Đề tài Cà chua chuyển gen

Thời hạn sử dụng sản phẩm tăng lên mang lại lợi ích cho cả người sản xuất và người tiêu dùng. Bảo đảm về chất lượng rau quả trên thị trường. Giờ đây, nông dân có thể chờ rau quả trưởng thành đầy đủ mới thu hoạch. Người tiêu dùng có thể mua được hàng hóa tốt với giá tiền phù hợp. Nông dân yên tâm khi vận chuyển sản phẩm của mình trong một khoảng thời gian dài mà không cần phải bảo quản lạnh. Giảm thiệt hại sau thu hoạch. Quả có độ cứng cao hơn quả thông thường do đó nó không bị bầm dập trong quá trình vận chuyển và thời gian lưu thông trên thị trường lâu hơn. Kéo dài thời hạn sử dụng nhưng rau quả vẫn tươi ngon.

ppt67 trang | Chia sẻ: tienthan23 | Ngày: 06/12/2015 | Lượt xem: 2693 | Lượt tải: 4download
Bạn đang xem trước 20 trang tài liệu Đề tài Cà chua chuyển gen, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
TRƯỜNG ĐẠI HỌC NÔNG NGHIỆP HÀ NỘI KHOA: CÔNG NGHỆ SINH HỌC  CNSH trong Bảo quản chế biến nông sảnĐề tài: Cà chua chuyển genGiáo viên hướng dẫn: PGS.TS Ngô Xuân MạnhNhóm sinh viên thực hiện:Lê Trọng Tấn Dương Xuân ThảoĐinh Văn Lâm Lê Như SangTrần Ngọc Tiệp Đỗ Đức TrọngTrần Quyết Lê Thế ThuyênNguyễn Hữu Giới Lê Văn ChiếnBùi Văn CôngCà chua chuyển genNội dungCây trồng chuyển gen là gì?Tình hình cây trồng chuyển gen trên thế giới?Cách thức tạo ra cây trồng chuyển gen?Những khó khăn gặp phải sau thu hoạch?Độ chín của nông sản?Sự chín của nông sảnCấu trúc thành tế bào thực vật?Sự chín của quả cà chuaCác giai đoạn chín của quả cà chuaBảo quản cà chua sau thu hoạchCà chua chuyển gen FLAVR SARVTMCà chua chuyển gen sử dụng công nghệ chín chậm (DR – Delayed Ripening)Những lợi ích của việc tạo ra cà chua chuyển genWhat are transgenic plants?Transgenic plants result from the insertion of genetic material from another organism so that the plant will exhibit a desired trait. Recombinant DNA techniques (DNA formed by combining segments of DNA from different organisms) are usually used.Cây trồng chuyển gen là cây trồng ngoài vật chất di truyền sẵn có của nó còn được chuyển thêm vật liệu di truyền từ các sinh vật khác để tạo ra các tính trạng mong muốn bằng cách sử dụng kỹ thuật tái tổ hợp ADN.Diện tích cây trồng chuyển gen trên toàn thế giớiSự phân bố của cây trồng biến đổi gen 2001Các cây trồng được chuyển gen với nhiều đặc tính khác nhauHow are Transgenic Plants made?Transgenic plants are made by introducing new or foreign DNA into the genome of the plant by using recombinant techniques.Fours steps are involved in developing transgenic plants.Construction of the recombinant molecule.Transformation techniques.Selection and testing.Backcross and gene stability.Cây trồng chuyển gen được tạo ra bằng cách đưa đoạn ADN ngoại vào bộ genome của cây trồng nhờ sử dụng kỹ thuật di truyền.Cây trồng chuyển gen được tạo ra thông qua 4 bước:Thiết kế vector tái tổ hợpKỹ thuật biến nạp di truyềnChọn lọc và đánh giáLai lại và tạo tính ổn định di truyềnChuyển gen nhờ vi khuẩn Agrobacterium tumefaciensCấu tạo Ti-Plasmid của Agrobacterium tumefaciensCơ chế chuyển gen nhờ vi khuẩn Agrobacterium tumefaciens ?Những khó khăn gặp phải sau thu hoạch nông sản (cà chua)Tổn thất về số lượng: biểu hiện bằng sự hao hụt về số lượng cá thể trong khối nông sảnTổn thất khối lượng: biểu hiện bằng sự hao hụt chất khô hay thủy phần của từng cá thể nông sản (do tiêu hao trong quá trình hô hấp hoặc bị vi sinh vật hại).Tổn thất về chất lượng: biểu hiện bằng sự thay đổi chất lượng cảm quan, chất lượng dinh dưỡngDo chưa tích lũy đầy đủ, do các biến đổi trong quá trình bảo quản.Giá bán rẻ do lượng cung sản phẩm quá lớn (được mùa)Giải pháp khắc phục: tạo cây chuyển genĐộ chín của nông sảnĐộ chín sinh lý (physiological maturity): là thời điểm nông sản đã phát triển thuần thục hoàn toàn về phương diện sinh lý, quá trình sinh trưởng và tích lũy ngừng lại, nông sản chuyển sang giai đoạn chín hoặc già hóa.Độ chín thu hoạch (commercial maturity): là độ chín mà nông sản được thu hoạch theo nhu cầu của thị trường. Cà chua thu ở giai đoạn quả vẫn còn xanhĐộ chín chế biến: là độ chín thích hợp cho một quy trình chế biếnSự chín của nông sảnQuá trình chín là một sự thay đổi mạnh mẽ trong một vòng đời chuyển từ trạng thái thuần thục về sinh lý không ăn được sang trạng thái hấp dẫn về màu sắc, mùi, vị, đánh dấu kết thúc quá trình phát triển chuyển sang giai đoạn già hóa.Các biến đổi xảy ra trong quá trình chín của quảSự thành thục của hạtThay đổi màu sắcHình thành tầng rờiThay đổi về cường độ hô hấpThay đổi về cường độ sản sinh ethyleneThay đổi về tính thẩm thấu của mô và thành tế bàoThay đổi về cấu trúc (thành phần các hợp chất pectin)Thay đổi về thành phần các hợp chất hydratcarbonThay đổi các axit hữu cơThay đổi các proteinSản sinh các hợp chất tạo mùi thơmPhát triển lớp sáp bên ngoài vỏ quả Thay đổi về cường độ sản sinh ethylenEthylene (C2H4) là một phytohormone quan trọng điều khiển quá trình sinh trưởng phát triển của cây.Được tổng hợp chủ yếu trong các mô già đặc biệt là trong quả đang chínKhi chín thì hàm lượng ethylene tăng lên rất nhanh thúc đẩy quá trình chín của quảEthylene làm tăng tính thấm của màng tế bào nên giải phóng các enzyme liên quan đến quá trình chín như enzyme hô hấp, enzyme biến đổi độ mềm, mùi vị.Kích thích sự tổng hợp các enzyme tác động lên sự chín bằng cơ chế hoạt hóa genEhtylene hoạt hóa sự hình thành các enzyme cellulase, pectinase phân giải thành tế bào tạo thành tầng rời theo cơ chế hoạt hóa gen làm cho quả rụngThay đổi kết cấu thịt quảTinh bột chuyển thành đườngProtopectin chuyển thành pectin làm cho quả mềmCác hợp chất ở thành tế bào bị phân giảiTừ giải thuyết này các nhà khoa học đi theo hướng tạo cây cà chua chuyển gen ức chế sự phân hủy thành tế bào cho quả không bị mềm quá nhanh tăng thời gian bảo quảnThe Plant Cell Wall a | Cell wall containing cellulose microfibrils, hemicellulose, pectin, lignin and soluble proteins. b | Cellulose synthase enzymes are in rosette complexes, which float in the plasma membrane. c | Lignification occurs in the S1, S2 and S3 layers of the cell wall.Cấu trúc tế thành tế bào thực vậtThành phần hóa học: thành tế bào được cấu tạo từ polysaccarit, protein và các hợp chất thơmCellulose là thành phần cơ bản cấu trúc nên thành tế bào thực vật, thành tế bào được cấu tạo từ các bó sợi cellulose, các bó sợi này được nhúng vào một khối khuôn mềm dẻo vô định hình được tạo thành từ hemicellulose, pectin và protein. Hàm lượng celluose trong thành tế bào thay đổi theo loại tế bào và tuổi của tế bàoHemicellulose là các polysaccarit gồm các monosaccarit khác nhau liên kết với nhau tạo nên như: galactose, manose, xylose, arabinose (gồm khoảng 150-300 monome)Pectin: là thành phần quan trọng cấu trúc nên thành tế bào. Pectin kết dính với các tế bào với nhau tạo nên một khối vững chắc của các mô. Đặc biệt quan trọng là các protopectin. Nó gồm chuỗi axit pectinic kết hợp với canxi tạo nên pectat canxi. Khi thành tế bào bị phân hủy thì thành phần trước tiên bị phân giải là pectat canxi. Các pectin bị phân giải làm cho các tế bào tách khỏi nhau, không dính kết với nhau, như khi quả chín, hoặc lúc xuất hiện tầng rời trơớc khi rụngGalacturonic acid (đơn vị cấu tạo nên pectin)Cấu trúc thành tế bào thực vậtLớp giữa: được hình thành khi tế bào phân chia. Phần cấu trúc nằm giữa hai tế bào biến đổi thành lớp giữa và có nhiệm vụ gắn kết 2 tế bào với nhau chủ yếu là pectin dưới dạng pectat canxiLớp 1 hình thành trong quá trình sinh trưởng của tế bào được cấu tạo từ vật liệu vừa mềm dẻo, vừa đàn hồi để điều tiết sự sinh trưởng của tế bàoLớp thành thứ 2: được hình thành khi tế bào ngừng sinh trưởng có tác dụng tăng độ bền vững cơ học của thành tế bào làm cho tế bào mất khả năng sinh trưởngQuá trình chín của quảTrong quá trình chín của quả, quả thường chuyển từ trạng thái cứng sang trạng thái mềm. Sự thay đổi trạng thái này là do sự thủy phân protopectin thành các pectin hòa tan hoặc sự phá vỡ liên kết pectin với các thành phần khác của tế bào. Các enzyme tham gia vào quá trình này là pectinesterase, endopolygalacturonase, exopolygalacturonase. Enzyme pectinesterase (PE) hay pectinmethylesterase (PME) xúc tác cho sự thủy phân methylester trong chuỗi pectic, giải phóng các nhóm carboxyl tự do. Enzyme polygalacturonase (PG) thủy phân pectin tạo thành các polymer có trọng lượng phân tử nhỏ hơn (các monosaccharide)Quá trình chín của quảCả 2 loại enzyme polygalacturonase đều được tìm thấy trong mô quả sự tăng hoạt tính của chúng có liên quan chặt chẽ với sự tạo thành pectin hòa tan và sự thay đổi trạng thái quả khi chín. Enzyme exopolygalacturonase phân tách từng axit galacturonic từ đầu không khử của phân tử protopectinEnzyme endopolygalacturonase phá vỡ chuỗi pectin tại các vị trí bất kỳ, điều này có ảnh hưởng quan trọng tới khả năng hòa tan của các phân tử pectin, làm mô quả mềmGiới thiệu về cây cà chuaCà chua là cây trồng hàng năm yêu cầu thời gian hoàn thành vòng đời từ 4-6 tháng kể từ khi gieo hạt cho đến khi thu hoạchCà chua là cây trồng có phản ứng trung tính với ánh sáng, tự thụ phấn hoàn toànMột quả cà chua có thể chứa từ 20-150 hạt tùy thuộc vào giống và điều kiện ngoại cảnhHạt chín sinh lý 40-60 ngày sau khi thụ phấnQuả cà chua thuộc loại quả chín đột biếnHô hấp đột biến (Climateric): xảy ra khi quả đã bắt đầu chín. Cường độ hô hấp tăng đột biến trong thời gian ngắn tới đỉnh điểm sau đó giảm dần tương ứng với giai đoạn quả chín hoàn toàn, lúc này quả đạt chất lượng cao nhất. Hô hấp đột biến xảy ra ngay khi quả còn trên cây mẹ, có thể hái sớm và rấm khi cần thiếtHô hấp thường (Non-Climateric): quá trình chín xảy ra khi quả còn ở trên cây, cường độ hô hấp chậm dần trong quá trình sinh trưởng và sau thu hoạchNhững biến đổi chính xảy ra trong quá trình thành thục và chín của quả cà chuaChuyển hóa tinh bột thành đườngGiảm hàm lượng diệp lụcMất các enzyme quang hợpTích lũy các vitaminPhân hủy các hợp chất alkaloid như là -tomatinGia tăng sự tổng hợp ethylenTích lũy lycopene và -carotenQuá trình mềm hóa của thành tế bàoHô hấp tăngDiệp lụcEnzyme PGLycopeneHô hấpEthyleneThời gian (ngày)05101520Tinh bộtCác diễn biến xảy ra khi quả cà chua chínSự thay đổi sắc tố khi quả cà chua chíndaysdaysdays(Mature green)BreakCác giai đoạn chín của quả cà chuaThời kỳ quả xanh: quả và hạt phát triển chưa hoàn chỉnh. Nếu thu hái quả ở thời kỳ này và thông qua các phưng pháp thúc chín thì quả chín không bình thường, quả không có hương vị, không có mầu sắc đặc trưng của giống.Thời kỳ chín xanh: Chất keo bao quanh hạt được hình thành, quả chưa có mầu hồng hoặc màu vàng. Nếu đem thúc chín thì quả sẽ thể biện mầu sắc của giống.Các giai đoạn chín của cà chua (tiếp)Thời kỳ chín vàng : Đỉnh quả xuất hiện màu vàng hoặc màu hồng với diện tích bề mặt chiếm khoảng 10%.Thời kỳ chuyển màu: Diện tích bề mặt từ 10-30% có mầu vàng hoặc đỏ.Thời kỳ chín hồng: Diện tích bề mặt quả từ 30-60% có mầu hồng nhạt hoác mầu vàng.Thời kỳ quả hồng hoặc đỏ : Diện tích bề mặt quả từ >60-90% có mầu vàng hoặc đỏ.Thời kỳ quả chín đỏ: Diện tích bề mặt từ trên 90% trở lên.Bảo quản cà chua sau thu hoạch Bảo quản trong điều kiện tự nhiên. Chọn những quả có khối lượng quả trung bình, khi chín quả rắn chắc. Chọn quả ở thời kỳ chín xanh, thu hái quả về sắp xếp quả ở nơi thoáng mát (không được chất đống) để giảm nhiệt độ trong quả, giảm hô hấp. Dùng vải mềm, giấy mềm lau chùi quả sạch, tách bỏ lá đài, không để lại vết nứt, rách. Sau đó đưa quả lên dàn hoặc xếp quả vào khay gỗ, khay nhựa, những khay nhựa có thể chồng lên nhau nhưng không cao quá lắm. Nên phân cấp quả khi bảo quản, thường xuyên kiểm tra trong thời gian bảo quản để giảm thiểu hiện tượng hao hụt khối lượng và chất lượng. Phân loại cà chua trước khi đưa vào bảo quảnBảo quản cà chua truyền thốngBảo quản cà chua Flavr Savr trên đồng ruộngChuyển gen tạo cà chua FLAVR SAVRTMĐối tượng tiến hành chuyển gen là giống cà chua Lycopersicon esculentumTính trạng chuyển: hãm quá trình mềm của quả thông qua việc ức chế sự hoạt động của enzyme PG (Polygalacturonase)Chuyển gen thông qua vi khuẩn đất Agrobacterium tumefaciensMục đích sử dụng cho tiêu dùng hoặc chế biến sản phẩm đã được thương mại hóaSản phẩm rất an toàn cho người sử dụngPectin làm cho tế bào cứng rắnKhi quả chín lớp vỏ quả mềm là do quá trình phân giải pectin do enzyme tế bào sinh raPGPolygalacturonase enzymePectin làm cho tế bào cứng rắn Sự mềm của quá là nhờ vào quá trình phá hủy cấu trúc của pectinPGPolygalacturonaseC2H4The Flavr Savr tomato ripens on the vine – resulting in fuller flavour. It is modified so that it remains firm after harvesting. Flavr Savr Traditional Ripe and Increased Flavour.Ripe but decreased Flavour. The traditional tomato is sprayed with ethylene after shipping to induce ripening. The traditional tomato must be harvested while it is still green and firm so that it is not crushed on the way to the supermarket. Công nghệ đối bản sử dụng để hạn chế PG enzymeTATATACGAAGGCACATATATGCTTCCGTGTACGAAGGCAC..TATAATGCTTCCGTGATATAUGCUUCCGUGPPUACGAAGGCACAUGCUUCCGUG UACGAAGGCACSợi kép ARN không thể phiên mã do đó không tạo ra enzyme PGSENSEANTISENSECông nghệ ARN ngược nghĩaAntisense TechnologyCà chua chuyển gen đối bản PG giảm thiểu tới 95% PG enzymeCà chua Flavr-Savr chín ngay trên cánh đồng nhưng quả vẫn rắn chắc trong một thời gian dàimRNA sẽ bắt cặp bổ sung với sợi đối bản với nó và không tiến hành dịch mã được do đó enzyme PG không được tạo ra, kết quả là pectin không bị phân hủyPG genetranscriptionmRNAtranslationPG genetranscriptionmRNAAntisense mRNAtranslationAntisense TechnologySơ đồ quá trình chuyển gen vào cà chua thông qua vi khuẩn Agrobacterium Trong quá trình chín của quá enzyme PG sinh ra sẽ phá vỡ cấu trúc pectin ở thành tế bào làm cho quá chuyển về trạng thái mềmCà chua chuyển gen đối bản PG sẽ tạo ra lượng PG ít hơn Thành tế bào sẽ mềm chậm hơnNhiều gen được vận dụng theo cách đó để trả lời các câu hỏi- Vai trò của hormone đối với quá trình chínCác enzyme đã thực hiện như thế nào trong thành tế bào quả chínWild-type fruitAntisense PG fruitPG activityDays from 1st colour change0102468Thay đổi quá trình chín của quả nhờ antisense RNA Thời gian thu hoạch khi quả chuyển màu sắc chín đỏ tích lũy đầy đủ các chấtKhông cần phải xử lý quả chín bằng ethylene, để cho quả chín trực tiếp trên đồng ruộngQuả cứng rắn, thành quả bị phân hủy từ từ làm cho chất lượng quả ổn định và có thể dự trữ trong kho trong một khoảng thời gian dàiThu hoạch ở giai đoạn chín thương phẩm, quả vẫn còn xanh, khi thu về vẫn còn hiện tượng hô hấp chín tiếp (cà chua thuộc loại quả hô hấp đột biến) làm giảm hàm lượng các chất trong quảXử lý quả chín bằng ethyleneQuả nhanh bị thối, dập nát do vỏ quả mềmFLAVOR SAVR Cà chuaCà chua truyền thốngThành phần dinh dưỡng của cà chua FLAVR SAVR so với cà chua thườngSản phẩm cà chua chuyển gen được bầy bán trong siêu thịSản phẩm được thương mại hóa và sản xuất thành đồ hộpSơ đồ quá trình tổng hợp ethylene ở thực vậtSơ đồ quá trình tổng hợp ethylene ở thực vậtMACCAdeninATPMTRMTASAMMTR-1-PHCNO2Malonyl CoACO2ACC oxidaseEthyleneACCACC synthetaseGACCMTA nudosidaseMTR kinaseYang CycletransaminaseL-MethionineSAM synthetaseKMBAỨc chế sự tổng hợp ethyleneĐiều khiển sự chín chậm thông qua ức chế sự tổng hợp ethylene qua chuyển genỨc chế sự biểu hiện của gen ACC synthase. ACC (1-aminocyclopropane-1-carbonxylic acid) synthase là enzyme chịu trách nhiệm chuyển hóa S-adenosylmethiomine (SAM) thành ACC; từ bước thứ hai tới bước cuối cùng trong quá trình sinh tổng hợp ethylene.  Sự biểu hiện của enzyme bị cản trở khi một antisense hoặc một đoạn của bản sao gen synthase được chuyển vào trong genome của thực vật. Chuyển gen ACC deaminase. Gen mã hóa cho enzyme này nhận được từ một vi khuẩn đất (Pseudomonas chlororaphis) không gây bệnh. Vi khuẩn này có khả năng chuyển hóa ACC thành một phân tử khác, nhờ vậy làm giảm lượng ACC có thể nhận được để tạo ethylene. Điều khiển sự chín chậm thông qua ức chế sự tổng hợp ethylene qua chuyển genChuyển gen SAM hydrolase. Phương pháp này cũng tương tự như ACC diaminase, bằng cách giảm tiền chất của ethylene. Trong trường hợp này, SAM được chuyển hóa thành homoserine. Gen mã hóa cho enzyme này được phân lập từ thể thực khuẩn E. Coli T3. Ức chế sự biểu hiện của gen ACC oxidase. ACC oxidase là enzyme xúc tác cho sự oxi hóa ACC thành ethylene, bước cuối cùng trong con đường sinh tổng hợp ethylene. Thông qua công nghệ anti-sense, giảm sự điều khiển gen ACC oxidase dẫn đến ức chế sự hình thành ethylene, do đó làm chậm sự chín của quả. Sơ đồ vector chuyển gen ACC deaminaseChọn lọc cây chuyển gen nhờ nptII geneProtein NPTII xúc tác cho quá trình chuyển nhóm phosphate từ adenosine 5’-triphosphate (ATP) tới chất kháng kháng sinh có nhóm adenosineglycoside do đó làm bất hoạt các chất kháng sinh.Sự có mặt của gen NPTII cho phép chúng ta có thể chọn được các cây cà chua chuyển gen thông qua môi trường có chứa chất kháng sinh kanamycineHóa chất và hướng dẫn sử dụng gen nptII markerCà chua chuyển gen chín chậmNhững lợi ích của cà chua chuyển genThời hạn sử dụng sản phẩm tăng lên mang lại lợi ích cho cả người sản xuất và người tiêu dùng.Bảo đảm về chất lượng rau quả trên thị trường. Giờ đây, nông dân có thể chờ rau quả trưởng thành đầy đủ mới thu hoạch. Người tiêu dùng có thể mua được hàng hóa tốt với giá tiền phù hợp.Nông dân yên tâm khi vận chuyển sản phẩm của mình trong một khoảng thời gian dài mà không cần phải bảo quản lạnh.Giảm thiệt hại sau thu hoạch. Quả có độ cứng cao hơn quả thông thường do đó nó không bị bầm dập trong quá trình vận chuyển và thời gian lưu thông trên thị trường lâu hơn.Kéo dài thời hạn sử dụng nhưng rau quả vẫn tươi ngon. Tài liệu tham khảoGiáo trình bảo quản chế biến nông sản Nguyễn Mạnh Khải (Chủ biên) NXBNN 2005Giáo trình sinh lý thực vật – Nguyễn Quang Sáng (Chủ biên) NXBNN 2005Tomato with a Delayed Ripening GeneTransgenic Crops ột số tài liệu khác

Các file đính kèm theo tài liệu này:

  • pptca_chua_chuyen_gen_913.ppt
Luận văn liên quan