Đề tài Định lượng kháng nguyên Cyfra 21-1 bằng kỹ thuật Real-time PCR

Mở đầu Theo thống kê của Tổ chức Nghiên cứu ung thư Thế giới (International Agency for Research on Cancer_ IARC), ung thư phổi là nguyên nhân gây tử vong hàng đầu trong số các bệnh về ung thư. Tổng số người chết vì ung thư phổi hàng năm cao hơn tổng số người chết vì ung thư vú, ung thư ruột và ung thư tuyến giáp, và đứng thứ hai trong tổng số tử vong vì bệnh sau các bệnh về tim mạch. Các thống kê từ hiệp hội Ung thư quốc gia của Việt Nam cũng đưa ra những cảnh báo tương tự, số bệnh nhân ung thư phổi gia tăng liên tục trong những năm gần đây. Phần lớn bệnh nhân ung thư khi được phát hiện đã ở giai đoạn cuối không chữa trị được, đa số bệnh nhân bị tử vong. Vì rất nhiều lí do như: hút thuốc lá, môi trường sống bị ô nhiễm, thực phẩm không an toàn nên căn bệnh nguy hiểm này ngày càng trở nên phổ biến. Mặc dù đây là một căn bệnh rất nguy hiểm nhưng nếu bệnh nhân được phát hiện sớm và được điều trị theo những phác đồ thích hợp thì người bệnh vẫn có cơ hội được cứu sống, thậm chí là khỏi bệnh. Ngoài những phương pháp chẩn đoán ung thư truyền thống như: chụp hình phổi bằng X_quang, chụp CT Scan phổi .các nhà khoa học đang nỗ lực nghiên cứu nhằm tìm ra cách chẩn đoán nhanh và chính xác bệnh ung thư. Sự phát triển như vũ bão của ngành sinh học phân tử đã mở ra một hướng mới trong nghiên cứu Sinh_Y_Dược học. Việc tìm ra những chỉ thị sinh học đã giúp cho các bác sĩ chẩn đoán và phát hiện bệnh một cách nhanh chóng, có độ chính xác cao hơn. Các chỉ thị sinh học có liên quan đến chẩn đoán bệnh ung thư cũng đang được quan tâm. Trong đo, Cyfra21-1 là một chỉ thị có độ nhạy tương đối cao đối với ung thư phổi và đang được nghiên cứu. Do đó chúng tôi tiến hành thực hiện đề tài: “Định lượng kháng nguyên Cyfra 21-1 bằng kỹ thuật Real-time PCR”. Để từ đó nghiên cứu và tạo ra một bộ Kít định lượng để có thể chẩn đoán Ung thư phổi một cách nhanh chóng, có độ chính xác cao.

doc47 trang | Chia sẻ: lvcdongnoi | Ngày: 03/06/2013 | Lượt xem: 2139 | Lượt tải: 2download
Bạn đang xem nội dung tài liệu Đề tài Định lượng kháng nguyên Cyfra 21-1 bằng kỹ thuật Real-time PCR, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
n radon có trong sỏi đá. Nó có thể làm tổn hại tới phổi và từ đó có thể dẫn đến ung thư phổi. Những người làm việc trong hầm mỏ có thể tiếp xúc với khí radon. Ở một số vùng ở Mỹ, người ta còn tìm thấy khí radon ở trong những ngôi nhà. 1.1.5.3. Amiang Amiang là tên gọi của một nhóm các chất khoáng, chúng tồn tại trong tự nhiên dưới dạng sợi và được sử dụng trong một số nghành công nghiệp. Amiang có hai nhóm chính là nhóm amphibole và nhóm serpentine. Nhóm amphibole khi hấp thụ qua đường hô hấp và lưu lại trong phổi sẽ rất khó bị đào thải ra ngoài. Các sợi thuộc nhóm amphibole là nguyên nhân chính gây ra các bệnh ung thư phổi, u trung biểu mô. 1.1.5.4. Nghề nghiệp Các thống kê bệnh học cho thấy, chất phóng xạ đóng vai trò quan trọng trong phát sinh bệnh ung thư. Những người thường xuyên tiếp xúc với các chất phóng xạ, niken, cromat, amian và các chất sinh ra do chưng cất hắc ín thường dễ bị ung thư. Các chất này cũng là nguyên nhân dẫn đến Ung thư phổi ở những người không hút thuốc (chiếm khoảng 15-20%). Nghiên cứu của Doll (1958) cho thấy: công nhân làm việc trong công nghiệp niken bị chết do Ung thư phổi là 26%, cao hơn 9 lần so với những công nhân làm việc trong các ngành công nghiệp khác. 1.1.5.5. Môi trường Các nhà nghiên cứu đã tìm ra mối liên kết giữa bệnh ung thư phổi và sự phơi nhiễm với một số chất gây ô nhiễm môi trường không khí nhất định (ví dụ: các sản phẩm phụ sinh ra trong quá trình đốt dầu Diezen và những nguyên liệu hóa thạch). Tuy nhiên, mối quan hệ này vẫn chưa được xác định một cách rõ ràng và vẫn đang tiếp tục được nghiên cứu. Nhiều thống kê cho thấy, tỉ lệ mắc ung thư phổi ở các thành phố công nghiệp, đặc biệt là các thành phố có ngành công nghiệp hóa chất cao hơn hẳn so với các vùng nông thôn. Trong bầu khí quyển của các thành phố này có chứa nhiều chất độc hại như benzopyren…..Các chất này kích thích và gây ra phản ứng với lớp niêm mạc của đường hô hấp làm cho quá trình tiết chất nhầy bị chậm lại, sau đó biểu mô bị bong ra, rồi lại được tái sinh. Những chu kì như vậy liên tiếp diễn ra đã kích thích sự tăng sản của tế bào đáy, dị sản của tế bào biểu mô đẫn đến sự hình thành và phát triển của các tế bào ung thư. 1.1.5.6. Các yếu tố khác Ngoài những nguyên nhân trên, các nhà khoa học còn phát hiện thấy virus là nguyên nhân gây Ung thư phổi ở khỉ. Điều này đặt ra câu hỏi: liệu ung thư phổi có phải do virus gây ra không? Đây vẫn là một ẩn số lớn đối với các nhà khoa học. Tiền sử bản thân người bệnh cũng là một nguyên nhân gây ung thư phổi. Một người đã mắc ung thư phổi một lần có nguy cơ mắc ung thư phổi lần hai cao hơn so với một người chưa bao giờ mắc bệnh ung thư phổi.Bỏ hút thuốc sau khi được chẩn đoán ung thư phổi có thể ngăn ngừa nguy cơ bị ung thư phổi lần hai. Các nhà nghiên cứu vẫn tiếp tục tìm hiểu những nguyên nhân gây ra bệnh ung thư phổi và tìm kiếm những cách thức để phồng chống căn bệnh này. Chúng ta đã biết, cách tốt nhất để phòng chống bệnh ung thư phổi là bỏ hút thuốc lá, càng bỏ hút thuốc lá sớm thì càng tốt. Thậm chí, nếu bạn đã hút thuốc lá trong một thời gian dài thì việc bỏ hút thuốc lá cũng vẫn không bao giờ là quá muộn. 1.2. Kháng nguyên Cyfra 21-1 1.2.1. Kháng nguyên 1.2.1.1. Định nghĩa Kháng nguyên được định nghĩa là một chất tương tác với các phân tử kháng thể và thụ thể kháng nguyên trên các tế bào lympho. Một chất gây miễn dịch là một kháng nguyên được cơ thể nhận biết như một chất ngoại lai và kích thích phản ứng miễn dịch thích ứng. Để đơn giản hóa, kháng nguyên và chất gây miễn dịch đều được xem là kháng nguyên.[2,3] 1.2.1.2. Bản chất hóa học của kháng nguyên Về bản chất hóa học, kháng nguyên là những phân tử protein có khối lượng phân tử lớn (kể cả các protein cộng hợp như các glycoprotein, lipoprotein và nucleoprotein) và các polysaccharide (kể cả lipopolysaccharide). Các kháng nguyên protein và polysaccharide này được tìm thấy trên bề mặt của virus, tế bào vi khuẩn, nấm, đơn bào và tế bào người.[3] 1.2.1.3. Nguồn gốc kháng nguyên 1.2.1.3.1. Kháng nguyên ngoại sinh Kháng nguyên ngoại sinh là kháng nguyên xâm nhập vào cơ thể từ bên ngoài do: hít, ăn, tiêm. Bằng quá trình nhập nội bào hoặc thực bào, các kháng nguyên này được đưa vào tế bào trình diện kháng nguyên (ACP) và được xử lí thành các mảnh nhỏ. Sau đó các ACP trình diện các mảnh nhỏ này cho tế bào Lympho T giúp đỡ (CD4+) bằng cách dung phân tử phù hợp mô loại II trên bề mặt của chúng. Một số tế bào Lympho T đặc hiệu cho phức hợp peptide: MHC. Chúng trở nên hoạt hoá và bắt đầu tiết Cytokine. Cytokine là các chất có khả năng hoạt hoá Lympho bào T độc tế bào (CLL), tế bào Lympho B tạo kháng thể, đại thực bào và các tế bào khác. 1.2.1.3.2. Kháng nguyên nội sinh Kháng nguyên nội sinh là các kháng nguyên được sản xuất bên trong tế bào, là kết quả của quá trình chuyển hoá tế bào bình thường, hoặc do nhiễm khuẩn nội bào hay nhiễm virus. Sau đó các mảnh kháng nguyên được trình diện trên bề mặt tế bào trong phức hợp phân tử phù hợp mô loại I. Nếu tế bào Lympho T CD8+ độc tế bào nhận ra chúng, các tế bào Llympho T này bắt đầu tiết các loại độc tố khác nhau gây ly giải hoặc chết theo chương trình (apoptosis) tế bào bị nhiễm. Để giữ tế bào độc tế bào khỏi giết nhầm các tế bào vốn chỉ sản xuất protein của chính nó, các tế bào lympho T tự đáp ứng được loại ra khỏi quá trình miễn dịch qua cơ chế dung nạp trung ương (cũng được biết là quá trình chọn lọc âm tính xảy ra ở tuyến ức). Chỉ những Lympho bào T độc tế bào nào không phản ứng với peptide của chính nó (peptide này được trình diện trong tuyến ức qua phân tử MHC loại I) mới được phép vào máu. Có một ngoại lệ không thuộc ngoại sinh lẫn nội sinh được gọi là trình diện chéo. 1.2.1.4. Kháng nguyên khối u Kháng nguyên khối u là các kháng nguyên được trình diện bởi các phân tử MHC I trên bề mặt tế bào khối u. Đôi khi các kháng nguyên này chỉ được trình diện bởi các tế bào khối u và không có ở tế bào thường. Trong trường hợp này, chúng được gọi là kháng nguyên đặc hiệu khối u và thường là kết quả của một đột biến đặc hiệu cho khối u. Phổ biến hơn, các kháng nguyên này được trình diện ở tế bào khối u lẫn tế bào thường, khi đó chúng được gọi là kháng nguyên liên hệ khối u. Nếu lympho bào T độc bào nhận ra kháng nguyên này, chúng có thể tiêu diệt tế bào khối u trước khi tế bào khối u tăng sinh và di căn. Kháng nguyên khối u cũng có thể có trên bề mặt khối u ở dạng thụ thể bị đột biến. Trong trường hợp này chúng bị nhận diện bởi tế bào B. 1.2.1.5. Các loại kháng nguyên -Miễn dịch nguyên: kháng nguyên loại này kích thích đáp ứng miễn dịch khi được đưa vào trong cơ thể. Miễn dịch luôn luôn là một đại phân tử (protein, polysaccharide). Khả năng kích thích đáp ứng miễn dịch của nó phụ thuộc vào tính lạ đối với vật chủ, kích thước phân tử, thành phần hoá học và tính không đồng nhất (vd: phân tử protein chứa nhiều loại amino axit khác nhau). -Dung nạp nguyên: kháng nguyên loại này kích thích tình trạng không đáp ứng miễn dịch đặc hiệu do hình dạng phân tử của nó. Khi thay đổi hình dạng, nó có thể trở thành miễn dịch nguyên. -Dị ứng nguyên: đây là chất gây phản ứng dị ứng. Chúng có thể xâm nhập vào cơ thể qua nhiều con đường như: ăn, hít, tiêm hoặc tiếp xúc với da. Tế bào trình diện với kháng nguyên của chúng qua phân tử phù hợp mô. Các tế bào miễn dịch khác nhau có thể được hoạt hoá tuỳ thuộc vào kháng nguyên được trình diện và loại phân tử phù hợp mô. 1.2.2. Kháng nguyên Cyfra 21-1 Trên thế giới hiện nay có khá nhiều chỉ thị sinh học liên quan đến ung thư phổi, trong đó các nhà khoa học đang rất quan tâm đến một chỉ thị mới, có độ nhạy cao với ung thư phổi là Cyfra 21-1 nằm trong nhóm chỉ thị Cytokeratin, một cấu trúc trong bộ khung tế bào. 1.2.2.1. Cytokeratin Cytokeratin thuộc họ sợi trung gian, đặc biệt hữu ích trong chẩn đoán bất thường ở tế bào, chẳng hạn như ung thư. Bởi vậy, các nhà ung thư học hiện nay đang tích cực nghiên cứu kỹ hơn về cấu trúc và vai trò của Cytokeratin, nhằm tìm ra giải pháp chống lại sự hoành hành của căn bệnh toàn cầu – Căn bệnh ung thư. Cấu trúc sợi đã được quan sát trong nhân và tế bào chất từ rất lâu. Nhưng chỉ ngần đây, những kiến thức về chức năng thực sự của bộ khung tế bào mới được tìm hiệu cặn kẽ và chi tiết. Ở tế bào nhân chuẩn, bộ khung tế bào được tạo thành từ 3 loại cấu trúc sợi, khác nhau về hình thái: vi sợi (microfilament), sợi trung gian (intermidiatefilament) và vi ống (microtubules). Bộ khung xương tế bào hợp nhất được hình thành từ hệ thống 3 loại sợi là yếu tố then chốt trong một quá trình như phân bào, vận động và tương tác tế bào với tế bào. Trong cấu trúc sợi, họ protein sợi trung gian là phức tạp nhất, bao gồm vài trăm thành viên khác nhau. Dựa trên những đặc điểm như sự tương đồng về trình tự và cách biểu hiện, người ta phân loại chúng thành một vài nhóm. Sợi trung gian nhóm I và II tạo thành Cytokeratine (theo thứ tự là các protein axit và bazo), trong khi đó sợi trung gian nhóm III gồm các protein axit dạng sợi desmin, vimentin và glial. Loại IV bao gồm các sợi protein thần kinh (NF-L, NF-M và NF-H) và internexin, còn protein nhóm V được gọi là các lamin nhân (chỉ cở nhân tế bào). Các protein cytokeratin còn lại đôi khi được xếp vào nhóm VI, gồm có felensin và phakinin. Cytokeratin biểu mô (sợi trung gian nhóm I và II) được hình thành trong quá trình phát sinh và có liên quan gần gũi về mặt sinh hóa và miễn dịch. Ngày nay, hơn 20 loại Cytokeratin khác nhau đã được biết đến và được chia thành các nhóm I và II dựa vào tính tương đồng trình tự. Các Cytokeratin từ 1-8 tạo thành nhóm II (53-68 kDa, các thành phần protein trunng tính đến bazo), còn Cytookeratin 9-20 tạo thành nhóm I (40-56 kDa, các protein axit), trong đó các Cytokeratin 8, 18, 19 có nhiều nhất ở các tế bào biểu mô đơn giản. Các Cytokeratin khi giải phóng khỏi các tế bào đang tăng sinh hoặc chết theo chương trình, tạo ra các chỉ thị hữu ích cho khối u biểu mô ác tính, phản ánh rõ nét hoạt động của tế bào. Những chỉ thị này xuất hiện đặc trưng cho các Cytokeratin nhất định và sự giải phóng tiểu đơn vị của chúng diễn ra liên quan đến apoptosis.[9,11,13,14] 1.2.2.1.1. Cấu trúc chung của một Cytokeratin Một Cytokkeratin điển hình bao gồn 3 vùng: vùng đầu N (không xoắn), vùng trung tâm (chủ yếu có cấu trúc xoắn) và đầu C (không xoắn). Hình 2: Cấu tạo của Cytokeratin Phần xoắn ở vùng trung tâm (chủ yếu là cấu trúc xoắn alpha) gồm 300-320 axit amin có tính bảo tồn về trình tự và được chia thành 4 vùng khác nhau: 1A, 1B, 2A và 2B. Thành phần axit amin của cá vùng xoắn được bảo toàn về kích thước và chứa các trình tự axit amin lặp lại ở phần dư. Các đoạn xoắn tách biệt nhau nhờ các vùng liên kết ngắn hơn là L1, L1-2 và L2.[9,11,13,14,15] 1.2.2.1.2. Biểu hiện của Cytokeratin Cytokeratin biểu hiện khác nhau ở các dạng tế bào biểu mô, ở quy mô phát triển và quá trình biệt hóa của các mô. Trong suốt quá trình biến đổi của tế bào từ bình thường thành tế bào ác tính, đặc tính của Cytokeratin thường được duy trì. Ưu điểm này làm cytokeratin được ứng dụng như các chỉ thị khối u. Những biến đổi sau khi dịch mã của các vùng ở trung tâm rất hiếm thấy, nhưng những biến đổi này xuất hiện khá nhiều ở vùng đầu N và C, bao gồm sự phosphoryl hóa, glycosyl hóa và sự vận chuyển glutamine hóa. Những biến đổi này làm tăng tính tan và gây ra sự sắp xếp lại các sợi. Trong bộ khung, Cytokeratin là điển hình cho tính tan rất thấp, nhưng khi lưu thông người ta nhận thấy rằng các Cytokeratin đều bắt nguồn từ các sợi protein nguyên vẹn bị biến tính một phần tạo thành các phức hệ nhỏ hoặc các polymer protein lớn. Các phân tử Cytokeratin nguyên vẹn không tham gia trong lưu thông. Thời gian bán hủy của sợi Cytokeratin trong lưu thông khoảng 10-15h, phụ thuộc vào kích thước sợi. Quá trình giải phóng sợi Cytokeratin tan vào lưu thông diễn ra rất phức tạp và chưa được làm sáng tỏ hoàn toàn. Trong lúc giải phóng tự khối u, có thể nhận ra Cytokeratin với một lượng lớn trong dịch thể gồm: máu, nước tiểu, dịch tế bào và dịch màng phổi. Thông thường trong các cá thể khỏe, nông độ Cytokeratin lưu thông rất thấp. Nồng độ tăng một cách đặc biệt trong những người bệnh có bệnh Ung thư biểu mô.[10] 1.2.2.2. Cyfra 21-1 Cyfra 21-1 là một phân đoạn của cytokeratin 19 (đặt tên theo chữ viết tắt của cytokeratin fragment) tiết ra mạnh khi tế bào biểu mô phổi tăng sinh bất thường. Cytokeratin 19 có cấu trúc giống các cytokeratin khác với kích thước khoảng 40 kDa, gồm 400 axit amin. Gene mã hóa cho cytokeratin 19 nằm trên nhiễm sắc thể 17 có kích thước 4667bp với 6 exon mã hóa cho mARN kích thước 1382bp. Hình 3: Sơ đồ gene mã hóa cho Cytokeratin 19 Fujita.J và các cộng sự cho rằng, sở dĩ cytokeratin 19 (40kDa) mất một phần đầu C để trở thành Cyfra 21-1 (37kDa) có liên quan đến vị trí Met-Asp nhậy cảm với một số protease.[12,16] 1.3. Kháng thể 1.3.1. Đinh nghĩa Kháng thể là một sản phẩm đặc hiệu được hệ miễn dịch tổng hợp giúp cơ thể tấn công các tác nhân gây bệnh. Kháng thể là các Immunoglobiulin (có bản chất glycoprotein), do các tế bào Lympho B, các tương bào (biệt hoá từ Lympho B) tổng hợp và tiết ra giúp hệ miễn dịch nhận biết và vô hiệu hoá các tác nhân lạ. (Vd: các vi khuẩn hoặc virut).[3] 1.3.2. Cấu tạo Các kháng thể có cấu trúc hình chữ Y, có hai bộ “cành” gắn vào một “thân”. Các đầu của Y (Fab) được gọi là các vùng biến đổi, ở phía đầu các cành chứa các vùng gắn kết kháng nguyên (vùng quyết định bổ trợ, CDR) và thân (Fc) là một vùng hằng định. Các vùng hằng định chứa “lẫy khởi động” chức năng phản ứng lại kích thích bằng việc gắn kết các phức hệ của tế bào khác của hệ miễn dịch. Kháng thể thực hiện các chức năng cơ bản như liên kết đặc hiệu với kháng nguyên, hoạt hoá các bổ thể, hoạt hoá các tế bào miễn dịch. Hình 4: Cấu tạo của kháng thể 1.3.3. Phân loại kháng thể 1.3.3.1. Kháng thể đa dòng Là một tập hợp các kháng thể đặc hiệu với các epitope khác nhau trên một kháng nguyên cho trước. Trong đáp ứng miễn dịch, cơ thể tổng hợp nhiều kháng thể tương ứng với các epitope của cùng một kháng nguyên. Đáp ứng như vậy gọi là đa dòng. Các kháng thể đa dòng, mỗi kháng thể liên kết với một epitope khác nhau 1.3.3.2. Kháng thể đơn dòng Là những kháng thể được tổng hợp từ một dòng tế bào Lympho B. Chúng chỉ nhận biết một epitope đặc hiệu trên một kháng nguyên cho sẵn.[3] Để tăng hiệu quả điều trị của các kháng thể đơn dòng, các nhà khoa học đã kết hợp các gene tái tổ hợp mã hoá các kháng thể đơn dòng có vùng gắn kết với cùng một vị trí (một epitope) của kháng nguyên. Các kháng nguyên đơn dòng có thể là: - Kháng thể đơn dòng chuột - Kháng thể đơn dòng khỉ - Kháng thể đơn dòng gà - Kháng thể đơn dòng người 1.3.3.3. Phương pháp sản xuất kháng thể đơn dòng - Kỹ thuật hybridoma - Tạo mảnh kháng thể đơn dòng bằng kỹ thuật gene - Kỹ thuật phage display (được dùng để tạo kháng thể đơn dòng dạng đơn chuỗi_scFv). 1.3.3.4. Kháng thể đơn chuỗi (scFv) Cùng với sự phát triển của công nghệ sản xuất kháng thể, các mảnh kháng thể được tạo ra bằng kỹ thuật sinh học đã đạt được những tiến bộ đáng kể. Kháng thể đơn chuỗi (scFv) là một trong những kháng thể phổ biến nhất. Kháng thể đơn chuỗi bao gồm vùng biến đổi của chuỗi nặng và chuỗi nhẹ (VL và VH) của phân tử kháng thể hoàn chỉnh được nối với nhau bằng linker polypeptide linh động. Hình 5: Cấu tạo của kháng thể và kháng thể đơn chuỗi So với kháng thể đơn dòng thì kháng thể đơn chuỗi (scFv) có một số ưu điểm sau: - Chúng dễ dàng được sản xuất với số lượng lớn và giá thành. - Kích thướng nhỏ của chúng cho phép chúng dễ dàng xâm nhập vào mô và khối u rắn, có tính hướng đích cao. - Kháng thể đơn chuỗi dễ dàng được dung hợp với một protein khác như enzym hap protein phát huỳnh quang để tạo thành phân tử hoàn chỉnh dùng cho những thử nghiệm miễn dịch. 1.4 Phương pháp Real-time PCR 1.4.1. Kỹ thuật PCR 1.4.1.1. Định nghĩa PCR là tên gọi tắt của phản ứng chuỗi polymedase (Polymedase Chain Reaction = PCR) để nhân các bản của đoạn DNA trong ống nghiệm. 1.4.1. 2. Nguyên lý Phản ứng chuỗi polymedase (PCR) được Mullis và cộng sự mô tả đầu tiên và đã góp phần đem lại cho Mullis giải thưởng Nobel y học và sinh lý năm 1993. PCR là quá trình tương đối đơn giản cho phép nhân nhanh 1 số lượng không hạn chế nguyên bản 1 đoạn DNA nhất định trong một khoảng thời gian ngắn. Quá trình nhân bản bằng Enzyme này bao gồm 3 bước lặp lại nhiều lần. - Bước 1: Biến tính DNA từ dạng sợi kép thành dạng sợi đơn bằng cách nâng cao nhiệt độ lên 94-95 oC trong khoảng thời gian ngắn. - Bước 2: Tiếp hợp đoạn mồi (primer) thông qua hạ nhiệt độ xuống 40-60oC. Hai đoạn mối là các oligonucletid dài khoảng 18-24 bazo sẽ tiếp hợp theo nguyên tắc bổ sung với đoạn DNA tương đồng ở hai đầu của đoạn DNA cần nhân. - Bước 3: Phản ứng polymedase tổng hợp phân tử DNA kéo dài từ đoạn mồi. Hai phản ứng DNA mới được tổng hợp theo nguyên tắc bổ sung từ hai đầu phân tử ban đầu. Để tránh hiện tượng tiếp hợp không đặc thù, phản ứng tổng hợp được thực hiện ở 72 oC Loại polymedase thường dùng trong PCR là loại chịu nhiệt (Taq DNA polymedase) được tách chiết từ vi khuẩn Thermus aquaticus hoặc chủ yếu là enzyme tái tổ hợp. Như vậy, mỗi vòng phản ứng sẽ có 2 lần số lượng DNA của đoạn DNA cần nhân được tổng hợp, hệ số nhân bản tính theo số chu kỳ n là 2n.[6] Vd: Sau 20 chu kỳ có tới trên 30 triệu bản của 1 đoạn DNA được nhân lên. 1.4.2. Kỹ thuật Real-time PCR 1.4.2.1. Nguyên lý Real-time PCR là PCR tại thời điểm thực, nghĩa là quá trình khuếch đại DNA đang diển ra theo từng chu kỳ nhiệt được theo dõi trực tiếp. Real-time PCR gồm hai quá trình diễn ra đồng thời: - Quá trình khuếch đại DNA bằng PCR - Đo độ phát quang tỷ lệ thuận với số lượng phân đoạn DNA tạo thành. Hệ thống Real-time PCR bao gồm máy chu trình nhiệt (PCR) được nối với máy phát hiện quang phổ huỳnh quang và máy vi tính. Nguyên lý chủ yếu của Real-time PCR là dựa trên cơ sở phát hiện và định lượng thể thông báo huỳnh quang (fluorescent reporter). Hàm lượng sản phẩm PCR bắt đầu tăng lên cao từ chu kỳ ngưỡng (CT: threshold cycle) tương quan chặt chẽ với hàm lượng DNA đích ban đầu. Người ta thường sử dụng 3 dạng đầu dò để định lượng DNA bằng Real-time PCR: - Các chất liên kết DNA như: SYBA Green… - Các đầu dò thủy phân như: TaqMan, Beacons, Scorpions…. -Các loại đầu dò lai như: Light Cycler… Chu kỳ ngưỡng: là chu kỳ mà tại đó phần mềm máy tính bắt đầu đọc được ΔRn, deltaRn là tham sử dụng trong định lượng. Giá trị CT là 40 hay hơn 40 có nghĩa là không diễn ra sự khuếch đại và không thể tính toán được lượng sản phẩm.[6] 1.4.2.2. Cơ chế hoạt động của Real-time PCR Số chu kỳ PCR và tín hiệu huỳnh quang từ phản ứng tỷ lệ với lượng sản phẩm khuếch đại trong ống. Sự khuếch đại thể hiện qua 2 giai đoạn: giai đoạn một theo hàm mũ và giai đoạn hai bão hoà không theo hàm mũ. -Trong giai đoạn một, lượng sản phẩm PCR gần như được gấp đôi sau mỗi chu kỳ. Khi phản ứng tiếp diễn, các thành phần phản ứng được sử dụng. - Trong giai đoạn hai, một hay nhiều thành phần đã trở nên cạn kiệt, phản ứng bắt đầu chậm lại và bước vào giai đoạn bão hoà.[6] Hình 6: Đồ thị khuếch đại dựa trên hiệu số của tín hiệu nền huỳnh quang 1.4.2.3. Ưu điểm của Real-time PCR Ưu điểm chính của Real-time PCR so với PCR truyền thống là cho phép xác định số lượng bản sao khuôn mẫu ban đầu với sự chính xác và độ nhậy cao trong một phạm vi biến thiên rộng. Kết quả của Real-time PCR có thể là kết quả định tính (hiện diện hay vắng mặt một trình tự DNA) hay định lượng (số lượng bản sao DNA). Thêm vào đó, dữ liệu của Real-time PCR có thể được đánh giá mà không cần phải điện di trên gel để kiểm tra, giúp tiết kiệm thời gian và gia tăng số lượng thực hiện. Việc tiến hành và đánh giá dữ liệu trong một hệ thống ống đóng kín giúp làm giảm nguy cơ ngoại nhiễm và loại bỏ những thao tác sau phản ứng khuếch đại. Real-time PCR sử dụng để định lượng DNA được gọi là PCR định lượng.[6] CHƯƠNG II: VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1.Vật liệu nghiên cứu 2.1.1. Sinh phẩm - Thư viện thực khuẩn thể Griffin.1 (Human Synthetic VH, vL scFv Library)_Trung tâm nghiên cứu protein (Cambridge, Anh). - Hyperphage - Vi khuẩn E.coli chủng TG1. - Kháng thể: Kháng thể cộng hợp kháng M13 (anti-M13 horseradish peroxidase-conjugate, Amersham Biosciences, Pícâty, NJ, USA). - Kháng nguyên: Kháng nguyên Cyfra 21-1 (Phòng Công nghệ Tế bào Động vật - Viện Công Nghệ Sinh Học - Viện Khoa học Việt Nam). - Mẫu máu do bệnh viện Bạch Mai và bệnh viện Phổi Trung Ương cung cấp. - Cặp mồi: + CyfprobF: 5'-GGC GGT AGT GCA CTT GAG A-3' + CyfprobR: 5'-AAG GGT GAC AGG TGA GGA GA-3' + Probe No115: GA CCC AGA 2.1.2. Hoá chất Kháng sinh (Ampicilin, Kanamycine), cao nấm men, Tryptone, Agar, Agarose, NaCl, TAE, PBS, TMB, H2SO4, PEG, …… 2.1.3. Trang thiết bị - Máy ly tâm lạnh (Eppendorf, CHLB Đức). - Máy Real-time PCR (Roche). - Máy đo nồng độ Nanodrop. - Máy đo ELISA. - Máy xác định trình tự ABI PRISM 3100-Avant Genetic Analyzer (ABI, Mỹ). - Máy lắc ổn nhiệt; Bể ổn nhiệt; Tủ lạnh (4o. -20o. -80o). - Máy đo pH; Máy voltex; Tủ cấy vô trùng; Pipetman các loại. - Các trang thiết bị khác thuộc Phòng thí nghiệm Trọng điểm gene_Viện Công nghệ Sinh học_Viện khoa học và Công nghệ Việt Nam. 2.2. Phương pháp nghiên cứu 2.2.1. Phương pháp nuôi cấy vi sinh vật Các chủng vi sinh vật được nuôi cấy trong bình tam giác với thể tích từ 20-50ml chứa 5-15 ml môi trường thích hợp cho từng loại. Bình nuôi cấy được đặt trong máy lặc ổn nhiệt ở 37oC hoặc 30oC với tốc độ 220 vòng/phút. 2.2.2 Phương pháp tạo phage_DNA 2.2.2.1. Chuẩn bị - Box cấy vô trùng - Môi trường 2xTY - Kháng sinh: Ampicilin - Glucose 20 % - Pipetman các loại - Đèn cồn - Ống phancol 2.2.2.2 Tiến hành Các bước tiến hành phải được làm trong box cấy vô trùng để tránh bị nhiễm. - Lấy 50ml môi trường 2xTY vào ống phancol; - Bổ sung vào môi trường 100μg/ml Ampicilin và 1% glucose; - Sau đó bổ sung tiếp vào môi trường 50μ phagemid; - Nuôi lắc trong 2 giờ ở 37oC (đến khi OD600= o,5); - Cho hyper phage vào với mật độ 1 vi khuẩn/20 hyper phage; - Ủ trong nước 30 phút cở 37oC (không lắc); - Ly tâm các tế bào nhiễm ở 3300g trong 10 phút; - Loại bỏ dịch, thu phần cặn tế bào; - Lấy 30 ml môi trường 2xTY, bổ sung 25μg/ml Kanamycine và 100μg/ml Ampicilin; - Hòa lại cặn tế bào thu được ở trên vào trong môi trường; - Nuôi lắc qua đêm ở 30oC; - Ly tâm dịch nuôi cấy qua đêm ở 10800g trong 10 phút; - Thu dịch nổi chứa phage; - Kết tủa các hạt phage bằng cách cho thêm 1/5 thể tích PEG/NaCl; - Để ở 4oC trong ít nhất 1 giờ; - Sau đó, ly tâm 10800g trong 30 phút; - Loại bỏ dịch sau ly tâm, thu phần cặn; - Hòa lại cặn trong 40ml H20; - Bổ sung thêm 8ml PEG/NaCl, trộn đều và để 20 phút ở 4 oC; - Ly tâm 10800g trong 30 phút, loại bỏ phần dịch và thu phần cặn; - Hòa cặn trong 2,5 ml PBS; - Ly tâm 11000g trong 10 phút để loại các mảnh vụn tế bào còn sót lại; - Thu phần dịch nổi phía trên. 2.2.3. Phương pháp xác định nồng độ phage - Lấy 10μl dịch phage ở trên để pha loãng thành nhiều nồng độ khác nhau: 10-2,10-4,10-6,10 -8,10 -10; - Chủng TG1 được nuôi trong khoảng 2 giờ đến khi đo OD600= 0,6. Lấy 490μl dịch cho vào ống doff; - Sau đó, bổ sung 10μl dịch phage pha loãng ở các nồng độ vào; - Đem ủ 30 phút ở 37oC trong bể ổn nhiệt; - Lấy 100μl dịch cấy trải trên đĩa thạch, để qua đêm trong tủ 37oC; - Đếm số khuẩn lạc trên các đĩa thạch; Nồng độ phage= (a/b).(c/d)/m Trong đó: a: số khuẩn lạc có trên đĩa thạch b: thể tích dung dịch dùng để trải đĩa c: thể tích dịch nuôi d: lượng phage có trong dịch nuôi m: nồng độ pha loãng phage 2.2.4. Phương pháp xác định nồng độ DNA, kháng nguyên Việc xác định nồng độ DNA, kháng nguyên, kháng thể phage – scFv cho phép tính toán thành phần phản ứng Real-time PCR để có kết quả tốt nhất. Nồng độ DNA, kháng nguyên, kháng thể phage – scFv được xác định bằng cách sử dụng máy đo nồng độ Nanodrop ở các bước sóng phù hợp. Các bước tiến hành: - Bật máy đo, kiểm tra các tín hiệu kết nối với máy tính. Mở phần mềm đo sử dụng cho máy. Chọn chế độ xác định nồng độ DNA ở bước sóng 260nm hay protein (kháng nguyên) ở bước sóng 280nm; - Để khởi động máy ta cho 2µl H2O khử ion trực tiếp lên trên giá nhận mẫu. Sau đó chọn OK; - Dùng giấy thấm nhẹ nước trên bề mặt giá; - Sau đó cho 2µl dung dịch đệm dùng trong mẫu cần đo, chọn Blank; - Dùng giấy thấm nhẹ đệm; - Cho 2µl dung dịch cần đo nồng độ DNA hoặc kháng nguyên lên trên giá nhận mẫu. Chọn Measure; - Đọc kết quả nồng độ DNA hoặc kháng nguyên thu được. Hình 7: Máy đo NanoDrop 2.2.4. Phương pháp tách huyết thanh từ máu toàn phần - Máu được lấy vào ống chống đông có EDTA; - Ủ mẫu trong tủ ấm 37oC trong thời gian 20 phút; - Sau đó để mẫu trong tủ 4oC trong 2 giờ; - Hút lớp dịch trên sang ống eppendoft mới; - Ly tâm 2000 vòng/phút trong 10 phút; - Thu dịch huyết thanh và bảo quản ở -20oC. 2.2.5. Phương pháp ELISA 2.2.5.1. Nguyên lý ELISA là mộ kĩ thuật hóa sinh được sử dụng trong miễn dịch học để tìm ra sự có mặt của kháng thể hoặc kháng nguyên trong mẫu. Vào năm 1960, Rosalyn Sussman Yalow và Solomon Berson Prior mô tả phương pháp miễn dịch có gắn chất phóng xạ (radioimmunoassay) dùng để xác định sự có mặt của kháng nguyên, kháng thể. Trong phương pháp này, kháng nguyên hay kháng thể có thể gắn chất đánh dấu phóng xạ và sự hiện diện của chúng được xác định thông qua tín hiệu phóng xạ. Tuy nhiên, các chất phóng xạ lại tiềm ẩn một mối nguy hiểm lớn, chính vì vậy người ta đã nghĩ đến một phương pháp mới, trong đó tín hiệu được phát ra không phải là nhờ chất phóng xạ. Khi đó người ta đã biết rằng, một số loại enzyme như peroxidase phản ứng với một số cơ chất nhất định như Tetramethylbenzidine hay 3-ethylbenzthiazoline-6-sulphonic axit sẽ phát mầu. Mầu sinh ra từ các phản ứng này có thể được sử dụng làm tín hiệu nhận biết (tín hiệu chỉ thị). Tuy nhiên, để tín hiệu này được sử dụng như chất phóng xạ trong phép phân tích miễn dịch phóng xạ, tín hiệu mầu phát ra phải đồng nghĩa với sự có mặt của kháng nguyên hay kháng thể. Chính vì vậy, giải pháp được đưa ra là: enzyme sẽ được gắn với kháng nguyên hay kháng thể. Kỹ thuật gắn kết enzyme với kháng nguyên hay kháng thể được phát triển bởi Stratis Avrameas và G.B. Pierce. Tiếp sau đó, vào năm 1966, Wide và Porath phát triển phương pháp gắn kháng nguyên và kháng thể trên bề mặt rắn (bề mặt của các vi phiếm hay các đĩa) nhờ đó mà kháng nguyên hay kháng thể không được gắn kêt sẽ dễ dàng bị rửa trôi.[17] Peter Perlmann và Eva Engvall (Thụy Điển) cùng với nhóm Anton Schuurs và Bauke van Weemen (Hà Lan) công bố phương pháp được đặt tên ELISA (EIA) dựa trên tất cả những bước phát triển nói trên. Phương pháp chính thức ra đời vào năm 1971.[18,19] Đối với các ELISA phát quang, ánh sáng sẽ được phát ra từ mẫu chứa kháng nguyên- kháng thể. Sự hiện diễn của phức hợp kháng nguyên- kháng thể sẽ quyết định cường độ sáng phát ra. Trước đây các cơ chất tạo mầu sắc được sử dụng trong ELISA, nhưng ngày nay các chất phát quang được dùng rộng rãi làm tăng tính đặc hiệu và độ chính xác của ELISA. Với nguyên lý trên, ELISA giúp xác định sự có mặt hay không có mặt cũng như lượng kháng nguyên trong mẫu. 2.2.5.2. Các bước tiến hành - Phủ 100μl huyết thanh pha loãng 100 lần vào mỗi giếng của khay 96 giếng, ủ qua đêm ở nhiệt độ phòng; - Sau đó rửa 3 lần với PBS 1X; - Bổ sung vào mỗi giếng của khay 200μl MPBS 2% và ủ trong 2 giờ; - Sau đó tiếp tục rửa 3 lần với PBS 1X; - Phủ tiếp 100μl phage vào mỗi giếng và ủ trong 1,5 giờ ở nhiệt độ phòng; - Rửa tiếp 3 lần với TPBS 0,05% và 3 lần với PBS 1X; - Bổ sung 100μl kháng thể cộng hợp vào mỗi giếng và ủ 1,5 giờ ở nhiệt độ phòng; - Rửa 3 lần với TPBS 0,05% và 3 lần với PBS 1X; - Thêm vào mỗi giếng 100μl TMB để khoảng 10 phút; - Sau đó bổ sung 50μl H2SO4 1N; - Sau đó, đo OD ở bước sóng 450nnm và 650nm, tính hiệu số kết quả thu được ở hai bước sóng này. 2.2.6. Phương pháp Real-time PCR Tạo Template cho Rea-ltimePCR - Phủ 100µl kháng nguyên với các nồng độ pha loãng khác nhau hoặc huyết thanh bệnh nhân vào mỗi giếng của khay 96 giếng; - Ủ qua đêm ở nhiệt độ phòng; - Rửa với PBS 1X 3-5 lần; - Bổ sung vào mỗi giếng 200µl MPBS 2%; - Ủ 2giờ ở nhiệt độ phòng; - Sau đó tiếp tục rửa với PBS 1X 3-5 lần; - Thêm 100µl phage vào mỗi giếng; - Ủ ở nhiệt độ phòng từ 1-2 giờ; - Rửa với TPBS 0.005 %; - Sau đó rửa lại bằng PBS 1X; - Rửa 1 lần với nước vô trùng có khử ion; - Thêm 50µl nước vô trùng có khử ion vào mỗi giếng và mang đi biến tính ở 95oC trong 10 phút; - Thu dịch biến tính để làm khuôn chạy Rea-ltime PCR Hình 8: Khay ELISA dùng trong bước tạo DNA khuôn cho phản ứng Realtime_PCR Bảng 1: Thành phần phản ứng Realtime_PCR Thành phần phản ứng Thể tích Master mix 4μl CyfprobeR 0,5μl CyfprobeF 0,5μl Probe No115 0,2μl DNA khuôn 5μl H2O 9,8μl Tổng thể tích 20μl Bảng 2: Chu kỳ chạy Tên chương trình Chu kỳ chạy Chế độ phân tích Nhiệt độ (oC) Thời gian Acquisition Mode Preincubation 1 None 95 10 phút None Amplification 45 Quantification 95 10 giây None None 95 20 giây Singer Cooling 1 None 40 30 giây None Hình 9: Hệ thống máy chạy Realtime_PCR CHƯƠNG III KẾT QUẢ VÀ THẢO LUẬN 3.1. Xác định trình tự gene mã hóa kháng thể phage kháng Cyfra 21-1 Thư viện phage của Griffin 1 chứa các đoạn kháng thể tổng hợp được tạo nên từ vùng biến đổi của chuỗi nặng (VH) và chuỗi nhẹ (VL). Chúng được liên kết với nhau thông qua peptide liên kết để tạo thành chuỗi đơn (scFv). Các mảnh scFv này dung hợp với vỏ pIII của thực khuẩn thể M13 để tạo thành thư viện các kháng thể bộc lộ trên phage. Các vòng sàng lọc phage được tiến hành để thu nhận được kháng thể đặc hiệu với kháng nguyên Cyfra 21-1. Sàng lọc được tiến hành hơn 1 vòng để có thể làm giàu dòng phage mong muốn và loại bỏ được các dòng phage gắn không đặc hiệu. Sàng lọc kháng thể phage kháng Cyfra 21-1 sử dụng kháng nguyên Cyfra 21-1 tránh được sự bắt cặp đa dạng so với sàng lọc sử dụng tế bào. Vì vậy, sau 3 vòng sàng lọc đã lựa chọn được dòng kháng thể phage kháng Cyfra 21-1 có ái lực cao. Để khẳng định dòng phage chọn được có mang gene mã hóa cho kháng thể kháng Cyfra 21-1, chúng tôi tiến hành xác định trình tự đoạn gene mong muốn. Xác định trình tự gene mã hóa kháng thể Dòng phage sau khi sàng lọc được xâm nhiễm vào E.coli chủng TG1 để làm giầu lên rồi tiến hành tách phagemid, tinh sạch và xác định trình tự. Trình tự gene mã hóa kháng thể kháng Cyfra 21-1 được phân tích dựa trên các thông tin đã biết về phagemid vector. Bộ gene của phage thực chất là phagemid vector (pHEN2 vector) với vùng mã hóa kháng thể được gắn vào vị trí đa nối nằm trước gene mã hóa protein vỏ pIII và nằm giữa cặp mồi LabF và LabR. Theo đó, sau khi loại bỏ các đoạn trình tự mồi LabF, LabR, RBS, leader, vùng liên kết (linker), His-Tag,… được trình tự mã hóa đoạn kháng thể. Trình tự nucleotide và trình tự amino acid suy diễn của kháng thể đặc hiệu Cyfra 21-1: GGTGTCAGCGAACCCGGGAGAACCGTCGAGATCACCTGCTCCGGGGGTGGTAGCAGCAAC 60 G V S E P G R T V E I T C S G G G S S N TACTATGGCTGGTACCAGCAGAAGGCACCTGGCAGTGCCCCTGTCAGTCTGATCTATGCT 120 Y Y G W Y Q Q K A P G S A P V S L I Y A AACACCAACAGACCCTCAAACATCCCTTCACGATTCTCCGGTTCTGGATCCGGCTCCACA 180 N T N R P S N I P S R F S G S G S G S T AACACATTAACCATCACTGGGGTCCAAGCCGACGACGAGGCTGTCTATTTCTGTGGGAGT 240 N T L T I T G V Q A D D E A V Y F C G S GGAGACGGCAGTTATTCTGGTATATTTGGGGCCGGGACAACCCCGACCGTCCTAGGTCAG 300 G D G S Y S G I F G A G T T P T V L G Q TCCTCTAGATCTTCCGCCGTGACGTTGGACGAGTCCGGGGGCGGCCTCCAGACGCCCAGA 360 S S R S S A V T L D E S G G G L Q T P R GGAGCGCTCAGCCTCGTCTGCAAGGCCTCCGGGTTCACCTTCAGTGACCGTGGCATGTTC 420 G A L S L V C K A S G F T F S D R G M F TGGGTGCGACAGGCGCCCGGCAAGGGGCTGGAGTTCGTCGCTGAAATTACCAAGGATGGT 480 W V R Q A P G K G L E F V A E I T K D G GGTGGCACATGGTACGGGTCGGCGGTGAAGGGCCGTGCCACCATCTCGAGGGACAACGGG 540 G G T W Y G S A V K G R A T I S R D N G CAGAGCACAGTGAGGCTGCAGCTGAACAACCTCAGGGCTGAGGACACCGGCATCTACTGC 600 Q S T V R L Q L N N L R A E D T G I Y C TGCGCCAAACCTGCTGGTTATTGTTGGTATGGTGATTGTGGTGGTTGGATCGACGCATGG 660 C A K P A G Y C W Y G D C G G W I D A W GGCCACGGGACCGAAGTCATCGTCTCCTCCACTAGTGGCCAGGCCAGACCAGATCCTCAT 720 G H G T E V I V S S T S G Q A R P D P H Hình 10: Kết quả trình tự gene mã hóa kháng thể kháng Cyfra 21-1 So sánh với trình tự đã công bố trên ngân hàng gene Quốc tế cho thấy trình tự nucleotide mã hóa cho kháng thể thu được trong nghiên cứu này có sự tương đồng lên đến 99,7%. 3.2. Kết quả tạo phage Sau khi tạo phage bằng kỹ thuật phage disphay, chúng tôi thu 1ml dịch phage. Dịch phage sau khi pha loãng ở các nồng độ khác nhau được cấy trải trên đĩa thạch. Từ đó, chúng tôi tiến hành xác định nồng độ phage ban đầu. Sau khi cấy trải trên đĩa thạch, chúng tôi thu được những kết quả khác nhau. Tùy thuộc vào nồng độ pha loãng của phage ban đầu, chúng tôi thu được những địa thạch với mật độ khuẩn lạc khác nhau. Hình 11: Đĩa khuẩn lạc với nồng độ phage 10-8 Hình 12: Đĩa khuẩn lạc với nồng độ phage 10-10 Vì số lượng khuẩn lạc trên mỗi đĩa thạch tương ứng với số lượng phage có trong dịch nuôi, nên chúng tôi đã chọn 1 đĩa khuẩn lạc có số lượng khuẩn lạc phù hợp để tiến hành xác định nồng độ phage đã tạo được ở trên. Chúng tôi chọn đĩa có nồng độ pha loãng dịch phage là 10-10 vì: đĩa có số lượng khuẩn lạc phù hợp (khoảng 300 khuẩn lạc), có các khuẩn lạc riêng rẽ và khuẩn lạc mọc tương đối đồng đều. Dựa vào nồng độ pha loãng và số khuẩn lạc đếm được ở trên đĩa, cũng như lượng dịch dùng để trải đĩa. Chúng tối đã tính được nồng độ phage ban đầu. Nồng độ phage ban đầu= (300/100).(500/10)/10-10= 15.1011 phage/μl Tuy nhiên, nồng độ phage chúng tôi cần để phủ đĩa là 108, nên chúng tôi tiến hành pha loãng phage với tỷ lệ được tính toán như sau: Tỷ lệ pha loãng = Nồng độ phage ban đầu/nồng độ phage cần sử dụng Suy ra, ta có tỷ lệ pha loãng = 15.1011/1.108 = 1,5.104 3.3. Kết quả ELISA ELISA là phương pháp được sử dụng để xác định định tính kháng nguyên có trong mẫu. Trong nghiên cứu này, kháng nguyên Cyfra 21-1 với 4 nồng độ khác nhau đã được biết trước và một giếng đối chứng H2O được cố định trên khay ELISA 96 giếng, ủ mỗi giếng với phức hệ kháng thể- DNA. Các phức hệ kháng thể-DNA sẽ gắn với kháng nguyên đích thông qua kháng thể biểu lộ trên bề mặt phage. Theo lý thuyết, kháng thể có ái lực cao với kháng nguyên sẽ cho giá trị OD450 cao hơn. Trong nghiên cứu này, phức hệ kháng thể-DNA được sử dụng là đơn dòng vì vậy ái lực với kháng nguyên Cyfra 21-1 là như nhau ở các giếng. Do đó, giá trị OD sẽ có ý nghĩa xác định bán định lượng nồng độ kháng nguyên Cyfra 21-1. Như vậy, giếng nào trên khay ELISA có nồng độ kháng nguyên Cyfra 21-1 ban đầu cao hơn sẽ tương đương với với lượng kháng thể bắt cặp nên enzyme từ kháng thể cộng hợp oxy hóa cơ chất TMB tạo thành chất có mầu xanh đậm hơn. Do đo, khi chúng ta dừng phản ứng bằng H2SO4 dung dịch sẽ chuyển sang mầu vàng đậm hơn so với các mẫu còn lại, và mẫu này cũng sẽ cho kết quả OD cao hơn. Hình 13: Kết quả bán định lượng Cyfra 21-1 Mẫu 1: 2.106, mẫu 2: 2.105, mẫu 3: 2.104, mẫu 4: 2.103, mẫu 5: Đối chứng Tuy nhiên, dựa vào kết quả ELISA chúng ta chỉ biết được kháng nguyên Cyfra 21-1 có tồn tại trong các mẫu hay không, và so sánh được mẫu nào có nồng độ kháng nguyên Cyfra 21-1 nhiều hơn. Chính vì vậy, để xác định được một cách chính xác nồng độ kháng nguyên Cyfra trong các mẫu, chúng tôi đã sử dụng phương pháp Real-time PCR. 3.4. Kết quả Real-time PCR 3.4.1. Đường chuẩn nồng độ Để tiến hành phân tích định lượng kháng nguyên Cyfra 21-1 trong các mẫu phân tích, cần xây dựng đường chuẩn nồng độ. Probe No115 của hãng Roche được sử dụng để thực hiện Real-time PCR. Cụ thể, chúng tôi sử dụng cặp mồi đặc hiệu để khuếch đại đoạn mã hóa scFv của kháng thể đặc hiệu Cyfra 21-1 và probe No115. (Trình tự mồi và Probe No155 được thiết kế dựa trên phần mềm thiết kế Primer của Probe). Trình tự của probe No 115: gacccaga và trình tự mồi là: CyfprobF:5'-ggcggtagtgcacttgaga-3' CyfprobR:5'-aagggtgacaggtgaggaga-3’ Đoạn mồi trên được sử dụng để khuếch đại DNA mã hóa cho scFv đặc hiệu kháng nguyên Cyfra 21-1được gắn trong vector pHEN2. Mẫu đối chứng âm tính không chứa DNA khuôn trong thành phần phản ứng. Hình 14: Sơ đồ mồi, Probe và đoạn DNA được khuếch đại trong phản ứng định lượng kháng nguyên Cyfra 21-1 Hình 15: Đường chuẩn nồng độ Cyfra 21-1 Theo lý thuyết, chu kỳ ngưỡng của một phản ứng được xác định chủ yếu bởi lượng khuôn mẫu hiện diện lúc phản ứng khuếch đại bắt đầu. Chính vì vậy, nếu lượng ban đầu của mẫu lớn thì chỉ sau một vài chu kỳ, sản phẩm khuếch đại đã được tích lũy đủ để phát ra tín hiệu huỳnh quang cao hơn tín hiệu nền ban đầu. Như vậy, phản ứng xảy ra sớm hay có chu kỳ ngưỡng thấp. Ngược lại, nếu lượng mẫu ban đầu thấp, thì phải cần nhiều chu kỳ hơn để có thể phát ra được tín hiệu huỳnh quang cao hơn tín hiệu nền. Do đó, phản ứng sẽ trễ hay có chu kỳ ngưỡng cao. Kết quả cho thấy sự tương quan giữa tín hiệu huỳnh quang nhận được trong Real-time PCR với lượng kháng nguyên Cyfra 21-1 đã sử dụng. Kết quả cho thấy, nồng độ kháng nguyên ở mẫu số 1 ( 2.106) cao nhất nên có tín hiệu huỳnh quang sớm nhất với Cp= 19,36. Các nồng độ tiếp theo giảm dần và mẫu có tín hiệu huỳnh quang muộn nhất là mấu số 4 (2.103) với Cp= 31,46; mấu đối chứng không có tín hiệu huỳnh quang. Điều này chỉ ra rằng, số lượng khuôn DNA càng lớn thì lượng sản phẩm gắn với chất phát quang càng nhiều, tín hiệu huỳnh quang đạt ngưỡng càng sớm. Đường cong đặc trưng cho sự khuếch đại DNA với các nồng độ kháng nguyên Cyfra 21-1 được pha loãng theo dãy pha loãng 10 lần được thể hiện trên hình 15. Dãy pha loãng này tạo ra những đường đồ thị khuếch đại với khoảng cách khá đều nhau. Qua kết quả chu kỳ ngưỡng Cp với các nồng độ khác nhau đã biết trước, chúng tôi đã dựng được đường hồi quy tuyến tính của tín hiệu nhận được đối với logarit nồng độ kháng nguyên Cyfra 21-1 ban đầu. Với những kết quả thu được, chúng tôi có thể khảng định được primer, probe đã được thiết kế tốt và điều kiện tối ưu hóa cho phản ứng là phù hợp. Mối liên hệ giữa nồng độ Cyfra 21-1 được cố định ở các giếng thử và giá trị Cp trong thí nghiệm xây dựng đường chuẩn được thể hiện ở bảng 3. Mẫu Cp Nồng độ DNA theo Real-time PCR Nồng độ kháng nguyên (ng/ml) Kết quả OD trong ELISA Tỉ lệ tương quan giữa nồng độ DNA và KN 10-4 19,36 9,56.109 2.106 0,815 0,21.10-3 10-5 23,31 1,09.109 2.105 0,766 0,18.10-3 10-6 27,71 9,61.107 2.104 0,731 0,21.10-3 10-7 31,46 1,00.107 2.103 0,628 0,20.10-3 H2O _ _ _ _ _ Bảng 3: Mối tương quan giữa nồng độ Cyfra 21-1 với giá trị Cp và kết quả ELISA Bảng phân tích trên cho thấy sự tương quan chặt chẽ giữa lượng DNA xác định theo Real-time PCR với nồng độ kháng nguyên được cố định ở các giếng của khay thử. Từ bảng trên ta có thể thấy, nồng độ kháng nguyên tỷ lệ thuận với DNA. Điều này phù hợp với nhận định đưa ra ban đầu. Theo tính toán thì nồng độ tương quan trung bình giữa nồng độ kháng nguyên/nồng độ DNA là 0,20.10-3 với độ lệch chuẩn 1,41.10-5. Ở đây, chúng tôi sử dụng mẫu đối chứng là H2O vì: H2O là nước khử tinh khiết nên trong thành phần của nó không có DNA. Chính vì vậy, khi đem đi đo ELISA sẽ không cho giá trị OD và không có sự bắt cặp giưa kháng nguyên và DNA đích. Và trong quá trình chạy Real-time PCR cũng sẽ không cho tín hiệu huỳnh quang. 3.4.2. Kết quả định lượng Cyfra 21-1 trong các mẫu huyết thanh do bệnh viện Lao_Phổi trung ương cung cấp Dựa vào đường chuẩn xây dựng được ở trên những phân tích so sánh với kết quả ELISA của mẫu kháng nguyên Cyfra 21-1 đã biết trước nồng độ, chúng tôi tiến hành định lượng kháng nguyên Cyfra 21-1 trong các mẫu huyết thanh do bệnh viện Lao_Phổi trung ương cung cấp. Mẫu huyết thanh cần phân tích, xác định hàm lượng Cyfra 21-1 được pha loãng 100 lần bằng PBS 1X và được cố định trên các khay thử. Kết quả được thể hiện ở hình 16 và bảng 4. Hình 16: Kết quả định lượng kháng nguyên Cyfra 21-1 trong các mẫu huyết thanh do bệnh viện Lao_ Phổi TW cung cấp Mẫu Giá trị Cp Nồng độ DNA Nồng độ Cyfra 21-1 (ng/ml) HT1 29,72 1,11.105 83ng/ml HT2 29,61 1,24.105 92,9ng/ml HT3 29,58 1,28.105 95,9ng/ml HT4 30,97 3,07.104 22.9ng/ml HT5 _ _ _ H2O _ _ _ Bảng 4: Kết quả định lượng Cyfra 21-1 trong các mẫu phân tích Nghiên cứu của P.P.Mumbarkkar và các cộng sự cùng một số nghiên cứu của các nhà khoa học khác cho thấy, trong các cá thể khỏe mạnh, nồng độ Cyfra 21-1 lưu thông là rất thấp (thấp hơn 3,3ng/ml). Trong khi đó, với các bệnh nhân được xác định là ung thư phổi ở các giai đoạn khác nhau có nồng độ Cyfra 21-1 cao hơn gấp nhiều lần. Ngoài ra, nghiên cứu của Bram Wieskopf cùng các cộng sự (1995) hay nghiên cứu của Shi-Jian Ding và các cộng sự (2004) cũng chứng minh rằng có sự liên quan chặt chẽ giữa hàm lượng Cyfra 21-1 với thời gian phát triển và di căn của khối u. Các mẫu huyết thanh do bệnh viện Lao_ Phổi trung ương cung cấp có mẫu HT1, HT2, HT3 đã được chẩn đoán là bị ung thư phổi, mẫu HT4 được chẩn đoán là tràn dịch màng phổi. Kết quả trên cũng cho thấy các mẫu đều có tín hiệu vượt ngưỡng ở chu kỳ tương đối thấp. Trong đó, mẫu HT3 có tín hiệu vượt ngưỡng sớm nhất, Cp = 29,58 với nồng độ Cyfra 21-1 tương ứng là: 95,9ng/ml. Tương tự như vậy, mẫu HT1 có tín hiệu Cp = 29,72 với nồng độ Cyfra 21-1 tương ứng là: 83ng/ml; mẫu HT2 có tín hiệu Cp =29,61 với nồng độ Cyfra 21-1 tương ứng là: 92,9ng/ml; mẫu HT4 có tín hiệu Cp = 30,97 với nồng độ Cyfra 21-1 tương ứng là: 22,9ng/ml; mẫu HT5 và mẫu đối chứng không thấy có tín hiệu huỳnh quang. So sánh giữa kết quả lâm sàng và kết quả Real-time PCR chúng tôi nhận thấy có sự tương đồng rõ rệt. Các mẫu HT1,HT2,HT3 sau khi chạy Real-time PCR đều cho giá trị nồng độ Cyfra 21-1 rất cao và các mẫu này đều đã được chẩn đoán là mắc bệnh ung thư phổi. Từ đây, bước đầu chúng tôi có thể khẳng định được việc định lượng kháng nguyên Cyfra 21-1 bằng kỹ thuật Real-time PCR để chẩn đoán ung thư phổi đã cho kết quả hoàn toàn chính xác. Tuy nhiên, các mẫu huyết thanh ở trên đều cho giá trị nồng độ Cyfra 21-1 cao hơn rất nhiều so với nồng độ Cyfra 21-1 cho phép lưu thông trong máu theo nghiên cứu của P.P.Mumbarkkar (3,3ng/ml). Chính vì vậy, kết quả ở trên chỉ có ý nghĩa khẳng định sự chính xác của phương pháp. Riêng với mẫu HT4 có nồng độ Cyfra 21-1 thấp hơn các mẫu trên, nhưng lại cao hơn ngưỡng theo nghiên cứu của P.P.Mumbarkar (3,3ng/ml). Theo chẩn đoán lâm sàng, mẫu HT4 được chẩn đoán là tràn dịch màng phổi. Nhưng theo kết quả chạy Real-time PCR thì mẫu HT4 có nồng độ Cyfra 21-1 = 22,9ng/ml cao hơn ngưỡng theo nghiên cứu trên (3,3ng/ml) rất nhiều lần. Do đó, bước đầu có thể khẳng định mẫu HT4 có biểu hiện của bệnh ung thư phổi. Tuy nhiên, để có thể chẩn đoán một cách chính xác thì cần phải tiến hành một số xét nghiệm cần thiết khác để có kết quả chính xác nhất. Tràn dịch màng phổi là một biểu hiện bệnh lý tổn thương phổi. Khi bị tràn dịch màng phổi có thể nghĩ tới ung thư màng phổi ngoài những nguyên nhân thông thường khác do vi khuẩn gây tổn thương phổi. Do vậy, có thể đưa ra đề xuất cần phải theo dõi thường xuyên hàm lượng kháng nguyên Cyfra 21-1 của các bệnh nhân có hàm lượng kháng nguyên Cyfra 21-1 lưu thông trong máu cao bất thường, được chẩn đoán tổn thương phổi mà chẩn đoán hình ảnh chưa phát hiện khối u. Có thể tổn thương ban đầu ở phổi sẽ dẫn đến nguy cơ ung thư phổi cao hơn so với những người có lá phổi khỏe mạnh. Từ những kết quả thu được ở trên, chúng tôi nhận thấy việc ứng dụng phương pháp định lượng kháng nguyên Cyfra 21-1 bằng kỹ thuật Real-time PCR cho kết quả với độ chính xác cao, thời gian chẩn đoán ngắn. Đặc biệt hơn, chúng ta có thể chẩn đoán được những trường hợp có biểu hiện của bệnh ung thư phổi ở giai đoạn sớm, để từ đó có thể đưa ra được một phác đồ điều trị hợp lý. 3.4.3. Kết quả định lượng Cyfra 21-1 trong các mẫu huyết thanh do bệnh viện Bạch Mai cung cấp Ngoài những mẫu huyết thanh của bệnh viện Lao_Phổi trung ương cung cấp, chúng tôi còn tiến hành chạy Real-time PCR với các mẫu huyết thanh và kháng nguyên do bệnh viện Bạch Mai cung cấp. Các mẫu kháng nguyên và huyết thanh cần phân tích được pha loãng 100 lần trước khi chạy Real-time PCR. Kết quả xác định hàm lượng Cyfra 21-1 trong các mẫu huyết thanh và kháng nguyên được trình bày ở bảng 5 và hình 17: Hình 17: Kết quả định lượng kháng nguyên Cyfra 21-1 trong các mẫu huyết thanh do bệnh viện Bạch Mai cung cấp Mẫu Nơi cung cấp Giá trị Cp Nồng độ kháng thể Nồng độ Cyfra 21-1 (ng/ml) HT1 BV Lao_Phổi 29,72 1.11.105 83 HT2 nt 29,61 1.24.105 92,9 HT3 nt 29,58 1,28.105 95,9 HT4 nt 30,97 3,07.104 22,9 HT5 BV Bạch Mai 36,07 3,58.105 7,2 HT6 nt >40,00 > 1,31.104 <0,26 HT7 nt >40,00 > 1,31.104 <0,26 HT8 nt 37,38 1,37.105 2,7 HT9 nt 35,14 7,37.105 15,0 HT10 nt 36,88 1,08.105 2,2 HT11 nt 35,20 7,03.105 14,1 HT12 nt 36,20 3,23.105 6,5 PBS >40,00 > 1,31.104 <0,26 KN1 nt 35,82 4,36.105 8,7 KN2 nt >40,00 > 1,31.104 <0,26 KN3 nt 36,06 3,63.105 7,3 KN4 nt 36,83 1,96.105 3,9 KN5 nt 36,22 3,19.105 6,4 H2O _ _ _ Bảng 5: Kết quả định lượng Cyfra 21-1 trong các mẫu phân tích Dựa vào các phân tích kết quả ở trên cũng như dựa vào đồ thị phản ứng. Chúng tôi có nhận thấy, các mẫu đều có tín hiệu huỳnh quang vượt ngưỡng ở chu kỳ khá cao. Trong số các mẫu huyết thanh và kháng nguyên này, thì mẫu HT9 có chu kỳ vượt ngưỡng sớm nhất Cp = 35,14 với nồng độ kháng nguyên Cyfra 21-1 tương ứng là 15,0ng/ml. Ngoài ra, còn có mẫu HT11 cúng có chu kỳ vượt ngưỡng khá sớm Cp = 35,20 với nồng độ kháng nguyên Cyfra 21-1 tương ứng là 14,1. Cả hai mẫu huyết thanh này đều có nồng độ kháng nguyên Cyfra 21-1 cao hơn mức cho phép lưu thông trong máu theo nghiên cứu của P.P.Mumbarkar (3,3ng/mll). Từ những biện luận ở trên, chúng tôi cho rằng mẫu HT9 và HT11 có biểu biện của bệnh ung thư phổi ở giai đoạn sớm. Và để có kết quả chính xác nên tiến hành các xét nghiệm cần thiết để đưa ra được phác đồ điều trị hợp lý nhất. Mẫu HT1 có Cp = 35,56 và nồng độ Cyfra 21-1 là: 10,7; mẫu HT2 có Cp = 35,92 và nồng độ Cyfra 21-1 là: 8,1; mẫu HT5 có Cp = 36,07 và nông độ Cyfra 21-1 là: 7,2; mẫu HT12 có Cp = 36,20 và nồng độ Cyfra 21-1 là: 6,5; mẫu KN1 có Cp = 35,82 và nồng độ Cyfra 21-1 là: 8,7; mẫu KN3 có Cp = 36,06 và nồng độ Cyfra 21-1 là: 7,3; mẫu KN5 có Cp = 36,22 và nồng độ Cyfra 21-1 là: 6,4; mẫu HT4 có Cp = 36,49 và nồng độ Cyfra 21-1 là: 5,1. Các mẫu trên đều có nồng độ Cyfra 21-1 cao hơn mức mà nghiên cứu của P.P.Mumbarkar đưa ra (3,3ng/ml) nên cần được theo dõi kỹ. Dựa vào bảng kết quả ở trên, chúng tôi nhận thấy với phương pháp này chúng tôi có thể định lượng được nồng độ kháng nguyên Cyfra 21-1 trong huyết thanh ở nồng độ chính xác ở mức nanogram (Ví dụ như: Mẫu HT3 có nồng độ kháng nguyên Cyfra 21-1 là: 1,005ng/ml và mẫu HT6, HT7 có nồng độ Cyfra 21-1 <o,26ng/ml). Từ những kết quả thu được, chúng tôi nhận thấy phương pháp định lượng kháng nguyên mà chúng tôi sử dụng có độ nhạy và độ chính xác cao. Kết luận Đã thu nhận được kháng thể phage có khả năng nhận biết và gắn kết với kháng nguyên Cyfra 21-1 bằng kỹ thuật phage display. Đã xây dựng được phương pháp định lượng kháng nguyên bằng kỹ thuật Real-time PCR và kỹ thuật phage display. Đã ứng dụng kỹ thuật định lượng kháng nguyên để xác định nồng độ Cyfra21-1 ở một số mẫu huyết thanh nhận được từ các bệnh Viện. Kiến nghị Tiếp tục nghiên cứu hoàn thiện quy trình để Kit chẩn đoán bệnh ung thư phổi sớm được triển khai trong thực tiễn. TÀI LIỆU THAM KHẢO Tài liệu bằng tiếng Việt Bộ môn ung thư, Đại học Y Hà Nội (1999), Bài giảng ung thư học, Nhà xuất bản Y học, Hà Nội. Đỗ Ngọc Liên (2008), Miễn dịch học cơ sở, Nhà xuất bản Đại học Quốc gia, Hà Nội. Lê Quang Huấn, Lã Thị Huyền (2009), Kháng thể tái tổ hợp và ứng dụng, Nhà xuất bản khao học Tự nhiên và Công nghệ, Hà Nội. Lê Quang Huấn, Lã Thị Huyền, Nguyễn Thị Thu Thủy, Đào Huyền Quyên, Trần Thị Thanh Huyền (2008), Định lượng kháng nguyên ung thư bằng phương pháp PDRTI_PCR. Tạp trí Công nghệ sinh học, tập 6 (4A), trang 605-612. Phan Tuấn Nghĩa, Bùi Phương Thuận, Trường Đại học Khoa học Tự nhiên (2004), Các kỹ thuật mới trong công nghệ sinh học, Hà Nội. Quyền Đình Thi, Nông Văn Hải (2008), Những kỹ thuật PCR và ứng dụng trong phân tích DNA, Nhà xuất bản Khoa học tự nhiên và công nghệ. Trần Hoàng Thành, Khoa Hô hấp Bệnh viện Bạch Mai (2007), Bệnh lý tràn dịch màng phổi, Nhà xuất bản Y học. Vũ Triệu An, Jean Claude Homberg (2001), Miễn dịch học, Nhà xuất bản Y học Hà Nội. Tài liệu tiếng Anh 9. Barak. V, Goike. H, Panaretakis. KW, Einarsson. R (2004), “Clinical utility of cytokeratins as tumor markers”, Clinical Biochemistry 37: 529- 540. 10. Biesalski, HK; Bueno de Mesquita B, Chesson A et al. (1998), “European Consensus Statement on Lung Cancer: risk factors and prevention. Lung Cancer Panel”, CA Cancer J Clin 48 (3): 167-176. 11.Coulome. PA, Omary. MB (2002), “Hard and soft principle defining the structure, function and regulation of keratin intermediate filaments”, Cell Biology 14: 110-122. 12. Dohmoto. K, Hojo. S, Fujita. J, Ueda. Y, Bandoh. S, Yamaji. Y, Ohtsuki. Y, Dobashi. N, Takahara. J (2000), “Mechanisms of the release of CYFRA 21-1 in human lung cancer cell lines”, Lung Cancer 30: 55-63. 13. Fuchs. E, Weber. K (1994), “Intemediate filaments: Structure, Dynamics Function, and Disease”, Annu.Rev.Biochem 63: 345-382. 14. .Klyszejko-Stefaniak L (2002), “Keratin filaments, Cytobiochemistry – biochemistry of some cell structures”, PWN, Warszawa, Polish 141-146. 15. Stelko. SV, Herrmann. H, Aebi. U (2003), “Molecular architecture of intermediate filaments”, Bio Essays 25: 243-251. 16. Zhou. X, Liao. J, Hu. L, Feng. L, Omary. MB (1999), “Characterization of the Major Physiologic Phosphorylation Site of Human Keratin 19 and Its Role in Filament Organization”, The Journel of Biological Chemistry, 274 (18) 12861- 12866. 17. Wide L, Porath J (1966), “Radioimmunoassay of proteins with the use of Sephadex-coupled antibodies”, Biochem Biophys Acta 30: 257-260. 18. Van Weemen BK, Schuurs AH (1971), “Immunoassay using antigen- enzyme conjugates”, FEBS Letters 15 (3): 232-6. 19. Engvall E, Perlman P (1971), “Enzyme-linked immunosorbent assay (ELISA). Quantitative assay of immunoglobulin G”, Immunochemistry 8 (9): 871-4.

Các file đính kèm theo tài liệu này:

  • docĐịnh lượng kháng nguyên Cyfra 21-1 bằng kỹ thuật Real-time PCR.doc
Luận văn liên quan