đặc biệt là Trung Quốc, Thái Lan, Việt Nam,… d.xét nghiệm X quang phổi: tổn thương là hình ảnh viêm phổi mô kẽ khu trú một bên, hoặc có hình ảnh tổn thương giống viêm phổi thùy,nhưng ranh giới không rõ, sau đó tiến triển nhanh lan tỏa sang hai bên. Cần chụp phổi nhiều lần(ít nhất 2 lần) trong ngày ở giai đoạn cấp. Xét nghiệm máu: Công thức máu: số lượng bạch cầu giảm (<3000/ml) với tế bào lympho giảm, tỉ lệ CD4,CD8 giảm. có thể có thiểu cầu giảm. Sinh hóa: Có tình trạng giảm oxi máu PaO2<85 mmHg (trường hợp nặng suy hô hấp PaO2<60mmHg) Nồng độ các cytokine trong máu tăng: IL6,IL8,IL1,a TNF,INF g… Vi sinh: Lấy dịch mũi họng hoặc nội khí quản và máu: làm PCR để định virus cúm cúm A,làm ELISA và ngưng kết hồng cầu thụ động để định dưới nhóm H5N1. Cấy máu, cấy dịch màng phổi, dịch nội khí quản khi nghi ngờ bội nhiễm. III. Phương pháp chẩn đoán bệnh 1.các xét nghiệm chân đoán Chẩn đoán chỉ dựa vào yếu tố dịch tể học, dấu hiệu lâm sàng và các dấu hiệu huyết học-sinh hóa vì độ nhạy của các test nhanh quá thấp. Các kỹ thuật để xác định chẩn đoán: xét nghiệm phân tử Phân lập virus Thử nghiệm miễn dịch huỳnh quang 2.Để xét nghiệm phát hiện virus H5N1, cần lấy bệnh phẩm gì? 10 Bệnh phẩm dùng cho xác định nhiễm H5N1 gồm: dịch hầu họng hoặc dịch phế quản; huyết thanh bệnh nhân trong giai đoạn cấp (huyết thanh 1), và giai đoạn hồi phục (huyết thanh 2, thu thập 10-15 ngày sau khi lấy huyết thanh 1). Những người thu thập bệnh phẩm là: Nhân viên phòng thí nghiệm đã được tập huấn về cách thu thập bệnh phẩm và phương pháp bảo hộ cá nhân; các bác sĩ lâm sàng (trong trường hợp bệnh nhân nặng cần hỗ trợ thở). 3.quy trình xét nghiệm để chẩn đoán (tại bệnh viện Nhiệt Đới) - A.xét nghiệm phân tử Có thể phát hiện RNA đặc hiệu cho H5N1 trong nhiều loại bệnh phẩm lâm sàng như máu, phân, chất tiết hô hấp hoặc các dịch cơ thể bằng phản ứng chuỗi polymerase (PCR). Một số cách thức tiến hành PCR do các thành viên của mạng lưới xét nghiệm WHO phát triển hiện sẵn cót trên website của WHO ( Hơn nữa, kit xét nghiệm RT-PCR 5’-nuclease chứa đoạn mồi và chứng dương tính và âm tính do Viện Bernhard Nocht ( et al.) phát triển hiện sẵn có trên thị trường ( Virus không có các AND nên cần có một giai đoạn tạo các AND. để làm đươc điều này ta dùng các enzym sao chép ngươc gọi là transcriptase inverse(retrotranscriptase). RT-PCR(Reverse transcrip – PCR) là phương pháp để phát hiện các ARN của virus. Hiện nay các phòng thí nghiệm trên thế giới và Việt Nam đang phát triển các phương pháp mới. real time PCR,...PCR có thể tiến hành ở các phòng thí nghiệm thông thường còn RT-PCR thường chỉ được thực hiện tại các phòng thí nhiệm có tổ chức chặt chẽ. Virus H5N1 trong các mẫu có tỉ lệ rất nhỏ do đó rất khó phát hiện, tuy nhiên nếu dùng các phương pháp nuôi cấy rất nguy hiểm vì dễ gây phát tán virus. Hiện nay đê phát hiện virus H5N1 trong mẫu cần khoảng 5-7 tiếng. Các nghiên cứu hiện nay đa số tìm cách giảm thời gian này. một phương pháp cải tiến là dùng một số đoạn AND mồi đặc hiệu. Real time RT-PCR -Đích: M gene -Probe IA Taqman -Độ nhạy: 10 copies -Chứng nội tại (EAV) -Bản định lượng. RT-PCR đặc hiệu với: - H5N1 - H3, N1 Real time PCR -đặc hiệu với H5 -Taqman độ nhạy 10 copies Vi trung hoà Phân lập Loại trừ cúm A huyết thanh 2 lần phết họng và mũi 11 A.1. Phản ứng chuỗi polime sao chép ngược (RT-PCR) Phản ứng chuỗi pôlime sao chép ngược (RT-PCR) là một kỹ thuật đầy tiềm năng để định loại kiểu gien của virus cúm. Kiểu gien của virut (gồm có chuỗi đơn RNA) trước hết phải được tách ra. Sau đó, trong sao chép ngược, các bản sao DNA của RNA nguyên gốc (cDNA) được tổng hợp nhờ một men sao chép ngược (RT). Trong bước tiếp theo, cDNA sử dụng polyme để khuyếch đại thành số lượng lớn các bản sao (sản phẩm PCR). Cuối cùng, các sản phẩm cDNA hình thành qua việc khuyếch đại được phát hiện nhờ những kỹ thuật khác nhau và có thể được tiếp tục phân tích bằng các phương pháp di truyền học phân tử như sắp xếp chuỗi. Trong RT-PCR thường quy, sản phẩm được phát hiện vào lúc cuối của quá trình phản ứng. Với RT-PCR hiện thời, sản phẩm được phát hiện khi việc khuyếch đại vẫn đang diễn ra, nên có thể định lượng được. Phân tích RT-PCR thường quy vẫn được sử dụng rộng rãi, nhưng ngày càng có nhiều phòng thí nghiệm chuyển sang các phương pháp RT-PCR hiện thời khi chi phí giảm đi Với cả hai phương pháp, quy trình khuyếch đại đòi hỏi phải có cặp primơ oligonucleotide. Những cặp primơ này được thiết kế trên cơ sở của những chuỗi đã biết trong các gien khác nhau của virut cúm (gien ngưng kết hồng cầu (HA) và gien neuraminidaza (NA) thường được dùng nhiều nhất) với những chủng con của virut cúm được quan tâm, và do đó sẽ phát hiện được một cách rõ ràng RNA của chỉ 1 chủng con. Những primơ khác được định hướng vào những gien tương đối ổn định của tất cả mọi virut cúm A (ví dụ như gien ma trận). Do virut H5 vẫn đang tiếp tục tiến hoá, sự đa dạng hoá di truyền của các chủng H5N1 trong 2 năm qua đã đưa ra khuyến cáo về thách thứcđối với những bộ primơ cụ thể. Nhóm tác nghiệp của TCYTTG (Phụ lục C) đã được thành lập để chuẩn bị quy trình mẫu về các primơ RT-PCR thường quy và hiện thời để phát hiện những chủng virut cúm gia cầm đang lưu hành. cần có những điều kiện cận lâm sàng nói chung về an toàn sinh học, đảm bảo chất lượng, và năng lực chẩn đoán được mô tả trong tài liệu này, các phòng thí nghiệm sử dụng RT- PCR để phát hiện và chẩn đoán nhiễm cúm gia cầm cần cân nhắc: Bao phủ tất cả mọi chủng H5N1 đang lưu hành gây nhiễm cho người ở tất cả mọi khu vực, quy tắc xét nghiệm, những thực hành cận cận lâm sàng tốt, chuẩn định, đảm bảo chất lượng, đào tạo nhân lực, cơ sở vật chất và khu vực xử lý, trang thiết bị, diễn giải kết quả. Những vấn đề này có thể có tác động sâu sắc đến khả năng nhận được kết quả dương tính giả hoặc âm tính giả. A.1.1 Phân tích RT-PCR thường quy QUY TRÌNH RT-PCR thường quy 1 17 Các quy trình và primơ dùng để thực hiện PCR và điện di thạch thường quy trên các sản phẩm để phát hiện virut cúm gia cầm A(H5N1) trong bệnh phẩm thu thập từ người được nêu dưới đây. Những quy trình này đã tỏ ra rất có hiệu quả để định loại các chủng 1, 2 và 3 của virut H5N1 khi được áp dụg với những thuốc thử và primơ được chỉ định. Các phòng thí nghiệm có quan tâm đến việc xác định những chủng đang lưu hành nên liên hệ với một trong số các thành viên của Uỷ ban chuyên gia về PCR trong Cúm gia cầm của TCYTTG (Phụ lục C) hoặc một trong số các Phòng thí nghiệm H5 chuẩn thức của TCYTTG để được hỗ trợ trong việc tìm ra primơ tốt nhất. Vật liệu cần có • Bộ xét nghiệm nhỏ tìm RNA virut QIAamp® (QIAGEN® Cat#51104) • Bộ xét nghiệm RT-PCR một bước (QIAGEN®, Cat#210212) • Chất ức chế RNA 20U/μl (Hệ thống sinh học ứng dụng Cat# N808-0119) • Nước không chứa RNA • Ethanol (96–100%) • Máy siêu ly tâm (điều chỉnh được, đến 13.000 vòng/phút) • Pipét điều chỉnh được (10, 20, 200, 100 μl) • Đầu pipét không chứa RNA vô khuẩn có màng khí • Máy quay 12 • Ống nghiệm dùng cho máy siêu ly tâm (0,2 và 1,5ml • Điều chỉnh nhiệt độ • Bộ primơ • Chứng dương (có thể đặt từ một Phòng thí nghiệm H5 chuẩn thức của TCYTTG 18 ) Primơ Gien :H5 Chủng :1, 2, 3 Chuỗi primơ :H5-1: GCC ATT CCA CAA CAT ACA C : H5-3: CTC CCC TGC TCA TTG CTA T kích cỡ mong đợi của sản phẩm 219 bp Nguồn tham khảo chỉnh sửa theo Juen và CS. 1998 Gen M Chủng 1, 2, 3 chuỗi primer M30F: TTC TAA CCG AGG TCG AAA CG M264G2: ACA AAG CGT CTA CGC TGC AG kích cỡ mong đợi của sản phẩm 234 bp nguồn tham khảo NIID19 Gen N1 Chủng chuỗi primer N1-1: TTG CTT GGT CGG CAA GTGC N1-2: CCA GTC CAC CCA TTT GGA TCC kích cỡ mong đợi của sản phẩm 616 bp nguòn tham khảo: Wright và CS. 1995 Quy trình 1. Tách chiết RNA virut từ bệnh phẩm lâm sàng bằng Bộ xét nghiệm nhỏ tìm RNA virut QIAamp® hoặc bộ công cụ tách chiết tương đương theo hướng dẫn của nhà sản xuất. 2. Thực hiện RT-PCR một bước. Đối với các gien H5 hoặc N1 a. Chuẩn bị hỗn hợp chính cho RT-PCR như sau: 5x đệm QIAGEN® RT-PCR 10 μl hỗn hợp dNTP 2 μl 5x dung dịch Q 10 μl Primơ chuyển tiếp (5 μM) 6 μl Primơ đảo ngược (5 μM) 6 μl Hỗn hợp men 2 μl Chất ức chế RNA (20U/μl) 0,5 μl Nước (Độ phân tử) 9 μl 13 Tổng cộng 45 μl b. Thêm 5μl RNA virut Đối với gien M a. Chuẩn bị hỗn hợp chính cho RT-PCR như sau: 5x đệm RT-PCR QIAGEN® 10μl Hỗn hợp dNTP 2 μl Primơ chuyển tiếp (5 μM) 6 μl Primơ đảo ngược (5 μM) 6 μl Hỗn hợp men 2μl Chất ức chế RNA (20U/μl) 0,5μl Nước (Độ phân tử) 19μl Tổng cộng 45μl b. Thêm 5 μl RNA virut 3. Điều kiện quay nhiệt PCR H5, N1 Sao chép ngược 30 phút 50°C Hoạt hoá PCR ban đầu 15 phút 95°C quay 3 bước làm biến chất 30 giây luyện 30 giây 55oC mở rộng 30 giây 72oC số vòng 40 mở rộng vòng cuối 2 phút 72oC M Sao chép ngược 30 phút 50°C Hoạt hoá PCR ban đầu 15 phút 95°C làm biến chất 30 giây luyện 30 giây 94oC mở rộng 30 giây 50oC số vòng 40 mở rộng vòng cuối 2 phút 72oC 4. Điện di thạch aga sản phẩm RT-PCR Chuẩn bị thạch aga, sản phẩm PCR và cân điện tử, và vận hành theo quy trình chuẩn thức. Theo dõi màn hình cân dưới ánh sáng tia cực tím. Ví dụ về quy trình được nêu dưới đây. Vật liệu cần có • Khay đúc thạch aga và buồng điện di • Nguồn điện và điện cực 14 • Hộp tia cực tím (302 nm) • Máy ảnh và phim chống nắng hoặc máy tính kết nối với máy ảnh • Pipét điều chỉnh được • Thạch aga 2% trong 1× TAE • Đệm 1× TAE • Brômua ethidium (10 mg/ml) • 6 x đệm nâng thạch (GLB) • Cân điện tử Quy trình Đúc thạch aga 1) Đặt khay đúc thạch lên nền đúc thạch. Đưa khung vào và nâng nền lên. 2) Chuẩn bị thạch 2% bằng cách cân 4 g bột thạch và hoà tan trong 200ml đệm 1× TAE. Hoà tan thạch bằng cách làm nóng trong lò viba. 3) Làm nguội nước thạch đến khoảng 60°C, sau đó thêm 10 μl brômua ethidium. 4) Rưới nước thạch vào khay đúc thạch. 5) Để thạch đông lại ở nhiệt độ trong phòng. 6) Rút khung khỏi khuôn. 7) Đặt khay vào buồng điện di có các giếng ở phía điện cực âm. 8) Đổ 1× TAE vào buồng đệm đến mức có thể phủ kín bề mặt thạch. Nạp bệnh phẩm 1) Thêm 5 μl đệm nâng thạch vào mỗi ống nghiệm PCR. 2) Gắn cân điện tử vào giếng thạch aga đầu tiên. 3) Nhỏ 15 μl sản phẩm PCR/GLB lên thạch. 4) Đóng nắp buồng và gắn điện cực. Quay thạch ở vận tốc 100V trong 30–35 phút. 5) Theo dõi màn hình cân và dải sản phẩm PCR dưới ánh sáng tia cực tím. 6) Chụp hình ảnh thạch. 5. Diễn giải kết quả Cần so sánh kích cỡ của sản phẩm PCR thu được với kích cỡ mong đợi của sản phẩm (nêu trong các bảng trên). Nếu xét nghiệm được tiến hành mà không có chứng dương, sản phẩm phải được khẳng định bằng cách sắp xếp chuỗi và so sánh với những chuỗi sẵn có. A.1.2. Phân tích RT-PCR hiện thời RT-PCR hiện thời đặt ra những thách thức khác với RT-PCR thường quy. Ngoài những điều kiện liên quan đến RT-PCR nêu trên, những điều kiện cụ thể liên quan đến RT-PCR hiện thời bao gồm: • Đảm bảo việc sử dụng và xử lý đúng những trang thiết bị, phần mềm, và thuốc thử có huỳnh quang thích hợp. 15 • Đảm bảo đào tạo nhân lực một cách thích hợp về diễn giải kết quả (kinh nghiệm trong việc nhận biết dương tính thật, giải thích các giá trị của chứng và huỳnh quang khác thường, v.v..., có vai trò rất quan trọng). • Việc chuẩn định trong phòng thí nghiệm và tối ưu hoá các phản ứng là thiết yếu để thực hiện định lượng. • Ít có khả năng xảy ra nhiễm bẩn khi huỷ bỏ các phản ứng sau xét nghiệm. Tuy nhiên, nhiều phòng thí nghiệm vẫn tiếp tục làm phân tích sau phản ứng (ví dụ như phân tích hiện tượng nhiều hình thái có chiều dài đứt quãng hạn chế có sử dụng thạch, sắp xếp chuỗi) qua đó có thể tái nhiễm bẩn. QUY TRÌNH RT-PCR hiện thời 1 21 Tách chiết RNA virut từ bệnh phẩm lâm sàng theo cách mô tả trong Phần A.1.1. Phân tích RT- PCR thường quy đã nêu ở trên. Vật liệu cần có Sao chép ngược 10X đệm PCR I với 15 mM MgCl2 (Hệ thống sinh học ứng dụng) Hexamer ngẫu nhiên 50 μM (Hệ thống sinh học ứng dụng) Men sao chép ngược MuLV 50 U/μl (Hệ thống sinh học ứng dụng) Chất ức chế RNA 20 U/μl (Hệ thống sinh học ứng dụng). PCR hiện thời Bộ công cụ LightCycler ® – FastStart™ DNA Master HybProbes (Roche) Primơ và hỗn hợp thuốc thử: Thêm một lượng bằng nhau những thành phần sau để chuẩn bị primơ và hỗn hợp thuốc thử cho H5 và M. Primơ và thuốc thử Gen H5 chủng 1; 2; 3 Chuỗi primơ : H5-266F: 5’- TGCCGGAATGGTCTTACATAGTG -3’ (5 μM) H5-1615F: 5’- GTGGCGAGCTCCCTAGCA -3’ (5 μM) H5-347R: 5’- TCTTCATAGTCATTGAAATCCCCTG -3 (5 μM) H5-1695R: 5’- TCTGCATTGTAACGACCCATTG -3’ (5 μM) H5-290P: 5’-(FAM)-AGAAGGCCAATCCAGTCAATGACCTCTGTTA- (TAMRA)-3’ (2,5 μM) H5-1634P: 5’-(FAM)-TGGCAATCATGGTAGCTGGTCTATCCTTATGG- (TAMRA)-3’ (2,5 μM) Gien M Chủng 1, 2, 3 Chuỗi pri FLUAM-1F: 5’-AAGACCAATCCTGTCACCTCTGA (10 μM) FLUA-2F: 5’-CATTGGGATCTTGCACTTGATAT (10 μM) 16 FLUAM-1R: 5’-CAA AGCGTCTACGCTGCAGT 3’ (10 μM) FLUAM-2R: 5’- AAACCGTATTTAAGGCGACGATAA-3’ (10 μM) FLUA-1P: 5’-(FAM)- TTTGTGTTCACGCTCACCGT-(TAMRA)-3’ (5 μM) FLUA-2P: 5’-(FAM)- TGGATTCTTGATCGTCTTTTCTTCAAATGCA- (TAMRA)-3’ (5 μM) Thực hiện RT Thuốc thử Thể tích (μl) / phản 10X PCR buffer I with 15 mM Mg2 Thêm 25mM MgCl2 2,8 2,5mM dNTPs 8 Hexamer ngẫu nhiên 50μM 1 Chất ức chế RNA 20U/μl 1 Men sao chép ngược 50 U/μl 1 RNA đã tách chiết 4,2 (1) Quay và ly tâm sơ bộ ống nghiệm có chứa hỗn hợp. (2) Đặt ống nghiệm ở nhiệt độ trong phòng trong 10 phút, sau đó ủ ở 42°C trong vòng ít nhất 15 phút. (3) Ủ ống nghiệm ở 95°C trong 5 phút, sau đó làm lạnh trong nước đá. Thực hiện PCR hiện thời (1) Chuẩn bị hỗn hợp phản ứng “Khởi động nóng” bằng cách dùng pipét nhẹ nhàng bơm 60 μl Thuốc thử Hỗn hợp phản ứng LC-FastStart™ (lọ 1b) vào men LC-FastStart™ (lọ 1a). (2) Với mỗi bệnh phẩm xét nghiệm và các chứng dương và âm, chuẩn bị hỗn hợp thuốc thử với primơ và hỗn hợp thuốc thử theo nội dung sau: Thuốc thử Thể tích (μl) H 2 O PCR grade 7,6 MgCl2 (25 mM) 2,4 Primơ và hỗn hợp thuốc thử (H5 hoặc M) 3 Hỗn hợp phản ứng “Khởi động nóng” 2 17 Tổng cộng 15 Mỗi phản ứng: Hỗn hợp chính 15 cDNA 5 Điều kiện quay nhiệt PCR Nhiệt độ Thời gian (phút : g Số vòng 95 10:00 1 95 0:10 56 0:15 72 0:10 } 50 40 0:30 1 B.Phân lập virus Phân lập virus bằng cách nuôi cấy là một kỹ thuật nhậy cảm với ưu điểm là sau đó sẽ có được loại virus này để định loại và tiếp tục mô tả các đặc điểm di truyền và kháng nguyên học, xét nghiệm tính nhậy cảm với thuốc, và chuẩn bị văcxin. Môi trường tốt nhất để virus cúm mọc bao gồm các tế bào MDCK hoặc trứng gà có phôi. Không giống như các chủng virut cúm A khác, cúm A(H5N1) cũng sẽ mọc trong những dòng tế bào chung khác như Hep-2 và RD. Để tăng trưởng, virut cúm A(H5N1) ở người không đòi hỏi phải có thêm tripxin ngoại sinh. Sau đó có thể tiến hành định loại và kiểu hình của virut cúm được nuôi cấy bằng các thử nghiệm PCR, miễn dịch huỳnh quang (IFA) sử dụng kháng thể đơn dòng đặc hiệu, hoặc ngưng kết ức chế hồng cầu (HA) và phân tích kháng nguyên (xác định kiểu phụ) bằng thử nghiệm ngăn ngưng kết ức chế hồng cầu (HI) có sử dụng các kháng nguyên tham chiếu chọn lọc. Chỉ nên nuôi cấy virut khi đảm bảo có cơ sở vật chất đạt mức độ BSL-3, và cần thực hiện các biện pháp phòng ngừa an toàn sinh học khi xử lý nuôi cấy tế bào có thể chứa cúm gia cầm có độc tính cao. Vật liệu cần có • Các tế bào thận Madin-Darby Canine (MDCK), ATCC CCL34 • Bộ thuốc thử xét nghiệm bệnh cúm của TCYTTG để định loại virut cúm A(H5). Thuốc thử để định loại virut cúm A(H5N1) trong nuôi cấy tế bào bao gồm: o kháng nguyên kiểm soát virut cúm A(H5N1): virut bất hoạt o huyết thanh dê cho A/Tern/South Africa/61/H5 o huyết thanh hỗn hợp của gà cho A/Goose/Hong Kong/437-4/99 • Bộ thuốc thử xét nghiệm bệnh cúm của TCYTTG (phân phối hàng năm) − các kháng nguyên tham chiếu A(H1N1) và A(H3N2) • Men phá huỷ thụ cảm (RDE). 18 • Các tế bào hồng cầu (gà, gà tây, người týp O, hoặc tế bào hồng cầu chuột lang) trong dung dịch Alsever. Quy trình Cần tuân thủ các quy trình chuẩn thức nuôi cấy tế bào trong phòng thí nghiệm trong các khâu nhân giống nuôi cấy tế bào, tiêm bệnh phẩm, và gặt tế bào bị nhiễm để làm IFA hoặc nước nổi nuôi cấy cho xét nghiệm HA và HI (Lennette & Schmidt, 1995; WHO, 2002 24 ), RT-PCR, hoặc phân tích chuỗi. Cần tuân thủ các quy trình chuẩn thức về HA và HI, đảm bảo có đủ tất cả mọi chứng được khuyến cáo. Chi tiết cụ thể về những quy trình này được nêu trong tài liệu của TCYTTG về chẩn đoán và giám sát bệnh cúm ở động vật 25 . Diễn giải kết quả Độ pha loãng cao nhất của virut cho phép ngưng kết ức chế hồng cầu hoàn toàn là điểm kết thúc trong xác định hiệu giá HA. Độ pha loãng cuối cùng của kháng huyết thanh cho phép ngăn ngưng kết ức chế hồng cầu hoàn toàn là điểm kết thúc của HI. HIệu giá được biểu diễn ở dạng tỷ số của độ pha loãng cuối cùng. Định loại phân lập từ thực địa được tiến hành bằng cách so sánh kết quả của phân lập không rõ với các chứng kháng nguyên. Một phân lập được xác định là một chủng con đặc hiệu của virut cúm A nếu hiệu giá kháng thể HI đặc hiệu với chủng con của virut cúm A là 4 lần hoặc cao hơn so với hiệu giá thu được từ kháng huyết thanh khác. Ngưng kết tố không đặc hiệu có thể xuất hiện trong huyết thanh và dẫn đến các phản ứng giả âm tính; tương tự như vậy, một số phân lập có thể rất nhậy cảm với chất ức chế không đặc hiệu trong huyết thanh, dẫn đến các phản ứng giả dương tính. 3. Thử nghiệm miễn dịch huỳnh quang Có thể dùng thử nghiệm miễn dịch huỳnh quang (IFA) để định loại virut cúm trong nuôi cấy tế bào. Thực hiện IFA trên nuôi cấy tế bào được tiêm nhiễm rất hữu ích cho việc xét nghiệm bệnh phẩm lâm sàng vì nó cho phép khuyếch đại mọi virut hiện diện ở đó. Vật liệu cần có • Bộ thuốc thử xét nghiệm bệnh cúm của TCYTTG để định loại virut cúm A(H5N1) (phiên bản 1997–98, 2003 hoặc 2004). Thuốc thử trong bộ này dùng cho thử nghiệm miễn dịch huỳnh quang bao gồm: o hỗn hợp kháng thể đơn dòng đặc hiệu với virut cúm týp A(H5) o hỗn hợp kháng thể đơn dòng đặc hiệu với virut cúm týp A và týp B o kháng thể đơn dòng đặc hiệu với virut cúm A(H1) và A(H3) • Tiếp hợp IgG FITC kháng chuột • Phim cho kính hiển vi • Nắp đậy, 24 x 60 mm • Hồ dán • Axeton • Kính hiển vi miễn dịch huỳnh quang. Quy trình Cần thực hiện xét nghiệm này một cách phù hợp với những hướng dẫn nêu trong Bộ thuốc thử xét nghiệm bệnh cúm của TCYTTG. Làm sạch tế bào biểu mô khỏi chất nhầy nhiễm bẩn bằng cách 19 quay ly tâm, cố định, và hãm màu với kháng thể đơn dòng đặc hiệu. Tế bào biểu mô hô hấp nhiễm bệnh trong bệnh phẩm lâm sàng rất không ổn định và dễ bị phá huỷ; do đó cần giữ chúng lạnh trên nước đá trong quá trình xử lý và không ly tâm trên 500g. Cần có cả phim chứng có tế bào bị nhiễm virut cúm A(H3) và A(H1) (và, nếu có, tế bào bị nhiễm virut H5), và tế bào không bị nhiễm để cho phép kiểm soát thích hợp kháng thể đơn dòng và liên hợp, và để giúp diễn giải việc hãm màu cụ thể. Diễn giải kết quả Cần hãm mãu cụ thể bằng huỳnh quang màu xanh táo nội bào mạnh. Có thể quan sát được huỳnh quang tế bào chất hoặc hạt nhân. Điều quan trọng là đảm bảo rằng mật độ tế bào đủ cao. Có thể coi là có kết quả dương tính nếu một hoặc nhiều tế bào nguyên vẹn thể hiện có huỳnh quang nội bào cụ thể. Vì những kháng thể đơn dòng thương mại sẵn có để định kiểu phụ của virut cúm A(H1) đã tỏ ra có tương tác chéo với các chủng con của virut cúm A(H5), trong đó có các chủng của năm 2004, nên với xét nghiệm khẳng định cần sử dụng kháng thể đơn dòng có trong bộ xét nghiệm của TCYTTG. V. Kết luận Quy trình RT-PCR, phân lập virus,thử nghiệm miên dịch huỳnh quang dụng đều cho phép phát hiện được RNA của virus cúm gia cầm. Trong đó phương pháp RT-PCR là cho kết quả tốt nhất lại nhanh chóng đơn giản tiết kiệm thời gian,chính xác và chi phí thấp. Phụ lục B Tài liệu tham khảo google.com.vn Khuyến cáo và quy trình xét nghiệm để phát hiện virus cúm gia cầm A( H5N1) trong bệnh phẩm thu thập từ các ca nghi nhiễm bệnh ở người của “ World Health Oganization” Chẩn đoán và xử lý sớm bệnh do virus cúm A /H5N1) của Ts.Bs Trần TỊnh Hiền Nguyễn Ngoc Hải “công nghệ sinh học trong thú y” nhà xuất bản nông nghiệp www.vcn.vnn.vn • Lennette EH, Schmidt NJ, eds (1979). Diagnostic procedures for viral, rickettsial and chlamydial infections, 5th ed. Washington, DC, American Public Health Association • WHO (2002). WHO manual on animal influenza diagnosis and surveillance. • WHO (2004). WHO Laboratory Biosafety Manual - Third Edition, • WHO (2005). WHO global influenza preparedness plan, 2005. ml • WHO (2005). WHO guidelines for the storage and transport of human and animal specimens for laboratory diagnosis of suspected avian influenza A infection January 2005. • WHO (2005). WHO laboratory biosafety guidelines for handling specimens suspected of containing avian influenza A virus January 2005. • WHO (2006). Collecting, preserving and shipping specimens for the diagnosis of avian influenza A(H5N1) virus infection. Guide for field operations October 2006. x.html 20 • WHO (2007). The role of National Influenza Centres (NICs) during interpandemic, pandemic alert and pandemic periods, Interim document, May 2007. • WHO (2006). WHO case definitions for human infections with influenza A(H5N1) virus August, 2006. l • WHO (2007). WHO guidelines for investigation of human cases of avian influenza A(H5N1) January, 2007. ml • WHO (2007). WHO H5 Reference Laboratories: • WHO (2007). WHO National Influenza Centres 21 Phụ lục số trang \ . Đặt vấn đề 2 II. Virus cúm gia cầm 1. Giới thiệu về virus cúm gia cầm 2 2. Những đại dịch cúm trong lịch sử loài người 3 3. Cấu tạo của virus cúm A 4 4. Cấu trúc di truyền và các typ lien quan 5 5. Các tính chất của virus 7 6. Khả năng gây bệnh của virus 8 a. Sự lan truyền của virus trong cơ thể b. Hình ảnh lâm sang c. Dịch tễ học d. Xét nghiệm III. Phương pháp chẩn đoán bệnh 1. Các xét nghiệm chẩn đoán 10 2. Để xét nghiệm phát hiện virus H5N1 , cần lấy bệnh phẩm gì 10 3. Quy trình xét nghiệm để chẩn đoán 11 A. Xét nghiệm phân tử A.1. Phản ứng chuỗi polime sao chép ngược (RT-PCR) 11 A.1.1. Phân tích RT-PCR thường quy 12 A.1.1. Phân tích RT-PCR hiện thời 15 B. Phân lập virus 18 C. Thử nghiệm miễn dịch huỳnh quang 19 VI. Kết luận 20 Tài liệu tham khảo 20 22 23 24 25 26

Các file đính kèm theo tài liệu này:

  • pdfchandoanviruscumgiacambangkythuatgen_2115.pdf