Đề tài Phân lập và biểu hiện gen fljB mã hoá kháng nguyên roi H: 1,2 của Salmonella typhimurium trong Escherichia coli BL21

Lời nói đầu 1 Chương 1: Tổng quan về tài liệu 3 1.1 Khái quát chung về Salmonella 3 1.1.1. Tình hình dịch bệnh do Salmonella 3 1.1.2. Một số đặc điểm vi sinh của Salmonella 4 1.1.3. Phân loại Salmonella 4 1.1.4. Bệnh học của sự lây nhiễm Salmonella 5 1.1.5. Sự đề kháng của Salmonella với các chất kháng sinh 6 1.2. Kháng nguyên của Salmonella 8 1.2.1. Đặc điểm chung về kháng nguyên của Salmonella 7 1.2.1.1. Kháng nguyên thân 8 1.2.1.2. Kháng nguyên tua riềm 8 1.2.1.3. Kháng nguyên roi H 8 1.2.1.3.1.Cấu trúc protein flagellin của Salmonella 9 1.2.1.3.2. Quá trình hình thành flagella trong Salmonella 10 1.2.1.3.3 Cơ chế điều hoà biểu hiện protein roi (H) ở vi khuẩn Salmonella typhimurium 12 1.2.2. Vai trò kháng nguyên H trong đáp ứng miễn dịch bảo hộ phòng chống salmonella 14 1.3. Vacxin 16 1.3.1. Khái quát về vacxin 16 1.3.2. Phân loại vacxin 18 1.4. Phân lập và biểu hiện gen 24 1.4.1. Phân lập gen 24 1.4.1.1. Phân lập gen từ ngân hàng gen 24 1.4.1.2. Phân lập gen bằng kỹ thuật pCR 24 1.4.2. Biểu hiện gen 25 1.4.2.1.Hệ biểu hiện gen trong E. coli BL21 25 1.4.2.2. Hệ vector biểu hiện pET32a(+) 25 1.4.2.3. Chủng biểu hiện E. coli BL21 26 Chương 2: Nguyên liệu và phương pháp nghiên cứu 28 2.1. Nguyên liệu 28 2.1.1. Chủng sinh vật 28 2.1.2. plasmit 28 2.1.3. Môi trường nuôi cấy 28 2.1.4. Các dung dịch sử dụng 28 2.1.5. Hoá chất, enzyme, thiết bị 29 2.2. Phương pháp nghiên cứu 30 2.2.1. Phương pháp tách chiết ADN hệ gen của vi khuẩn 30 2.2.2 Khuếch đại gen fljB bằng kỹ thuật PCR 31 2.2.3. Xử lý ADN bằng enzim hạn chế 31 2.2.4. Quá trình tinh sạch ADN từ gel agaroza bằng cột QUIAGEN 32 2.2.5. Phản ứng nối ghép gen ngoại lai vào plasmit 32 2.2.6. Biến nạp sản phẩm ghép gen vào E. coli bằng sốc nhiệt 33 2.2.7. Tách chiết AND plasmit từ E. coli 34 2.2.8. Cảm ứng, biểu hiện protein tái tổ hợp 35 2.2.9. Phương pháp điện di ADN trên gel agaroza 36 2.2.10. Phương pháp điện di protein trên gel polyacrylamit 12,6% 37 2.2.11. Tinh sạch protein qua cột sắc ký ái lực His-tag 37 Chương 3: Kết quả nghiên cứu và thảo luận 39 3.1. Tách chiết ADN hệ gen của S. typhimurium 41 3.2. Khuếch đại gen fljB bằng kỹ thuật PCR 42 3.3. Tách dòng gen fljB 44 3.3.1. Đưa gen fljB vào véc tơ tách dòng PCR 2.1 44 3.3.1.1.Biến nạp sản phẩm nối ghép gen vào tế bào E. coli DH5ỏ 45 3.3.1.2. Chọn lọc các cá thể mang plasmit tái tổ hợp 46 3.3.2. Cắt kiểm tra plasmit tái tổ hợp PCRfljB 47 3.3.3.kiểm tra gen fljB trong pCR2.1 bằng giải trình tự gen 50 3.4. Thiết kế vectơ biểu hiện mang gen fljB 51 3.4.1. Thu gen fljB từ plasmit tái tổ hợp pCRfljB 51 3.4.2. Phản ứng nối ghép fljB và véc tơ pET32a (+) 51 3.4.3. Chọn lọc thể biến nạp mang plasmit tái tổ hợp 51 3.4.4. Cắt kiểm tra plasmit tái tổ hợp pET32fljB 52 3.5. Biểu hiện gen fljB trong E.coli BL21 54 3.6. Nghiên cứu một số điều kiện thích hợp để tối ưu biểu hiện protein tái tổ hợp fljB của E. coli 55 3.6.1. Nhiệt độ cảm ứng ảnh hưởng lên khả năng biểu hiện gen fljB 55 3.6.2. Nồng độ cảm ứng IPTG ảnh hưởng lên khả năng biểu hiện gen fljB 59 3.6.3. Thời gian cảm ứng ảnh hưởng lên khả năng biểu hiện gen fljB 60 3.7. Tinh sạch protein tái tổ hợp FljB 61 Kết luận 64 Định hướng nghiên cứu 64 Tài liệu tham khảo 65

doc75 trang | Chia sẻ: lvcdongnoi | Ngày: 17/08/2013 | Lượt xem: 2482 | Lượt tải: 4download
Bạn đang xem nội dung tài liệu Đề tài Phân lập và biểu hiện gen fljB mã hoá kháng nguyên roi H: 1,2 của Salmonella typhimurium trong Escherichia coli BL21, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
trước làm tiền đề cho phản ứng cấp bậc sau với cường độ tăng trưởng theo cấp số nhân dưới sự xúc tác của enzim ADN polimeraza * Thành phần PCR * Chương trình chạy PCR - Dịch đệm 10 lần 2,5 ml Bước 1: 94oC- 3phút - dNTP 2,5 mM 2,5 ml Bước 2: 94oC- 1phút - MgCl2 25 mM 2,0 ml Bước 3: 50oC-1phút - Mồi fljBf -5, 10 mM 2,0 ml Bước 4:72oC-1phút 40 giây - Mồi fljBr- 3, 10 mM 2,0 ml Bước5: lặp lại 25 lần từ bước 2 - ADN khuôn (~1mg/ml) 2,0 ml Bước 6: 72oC - 6phút - Enzim taq ADN polymeraza 0,3 ml Bước 7: 4oC - 3 giờ - H2O 11,4 ml Bước 8: Kết thúc 2.2.3. Xử lý ADN bằng enzim hạn chế Phản ứng cắt ADN bằng enzim hạn chế thường được tiến hành trong tổng thể tích là 10ỡl, gồm các thành phần như sau: - Đệm 10 lần cho enzim : 1 ml - ADN (~ 1mg) : 2 ml - Enzim hạn chế : 0,3 ml - Nước khử ion vô trùng : 6,7 ml Hỗn hợp phản ứng được trộn đều, ủ ở nhiệt độ và thời gian thích hợp của enzym, thường phản ứng được tiến hành ở 37oC trong 2 giờ. Sản phẩm phản ứng cắt được kiểm tra bằng cách điện di trên gel agaroza 0,8%. 2.2.4. Quá trình tinh sạch ADN từ gel agaroza bằng cột QUIAGEN Hiện nay, để tinh sạch ADN, các phòng thí nghiệm sinh học phân tử thường sử dụng bộ kít riêng. Nó bao gồm các thành phần chính là đệm gắn ADN, cột thu nhận ADN, đệm rửa. Nguyên tắc để thu nhận ADN của các thành phần này như sau: - Cắt phần gel có chứa băng ADN theo tính toán cho vào eppendorf 1,5 ml mới. Cân sản phẩm: (cứ 0,1g thạch bổ sung 100 ỡl đệm PQ). Hỗn hợp này được ủ ở 50oC trong khoảng 10 cho đến khi thạch tan hết. -Hút dịch cho lên cột thu ADN đã được đặt lên một ống thu và để ở nhiệt độ phòng trong 1 phút - Ly tâm 6000 vòng/phút trong 30 giây, loại bỏ dịch bên dưới ống thu, lúc này ADN đã được giữ lại trên cột thu ADN - Bổ sung 500ỡl wash buffer (PE chứa 70% ethanol) lên cột thu, để 30 giây ở nhiệt độ phòng - Ly tâm 6000 vòng/phút trong 30 giây, loại bỏ dịch dưới ống thu, ly tâm tiếp 6000 vòng/phút trong 1 phút để làm khô cột - Chuyển cột thu sang 1 eppendorf mới và bổ sung 40 ml H2O, để1 phút ở điều kiện nhiệt độ phòng, để ADN tan hoàn toàn vào nước - Ly tâm 13000 vòng/phút trong 5 phút, thu ADN vào eppendorf 2.2.5. Phản ứng nối ghép gen ngoại lai vào plasmit * Nguyên tắc Các nucleotide nằm ở đầu dính của một sợi ADN đơn có khả năng hình thành cầu nối hydro với các nucleotide bổ sung nằm trên đầu dính của đoạn ADN khác. Nhờ sự xúc tác ADN ligaza, cầu nối phosphodieste được hình thành giữa hai nucleotde sát cạnh nhau của hai đoạn ADN này. Kết quả là một liên kết este hình thành giữa gốc phosphat đầu 5’ của đoạn DNA này với gốc hidroxyl đầu 3’ của đoạn kia đồng thời giải phóng ra một phân tử nước * Quy trình Thành phần phản ứng như sau: - Đệm 10 lần cho T4 ADN ligaza : 2 ml - T4 ADN ligaza 4 U/ml : 1 ml - Dung dịch BSA 2 mg/ml : 2 ml - H2O khử ion + ADN tham gia phản ứng : 15 ml Hỗn hợp phản ứng được ủ qua đêm ở 16oC 2.2.6. Biến nạp sản phẩm ghép gen vào E. coli bằng sốc nhiệt * Nguyên tắc Dưới tác dụng của CaCl2, thành tế bào đang ở thời kỳ sinh trưởng trở nên xốp, tạo điều kiện cho ADN plasmit có thể chui qua các lỗ trên màng tế bào vào tế bào chất khi thay đổi nhiệt độ đột ngột * Quy trình * Tạo tế bào khả biến - Cấy chuyển một khuẩn lạc E. coli DH5ỏ vào 5 ml môi trường LB lỏng, lắc 200 vòng/phút ở 37oC qua đêm - Chuyển một 0,5 ml dịch tế bào sang 50 ml môi trương LB, tiếp tục cấy lắc ở 200 vòng/phút ở 37oC cho tới khi OD600 từ 0,4 đến 0,6. Sau đó lấy mẫu ra và đặt trên đá khoảng 1 giờ. Từ bước này tất cả các thao tác đều phải tiến hành trên ở 4oC - Ly tâm 5000 vòng/phút trong 10 phút. Hoà tan tế bào thu được trong 50 ml CaCl2 100 mM (vô trùng). ủ mẫu 15 phút và ly tâm thu tế bào ở 3500 vòng/phút trong 10 phút. - Hoà tủa trong 25 ml CaCl2 100mM, ủ mẫu trong 60 phút trên đá - Ly tâm 4000 vòng/phút trong 10 phút ở 4oC - Hoà tế bào trong 0,5 ml CaCl2 100 mM, bổ sung 15% glycerol - Hút 0,1 ml dịch tế bào trên vào mỗi ống eppendorf và bảo quản ở – 75oC * Biến nạp - Tế bào khả biến được lấy ra từ tủ - 75oC, làm tan trên đá trong khoảng 30 phút. Sau đó bổ sung sản phẩm ghép gen vào mỗi tế bào khả biến, đảo nhẹ nhàng để ADN phân bố đều trong dịch tế bào khả biến. Sau đó để mẫu trên đá trong thời gian 30 phút - Mẫu được chuyển sang bể ổn nhiệt có nhiệt độ 42oC và ủ trong 1 phút 30 giây. Sau đó mẫu được lấy ra để trên đá 2 phút - Bổ sung 0,9 ml LB, lắc hỗn hợp tế bào ở 37oC trong 60 phút - Hút 100 ỡl dịch tế bào cấy trải trên đĩa môi trường LB chọn lọc có bổ sung IPTG 40 ỡg/ml và X- Gal 40 ỡg/ml, ủ ở 37oC qua đêm 2.2.7. Tách chiết ADN plasmit từ E. coli * Nguyên tắc : Các tế bào E. coli mang plasmit sau khi nuôi cấy đến pha cân bằng thì được ly tâm thu lại. Thành và màng tế bào được phá vỡ bằng kiềm và chất tạo sức căng bề mặt. Sau đó ADN hệ gen và protein được tủa lại bằng muối kali axetat và SDS, phần tủa bị loại bỏ khỏi ADN plasmit bằng ly tâm. ADN plasmit được tủa lại bằng etanol. * Quy trình Cấy chuyển một khuẩn lạc của tế bào E. coli vào ống penixillin chứa 2 ml môi trường LBA, nuôi cấy lắc qua đêm ở 37oC, 2000 vòng/phút. Hút 1,5 ml dịch nuôi cấy vào ống Eppendorf ly tâm 5000 vòng/phút trong 5 phút, thu tế bào. Hòa đều tế bào thu được với 100 ml Sol I bằng máy voltex, sau đó để ở nhiệt độ phòng trong 5phút. Bổ sung 200 ml Sol II. Đảo nhẹ nhàng để tránh đứt gãy ADN nhiễm sắc thể, đặt trên đá 5 phút Bổ sung tiếp 150 ml Sol III và đảo nhanh trong 10 giây. Trong hỗn hợp xuất hiện tủa trắng. Bổ sung 450 ml dung dịch hỗn hợp cholorofom: isoamylalcohol (24: 1) trộn đều ly tâm 13000 vòng/phút trong 10 phút để loại protein và ADN nhiễm sắc thể Hút nhẹ nhàng pha trên khoảng 400 ỡl sang ống eppendorf mới, bổ sung thêm 400 ml dung dịch hỗn hợp cholorofom: isoamylalcohol, ly tâm 14000 vòng/phút trong 10 phút và tiếp tục hút nhẹ nhàng ở pha trên. Bằng cách này sẽ hút được nhiều hơn dung dịch ADN plasmit. ADN được tủa bằng hai lần thể tích cồn tuyệt đối 100%. Để dung dịch ở - 20oC trong trong 30 phút. Ly tâm thu ADN ở 13000 vòng/phút trong 10 phút. Phần kết tủa được rửa với cồn 70%, tiếp đến ly tâm 13000 vòng/phút trong 10 phút. Thu tủa và làm khô bằng máy Speed Vac ADN plasmit được hòa vào 40 ml đệm TE. ARN lẫn trong sản phẩm tách chiết ADN được loại bỏ bằng ARNaza nồng độ 100ml/ml ủ ở 37oC trong 30 phút, giữ mẫu ở -20oC. ADN plasmit đã tách được điện di kiểm tra trên gel agaroza 0,8% 2.2.8. Cảm ứng, biểu hiện protein tái tổ hợp Cấy lắc qua đêm một khuẩn lạc E. coli trong 2 ml LB có bổ sung Ampixilin đến nồng độ cuối cùng 100 mg/ml (LBA). Chuyển 30 ml dịch nuôi cấy sang 100 ml LBA lắc trong 2 giờ ở 37oC đến OD600 đạt khoảng 0,8. Tiếp theo, tiến hành cảm ứng tế bào bằng IPTG với nồng độ cuối cùng là 1mM. Nuôi dung dịch cảm ứng ở 28oC trên máy lắc Tiến hành thu mẫu sau 4 giờ nuôi cấy cảm ứng Sau khi cảm ứng, lấy 500 ml dịch tế bào chuyển vào ống eppendorf 1,5 ml. Ly tâm 5000 vòng/phút trong 5 phút để thu tế bào. Bổ sung 80 ml nước cất khử trùng và làm tan tế bào bằng máy vortex Giữ mẫu ở -75oC qua đêm. Mẫu thu được là tế bào có chứa protein tái tổ hợp. 2.2.9. Phương pháp điện di ADN trên gel agaroza * Chuẩn bị gel agaroza - Cân 0,8 g agaroza rồi hòa tan vào 100 ml dung dịch đệm TAE 1X (agaroza 0,8%). - Đun sôi cho đến khi agaroza tan hết, để dung dịch agaroza 0,8% nguội đến khoảng 50oC thì đổ vào khung có cài sẵn lược. - Để gel đông và ổn định hoàn toàn trong khoảng nửa giờ. - Rút lược ra khỏi khuôn, đặt gel vào bể điện di, đổ đệm TAE 1X tới khi ngập mặt gel. * Tra mẫu ADN vào giếng - Đổ đệm TAE 1X vào khuôn điện di cho ngập gel. Mẫu được trộn với loading dye 6X rồi được đưa vào giếng. Chạy điện di bằng dòng một chiều với hiệu điện thế 100 V trong khoảng 30 phút - Trong quá trình chạy, quan sát sự di chuyển băng màu bromophenol để biết lúc nào cần ngừng điện di. - Sau khi chạy điện di xong lấy nhẹ bản gel ra khỏi khuôn và ngâm vào dung dịch EtBr nồng độ 0,5 mg/ml trong khoảng 15 phút rồi được rửa lại bằng nước. * Quan sát và chụp ảnh Bản gel sau khi nhuộm EtBr được quan sát dưới ánh sáng tử ngoại l=320 nm, chụp ảnh gel với ánh sáng tử ngoại. 2.2.10. Phương pháp điện di protein trên gel polyacrylamit 12,6% * Thành phần gel polyacrylamit: H20 Tris-HCl Glyxerol 50% Acrylamit 30% SDS 10% APS 10% TEMED 1. Gel 12,6% (4,5 ml) 0,55 ml 1,125 ml (1,5 M; pH = 8,8) 0,9 ml 1,89 ml 45 ml 30 ml 3 ml 2. Gel 5% (0,8 ml) 0,45 ml 0,2 ml (0,5 M; pH = 6,8) 0 ml 0,14 ml 4 ml 8 ml 1 ml * Tiến hành - Xử lý mẫu protein: Sau khi nuôi cấy ở điều kiện cảm ứng bằng IPTG, các tế bào thu lại nhờ ly tâm được phá bằng đệm xử lý mẫu treatment buffer 6X và biến tính ở 100oC trong 10 phút để phá tế bào - Lắp bản gel, tra mẫu vào các giếng và chạy với cường độ dòng cố định từ 20-30 mA trong khoảng 45 phút. - Gỡ bản gel ra và nhuộm bằng Cosmasie brilliant blue trong một giờ, sau đó rửa lại bằng dung dịch tẩy rữa cho đến khi quan sát được các băng protein. 2.2.11. Tinh sạch protein qua cột sắc ký ái lực His-tag * Chuẩn bị mẫu - Mẫu tế bào được nuôi cấy cảm ứng lượng lớn 200 ml bằng IPTG với nồng độ 0,1 mM. Thu mẫu bằng cách ly tâm 6000 vòng/phút trong 5 phút. Sau đó loại dịch lấy tủa Bổ sung 20 ml H20 cất vô trùng vào, vortex, cất vào tủ - 80oC Mẫu ở tủ âm được sốc nhiệt ở 37oC trong 15 phút cho đến khi mẫu được tan ra Mẫu được siêu âm phá tế bào ở 4oC với 5 chu kỳ: 10 giây siêu âm, nối tiếp 10 giây ủ mẫu trong lạnh. - Ly tâm 10000 vòng/phút trong 10 phút. Thu dịch nổi có chứa protein tái tổ hợp để tinh sạch, bằng cách cho qua cột sắc ký ái lực * Chuẩn bị cột Niken Cột Niken dung tích 5 ml được gắn vào một giá đỡ sao cho cột luôn thẳng vuông góc với mặt đất Rửa cột bằng 50 ml đệm rửa có chứa Imidazol 50 mM, để cân bằng cột Sau đó bổ sung mẫu lên cột, và thu dịch qua cột để kiểm tra khă năng gắn protein tái tổ hợp vào cột. Mẫu được rửa với 50 ml đệm rửa có chứa 100 mM Imidazol để loại bỏ các tạp chất có ái lực yếu với Ni. Thu mẫu: thu theo phân đoạn mỗi phân đoạn 2 ml bắt đầu từ khi bổ sung đệm đẩy mẫu Imidazol 500 mM được 10 phân đoạn thì dừng lại. Sau khi thu hết mẫu, rửa lại cột bằng đệm rửa Imidazol với nồng độ 100 mM, để cột được sạch. Chú ý để cột không bị khô sau khi sử dụng. Kiểm tra các phân đoạn protein đã thu trên gel polyacrylamit 12,6% Chương 3: kết quả và thảo luận Để biểu hiện được gen fljB mã hoá cho kháng nguyên roi H: 1,2 của vi khuẩn S. typhimurium trong E. coli, chúng tôi đã tiến hành với các bước như sau: Tách chiết ADN hệ gen của S. typhimurium Khuếch đại fljB bằng kỹ thuật PCR Đưa gen fljB vào vector pCR2.1 Kiểm tra plasmit tái tổ hợp trong PCRfljB bằng enzim hạn chế và giải trình tự gen. Thiết kế vector biểu hiện gen fljB trong E. coli Kiểm tra plasmit tái tổ hợp pET32fljB Biểu hiện gen fljB trong E. coli BL21 Nghiên cứu một số điều kiện thích hợp để biểu hiện protein tái tổ hợp fljB của E. coli BL21 Tinh sạch protein tái tổ hợp qua cột His-tag Toàn bộ quá trình tiến hành thí nghiệm về gen fljB của S. typhimurium trong E. coli BL21 được trình bày tóm tắt ở sơ đồ sau: Hình 3.1. Sơ đồ tiến hành thí nghiệm phân lập, biểu hiện gen fliB mã hoá kháng nguyên roi H: 1, 2 của S. typhimurium trong E. coli BL21 XhoI + NcoI XhoI + NcoI Hind III EcoR I T… EcoR I Pst I EcoR V …T pCR2.1 3,9 kb Km Amp CoIE1 ori Plac LacZ F1ori pET32a(+) 5,9 Kb T7t T7p Xho I Not I Hind III … NcoI PCRfljB 5,4 Kb Amp fliC3 NcoI XhoI Đọc trình tự Cắt kiểm tra pETfljB 7,4Kb T7p T7t fljB BIỂU HIỆN GEN fljB Cắt kiểm tra A PCR Taq polymeraza fljB(1,5 Kb) A XhoI NcoI ADN hệ gen của S. typhimrium T4 ADN Ligaza T4 ADN Ligaza BIỂU HIỆN GEN fljB E. coli BL2.1 Biến nạp 3.1. Tách chiết ADN hệ gen của S. typhimurium Để có được gen fljB trước hết phải tách chiết thành công ADN hệ gen của vi khuẩn S. typhimurium. Do vi khuẩn S. typhimurium cùng họ với tế bào E. coli nên quy trình tách chiết được tiến hành giống với việc tách chiết ADN hệ gen của vi khuẩn E. coli. Sau đó ADN hệ gen được sử dụng làm khuôn mẫu cho việc tổng hợp đoạn gen fljB bằng kỹ thuật PCR. Kĩ thuật PCR muốn đạt kết quả tôt đòi hỏi ADN hệ gen phải có độ tinh sạch và tính đồng nhất cao với lượng ADN phù hợp. Nếu ADN hệ gen không đảm bảo độ tinh sạch thì rất nhiều tạp chất tồn tại trong đó sẽ làm giảm hiệu quả của kĩ thuật PCR. Để tách chiết ADN hệ gen của vi khuẩn S. typhimurium, chúng tôi tiến hành thí nghiệm theo phương pháp Murray và Thompson [8]. Đầu tiên, để thu sinh khối tế bào, chủng vi khuẩn S. typhimurium được nuôi cấy qua đêm trên môi trường LB lỏng ở 37oC. Điểm khác biệt của phương pháp này là không sử dụng lysozim để phá tế bào mà sử dụng nồng độ SDS để phá vỡ tế bào trong dung dịch TE. SDS tạo ra sức căng bề mặt rất mạnh, đồng thời tạo môi trường nhược trương làm tế bào dễ bị vỡ tung. Ngoài ra, SDS cùng với EDTA có tác dụng bất hoạt enzim phân giải ADN có sẵn trong tế bào vi khuẩn. Protein nội và ngoại bào được thuỷ phân bằng proteaza K. Những phân tử protein có khối lượng lớn còn lại sau khi xử lí enzim được loại bỏ bằng cách li tâm và các protein nhỏ bị loại bỏ bằng cách hoà tan trong dung dịch phenol/chloroform/Isoamylalcolhol và nằm ở pha dưới. Như vậy việc xử lí dịch chứa trên đã loại bỏ hoàn toàn protein lẫn tạp chất. Dịch chứa ADN hệ gen nằm ở pha trên được thu lại và tủa trong cồn tuyệt đối. Sản phẩm sau khi tách chiết được điện di kiểm tra trên gen agaroza 0,8%. Kết quả được trình bày ở hình 3.2. 1 2 Kb ADN hệ gen 12 6,0 2,0 2,0 1,5 1,0 Hình 3.2. Phân tích ADN hệ gen trên gel agaroza 0,8% Đường chạy 1: ADN hệ gen của S. typhimurium Đường chạy 2: Thang ADN chuẩn 1Kb Kết quả kiểm tra trên điện di đồ cho thấy, ADN là một băng sáng rõ nét, có kích thước lớn, không lẫn ARN và từ đó cho phép chúng tôi kết luận sản phẩm tách chiết đó đủ điều kiện để làm khuôn nhân gen fljB bằng kỹ thuật PCR. 3.2. Khuếch đại gen fljB bằng kĩ thuật PCR Mục đích của chúng tôi là phân lập được gen fljB từ S. typhimurium và đưa vào biểu hiện trong E. coli BL21. Gen fljB là đoạn gen mã hoá cho kháng nguyên roi H: 1,2 có chiều dài 1,52 Kb nằm trong hệ gen của S. typhimurium. Dựa vào trình tự gen fljB của S. typhimurium trong ngân hàng gen, các đoạn mồi xuôi fljBf và mồi ngược fljBr được thiết kế có trình tự sau: fljBf: 5’- tataccatggatgcacaagtaatcaacactaac- 3’ NcoI fljBr: 5’- tatactcgagacgtaacagagacagcacgttc - 3’ XhoI Trong kỹ thuật PCR trình tự mồi có vai trò quan trọng đặc trưng cho gen cần nhân lên, quyết đinh sự thành công của PCR. Với hai mồi như trên, chúng tôi thấy: Không có sự bắt cặp giữa mồi xuôi và mồi ngược, không có những cấu trúc “kẹp tóc” do sự bắt cặp bổ sung giữa các phần khác nhau của cùng một mồi Thành phần nucleotit của hai mồi tương đương nhau, và đặc trưng cho trình tự ADN cần khuếch đại. Sản phẩm PCR sẽ là một đoạn gen mà hai đầu có thêm trình tự nhận biết của hai enzim cắt hạn chế là Nco I và Xho I. Theo tính toán lý thuyết, đoạn gen fljB sau khi được khuếch đại bằng kĩ thuật PCR với cặp mồi đặc hiệu sẽ có chiều dài 1,5 Kb. Sau khi thiết kế mồi chúng tôi đã kiểm tra sự dịch mã của đoạn gen fljB được nhân lên bằng hai mồi trong vectơ biểu hiện theo lý thuyết thấy gen sẽ được dịch mã chính xác. PCR được thực hiện ở điều kiện 2 mM MgCl2; 0,4 mM dNTP; 1 ỡM primer các loại và một 1 đơn vị Taq ADN polymeraza với chu trình nhiệt đã được mô tả ở phần phương pháp. Kỹ thuật PCR ADN polymeraza làm enzim tổng hợp chuỗi ADN có nguồn gốc từ loài vi khuẩn chịu nhiệt Thermus aquaticus có khả năng tổng hợp chuỗi ở nhiệt độ cao 72oC. Ngoài ra enzim còn có đặc tính kéo dài chuỗi polynucleotit thêm 1 bazơ A ở đầu 3’ của mỗi sợi đơn. Hơn nữa để tạo điều kiện thuận lợi cho quá trình nối ghép và tạo khung dịch mã đúng trong quá trình biểu hiện protein tái tổ hợp, cặp mồi được thiết kế thêm vào trình tự cắt đặc hiệu cho hai enzim hạn chế Nco I và Xho I, nên khi xử lý bằng enzim hạn chế Nco I và Xho I sẽ cho ra đoạn ADN với hai đầu so le. Đây chính là cơ sở tạo điều kiện thuận lợi cho quá trình nối ghép sau này. Sản phẩm PCR được kiểm tra trên gel điện di agaroza 0,8%. Kết quả được trình bày ở hình 3.3. fljB 3 6,0 6 0,5 12 Kb 1 2 1,5 2,0 4,0 1,0 Hình 3.3. Phân tích sản phẩm nhân gen fljB bằng kỹ thuật PCR trên gel agaroza 0,8% Đường chạy1: Sản phẩm PCR của gen fljB Đường chạy 3: Thang ADN chuẩn 1Kb (Fermentas) Kết quả điện di sản phẩm PCR trên gel agaroza cho thấy, sản phẩm là một băng sáng rõ nét, đặc hiệu, có kích thước khoảng 1,5 Kb, đúng theo tính toán. Kết quả này đã khẳng định chương trình chạy cho kỹ thuật PCR là phù hợp, cặp mồi thiết kế đặc hiệu. Sản phẩm PCR đủ điều kiện để tiến hành các bước tiếp theo. Từ sự thành công ở bước nhân dòng gen này đã tạo điều kiện thuận lợi cho bước đưa gen fljB vào vector tách dòng. 3.3. Tách dòng gen fljB 3.3.1. Đưa gen fljB vào vector tách dòng pCR 2.1 Chúng tôi chọn vector pCR 2.1 làm vector tách dòng vì đây là vector có nhiều ưu điểm : kích thước phù hợp: 3,9 kb; số lượng bản sao trong một tế bào lớn: 100 - 200 bản; Chứa gen lacZ: dấu chuẩn dùng cho việc chọn lọc các tế bào mang plasmit; có vùng đa nối (polycloning site) với nhiều điểm cắt enzim hạn chế phù hợp. Hơn nữa vector pCR2.1 không tồn tại ở dạng vòng kín mà được thiết kế ở dạng thẳng với hai đầu tự do chứa một bazơ T. Như đã nói ở phần phân lập gen, enzim sử dụng cho phản ứng PCR là Taq ADN polimeraza có tính năng gắn thêm một bazơ A ở đầu 3’ của mỗi sợi, và sẽ bổ sung với đầu thừa T trên vector pCR 2.1. Chính vì thế khi ghép nối sản phẩm PCR của gen fljB vào vector pCR 2.1, chúng tôi chỉ cần bổ sung enzim nối T4 – ADNligaza và một số chất cần thiết khác vào hỗn hợp giữa vector và sản phẩm PCR. Sau đó ủ hỗn hợp này ở nhiệt độ thích hợp có thể tạo được plasmit tái tổ hợp. Sau khi đã gắn sản phẩm PCR vào vector tách dòng, hỗn hợp này được biến nạp vào tế bào vi khuẩn E. coli DH5ỏ. 3.3.1.1. Biến nạp sản phẩm nối ghép vào tế bào E. coli DH5ỏ Sản phẩm phản ứng ghép nối được biến nạp vào tế bào vi khuẩn E. coli DH5ỏ bằng phương pháp sốc nhiệt. Để quá trình biến nạp được hiệu quả, chúng tôi tiến hành tạo tế bào khả biến E. coli DH5ỏ như tả trong phần phụ lục. Cơ sở của quá trình biến nạp đó là: dưới tác dụng của CaCl2 thành tế bào vi khuẩn đang ở thời kỳ sinh trưởng (pha log) trở nên xốp tạo ra nhiều kênh dẫn xuyên màng. Nhờ đó mà khi thay đổi nhiệt độ đột ngột thì các kênh dẫn này được mở rộng, tạo điều kiện cho ADN có thể đi qua các lỗ màng tế bào vào tế bào chất. Quy trình thực hiện biến nạp được trình bày ở chương II. Sản phẩm sau khi biến nạp được bổ sung LB lỏng , cấy lắc ở 370C. Sau đó cấy trải trên môi trường LB đặc có bổ sung Ampinixilin (100 ỡM/ ỡl). Kết quả được thể hiện trên hình 3.4: Kết quả trên hình cho thấy trên đĩa thạch xuất hiện các khuẩn lạc màu xanh, trắng khác nhau. Dựa vào các cơ chế chọn lọc khác nhau ở trên ta có thể chọn lọc được dòng tế bào mang plasmit tái tổ hợp. Hình 3.4. Các dòng tế bào mang pCR2.1 (màu xanh) và plasmit tái tổ hợp (màu trắng) trên đĩa thạch LB có bổ sung Amp, X-gal và IPTG. 3.3.1.2. Chọn lọc các cá thể biến nạp mang plasmit tái tổ hợp Trên đĩa thạch xuất hiện các khuẩn lạc màu xanh, trắng khác nhau. Như theo đánh giá ban đầu thì các khuẩn lạc màu trắng là các thể biến nạp có gen ngoại lai chèn vào. Các khuẩn lạc màu xanh không có gen ngoại lai chèn vào. Do đó, chúng tôi chọn ngẫu nhiên một số khuẩn lạc màu trắng, và một khuẩn lạc màu xanh làm đối chứng. Tất cả chúng được cấy lắc trong môi trường LB lỏng có bổ sung ampixillin ở 37oC qua đêm. Tế bào được thu lại bằng cách ly tâm 5000 vòng/trong 5 phút. Sau đó, tiến hành tách chiết ADN plasmit để kiểm tra. Tiến trình được mô tả trong phần phương pháp. Kết quả, dòng vi khuẩn nào mang plasmit cao hơn đối chứng (pCR2.1) sẽ được chọn. Sản phẩm tách ADN plasmit được kiểm tra bằng điện di trên gel agaroza 0,8%. Kết quả được trình bày trong Hình 3.5. pCRfljB pCR2.1 1 2 3 4 Hình 3.5. Phân tích sản phẩm tách chiết ADN plasmit tách dòng trên gel agaroza 0,8% Đường chạy 1: plasmit đối chứng không mang gen pCR2.1. Đường chạy 2-4: plasmit tái tổ hợp pCR fljB Kết quả trên điện di đồ cho thấy, kích thước băng của các plasmit đối chứng chạy nhanh hơn các plasmit tái tổ hợp. Với kết quả này các dòng plasmit tái tổ hợp được cắt bằng các enzim hạn chế nhằm lựa chọn chính xác dòng plasmit mang đúng gen fljB mong muốn. 3.3.2. kiểm tra plasmit tái tổ hợp pCRfljB bằng enzim hạn chế Sau khi thu được plasmit tái tổ hợp, chúng tôi tiến hành cắt kiểm tra bằng enzim hạn chế. Chúng tôi đã sử dụng bản đồ cắt giới hạn của vector PCR2.1 và của đoạn fljB để tìm các enzim kiểm tra phù hợp. Sau khi nghiên cứu chi tiết sự phù hợp giữa các enzim trên bản đồ cắt giới hạn, và enzim có trong phòng thí nghiệm, chúng tôi quyết định chọn enzim Nco I, Xho I, EcoR I để cắt kiểm tra gen fljB và trên vector. Kết quả xử lý plasmit bằng các enzim hạn chế được kiểm tra trên gel agaroza 0,8% ở các hình sau. 1 2 3 Kb 1,6Kb 2,2Kb 3,8Kb 3,2Kb 6,0 4,0 1,5 2,0 1,0 0,5 Hình 3.6. Phân tích sản phẩm cắt plasmit pCRfljB bằng enzim Nco I trên gel agaroza 0,8% Đường chạy 1: Thang ADN chuẩn 1 Kb (Gibco) Đường chạy 2-3: pCRfljB Enzim Nco I có một vị trí cắt ở đầu mút của gen fljB và một nằm trong vectơ. Nếu gen đưa vào là xuôi chiều với promotor thì sản phẩm cắt có hai băng có kích thước 3,2 Kb và 2,2 Kb. Còn nếu là gen đưa vào là ngược chiều thì sản phẩm cắt có kích thước là 1,6 Kb và 3,8 Kb. Trên điện di đồ hình 3.6 (a) có các đoạn ADN với kích thước đúng như tính toán. Dòng pCRfljB trên đường chạy 2 là dòng mang gen fljB xuôi chiều với promoter lac, còn dòng pCRfljB trên đường chạy 3 là dòng mang gen fljB ngược chiều với promoter lac Tương tự như vậy đối với enzim Xho I cũng có 1 điểm cắt trên vector và sát trên gen fljB. Nếu gen đưa vào là xuôi chiều với promoter thì sản phẩm cắt có hai băng với kích thước là 5,42 Kb 1,52 Kb và 3,9 Kb. Còn gen đưa vào là ngược chiều thì sản phẩm cắt có kích thước là1,52 Kb và 3,9 Kb. Kết quả được điện di kiểm tra trên gel agaroza 0,8%. Hình 3.7 cho thấy dòng pCRfljB trên đường chạy 2 là dòng mang gen ngược chiều với promoter lac. Còn dòng pCRfljB trên đường chạy 3 là dòng mang gen xuôi chiều với promoter lac. 1 2 3 Kb 5,42Kb 6,0 4,0 2,0 1,0 12 3,9Kb 1,52Kb 0,5 Hình 3.7. Phân tích sản phẩm cắt plasmit pCRfljB bằng XhoI trên gel agaroza Đường chạy 1: Thang ADN chuẩn 1 Kb (Gibco) Đường chạy2-3: PCRfjB Enzim EcoR I có hai điểm cắt nằm ở hai vùng đa nối trên vector pCR21, đồng thời gen fljB không chứa trình tự EcoR I. Vì thế đối với enzim EcoR I sẽ có hai điểm cắt nằm ở hai vùng đa nối trên vectơr pCR2.1, khi chèn đoạn gen ngoại lai vào nếu là xuôi, hay ngược chiều thì vẫn nằm giữa hai điểm cắt của enzim EcoR I. Khi cắt plasmit tái tổ hợp mang fljB thì sản phẩm cắt sẽ có hai đoạn ADN với kích thước 1,52 Kb, và 3,9 Kb. Còn trên vectơ pCR2.1 đối chứng khi cắt bằng enzim này chỉ cho một băng có kích thươc 3,9 Kb. Kết quả trên điện di đồ hình 3.8 cho thấy hai băng ADN rõ nét với kích thước đúng như tính toán. Do đó, bước đầu, chúng tôi khẳng định đã tách dòng thành công gen fljB trong vector PCR2.1. Vector tái tổ hợp mang gen fljB được đặt tên là pCRfljB. 1 2 3 Kb 6,0 2,0 4,0 3,9Kb 1,5 1,5Kb 1,0 0,5 Hình 3.8. Phân tích sản phẩm cắt kiểm tra plasmit pCRfljB bằng EcoR I trên gel agaroza 0,8%. Đường chạy số 1: Thang ADN chuẩn 1 Kb (Gibco) Đường chạy số 2-3: PCRfjlB c 3.3.3. Kiểm tra gen fljB trong pCR2.1 bằng giải trình tự gen. Trong quá trình tiến hành kỹ thuật PCR, sai sót có thể xẩy ra trong sản phẩm PCR, đặc biệt là sự biến đổi nucleotit trong thành phần gen fljB. Mặc dù những sai sót này có thể nhỏ nhưng lại có sự ảnh hưởng lớn đến kết quả biểu hiện gen. Sự thay thế nucleotit không mong muốn có thể tạo ra một trình tự mã kết thúc. Sự mất hay thêm nucleotit dẫn đến sai cấu trúc dịch tạo ra protein hoàn không chính xác. Chính vì vậy, để kiểm tra gen fljB đã được tách dòng chính xác là gen mong muốn, chúng tôi tiến hành giải trình tự gen này trong vector pCR2.1. So sánh trình tự các nucleotit của gen đã tách dòng với trình tự nucleotit của gen này tren ngân hàng gen Quốc tế bằng phần mềm chuyên dụng (phần phụ lục), chúng tôi nhận thấy, gen có độ tương đồng cao 100% với gen mã số AF045151. Điều đó cho phép khẳng định, gen fljB đã tách dòng thành công trong vector pCR2.1, vector tách dòng pCRfljB đủ điều kiện để tiến hành nối ghép tạo vector biểu hiện. 3.4. Thiết kế vector biểu hiện gen fljB trong tế bào E. coli 3.4.1. Thu gen fljB từ plasmit tái tổ hợp pCRfjlB Trong phần phân lập gen đã đề cập khi thiết kế mồi, chúng tôi đã đưa trình tự nhận biết của hai enzim cắt hạn chế Xho I và Nco I vào hai đầu của đoạn gen thu được. Nhưng trên pCR2.1 cũng có một điểm cắt NcoI nên khi cắt Nco I + Xho I sẽ bị lẫn đoạn Nco I + Xho I của vector có cùng kích thước tương ứng với kich thước fljB. Để tránh vấn đề đó pCRfljB được cắt bằng EcoRI, rồi thu băng, tinh sạch và sau đó cắt bằng Nco I + Xho I để đưa vào pET32a(+) 3.4.2. Nối gen fljB và vector pET32 a (+) Plasmit và gen fljB giới hạn bởi enzim hạn chế Nco I + Xho I đặc hiệu được nối với nhau nhờ enzim T4 ADN ligaza ở 16oC qua đêm, trong điều kiện bổ sung BSA và các dung dịch đệm phù hợp. Sau khi phản ứng được hoàn tất, sản phẩm phản ứng được biến nạp vào tế bào vi khuẩn E. coli BL21, tế bào sau khi biến nạp được cấy trải trên đĩa thạch có bổ sung Ampixilin ở 37oC, thì chỉ những dòng nào mang plasmit mới có thể tồn tại được. Do đó việc cấy trải trên môi trường chọn lọc chứa Ampixilin không những tránh nhiễm khuẩn mà bước đầu sàng lọc được những thể không mang plasmit. 3.4.3. Chọn lọc thể biến nạp mang plasmit tái tổ hợp Sau khoảng 12 giờ nuôi cấy trên đĩa thạch, số lượng khuẩn lạc mọc lên được trên môi trường LB + Amp khá nhiều, chúng tôi tiến hành chọn ngẫu nhiên một số khuẩn lạc cấy chuyển sang môi trường LB lỏng để thu tế bào, tách plasmit. Sản phẩm tách chiết được kiểm tra bằng cách điện di trên gel agaroza 0,8%. Kết quả điện di kiểm tra được thể hiện trên hình 3.8. Theo tính toán lý thuyết, các plasmit pET32a(+) được chèn gen fljB vào có kích thước lớn hơn vector pET32a(+) không có gen chèn vào. Trên điện di đồ, chúng tôi sử dụng là vector pET32a(+) làm vector đối chứng, nên theo lý thuyết các plasmit đối chứng này sẽ chạy nhanh hơn các plasmit mang gen. Hình 3.9. Phân tích ADN plasmit tái tổ hợp trên gel agaroza 0,8% Đường chạy 2-3: pET32fljB Đường chạy 1: pET32(+) pETfljB pET32a(+) 1 2 3 Kết quả trên điện di đồ cho thấy đường chạy của plasmit tái tổ hợp có băng cao hơn hẳn so với đường chạy đối chứng. Như vậy các dòng mà chúng tôi lựa chọn đều đã có gen ngoại lai chèn vào. 3.4.4. Cắt kiểm tra plasmit tái tổ hợp pET32fljB Cũng tương tự với việc chọn lọc plasmit trong quá trình tách dòng, các plasmid mang gen ngoại lai đã thu được ở trên, được kiểm tra xem gen ngoại lai chèn vào đúng là gen mong muốn hay chưa. Chúng tôi tiến hành cắt kiểm tra bằng hai enzim Hind III+ Xba I. Vì trong gen fljB có điểm cắt của enzim hạn chế Hind III ở vị trí 566 còn enzim Xba I nằm trên vector cách điểm cắt của enzim Nco I dùng để đưa gen fljB là ≈ 0,5 Kb, khi cắt vector bằng hai 2 enzim này sẽ cho ra đoạn gen có kích thước 1 Kb. Hơn nữa khi sử dụng enzim ở trong gen để cắt thì kết quả sẽ chính xác hơn. Còn pET32a(+) cho ra một băng khoảng 5,9 Kb. 1,5 1,0 0,5 a a Kb 1 2 3 4 5 6 6,0 Hình 3.10. Phân tích sản phẩm cắt plasmit tái tổ hợp pET32fljB bằng Xba I và Hind III trên gel agaroza 0,8% Đường chạy số1-4: Dòng pET32fljB Đường chạy số 5: Dòng pET32a(+) Đường chạy 6: Thang ADN chuẩn 1 Kb(Gibco) Hình 3.10. cho thấy, các băng ADN thể hiện trên điện di đồ đúng như tính toán lý thuyết. Như vậy, chúng tôi có thể kết luận vector pET32fljB đã được thiết kế thành công. Để chắc chắn hơn, chúng tôi đã kiểm tra gen bằng 2 enzim hạn chế Nco I + Xho I. Theo tính toán lý thuyết cũng cho ra 2 đoạn băng ADN có kích thước (1,5 Kb + 5,9 Kb), còn pET32a(+) cũng chỉ cho ra một băng có kích thước là 5,9 Kb. Kết quả được thể hiện trên hình 3.11. 1 2 3 5,9Kb 4 5 6 6,0 5 6 4,0 2,0 1,5Kb 1,5 1,0 0,5 4 5 6 Hình 3.11. Phân tích sản phẩm cắt kiểm tra plasmit tái tổ hợp pETfljB bằng enzim hạn chế Xho I+Nco I Đường chạy 1: Thang ADN chuẩn 1 Kb (Fermentas) Đường chạy 2: Dòng pET32fljB Đường chạy 3:Dòng pET32a(+) Kết quả trên điện di đồ chúng ta thấy kích thước băng ADN với chiều dài 1,5 Kb đúng như tính toán lý thuyết. Như vậy một lần nữa khẳng định rằng gel fljB đã được ghép nối thành công vào vector biểu hiện pET32a(+). Vector này được biến nạp vào chủng vi khuẩn E. coli BL21 để nghiên cứu biểu hiện gen. 3.5. Biểu hiện gen fljB trong E. coli BL21 Chủng vi khuẩn E. coli BL21 tái tổ hợp được nuôi cấy trên môi trường LB có chọn lọc nhờ ampixillin tại 37oC qua đêm. Sau đó tiến hành làm mới tế bào cho đến khi OD bước sóng 600 nm của môi trường nuôi cấy đạt 0,6 thì tiến hành cảm ứng bằng IPTG đến nồng độ cuối cùng 0,1 mM. Sinh khối tế bào được thu lại sau 1, 2, 3, 4 giờ cảm ứng. Protein tổng số của các dòng tế bào mang plasmit pET32fljB tái tổ hợp được trình bày ở hình 3.12 1 2 3 4 kDa 66,2 45 35 25 18,8 14,4 Hình 3.12: Phân tích protein tổng số của chủng E. coli BL21 mang pET32fljB trên gelpolyacrylamit có T=12,6%,SDS Đường chạy số 1: Thang protein chuẩn (Fermentas) Đường chạy số 2 -3: E. coli BL21 mang pET32fljB Đường chạy số 4: Protein không cảm ứng IPTC Kết quả trên hình 3.9 cho thấy, thể biến nạp E. coli BL21 mang gen fljB tổng hợp một protein lai có kích thước hơn 66 kDa tương đương với kích thước của protein fljB dung hợp với vetor pET32a(+) theo tính toán lý thuyết. Như vậy protein fljB được biểu hiện thành công trong vi khuẩn E. coli khi được cảm ứng với IPTG có trong môi trường. 3.6. Nhiên cứu một số điều kiện thích hợp để biểu hiện protein tái tổ hợp FljB của E. coli BL21 Chúng tôi đã nghiên cứu ở các điều kiện nhiệt độ, các nồng độ IPTG và các thời gian cảm ứng khác nhau. 3.6.1. ảnh hưởng nhiệt độ cảm ứng lên khả năng biểu hiện gen fljB Trong quá trình biểu hiện sản phẩm protein ngoại lai, điều kiện môi trường cho việc biểu hiện là rất quan trọng. Khi quan sát điều kiện nhiệt độ trong quá trình sinh trưởng của chủng biểu hiện E. coli, người ta đã phát hiện rằng nhiệt độ tối ưu cho sinh trưởng của E. coli 37oC không phải là điều kiện tối ưu tạo sản phẩm [66]. Theo ông, khi sinh trưởng với tốc độ cao, các bản sao plasmit trong tế bào thường giảm kéo theo sự giảm chất lượng của sản phẩm tạo ra trong quá trình biểu hiện. Bởi vậy, qua nhiều thực nghiệm người ta thấy rằng, với chủng E. coli, điều kiện tối ưu cho sự biểu hiện tạo sản phẩm protein có chất lượng tốt thường là nhiệt độ 28-30oC. Với nhiều protein độc, khi biểu hiện ở nhiệt độ cao, protein tái tổ hợp thường tồn tại ở dạng thể vùi không có hoạt tính. Để tối ưu biểu hiện, các chủng này người ta thường biểu hiện ở nhiệt độ thấp từ 20oC – 37oC. ở 37oC có nhiều proteaza nội bào phân cắt protein tái tổ hợp FljB, do đó ở điều kiện nhiệt độ 30oC là phù hợp để biều hiện protein. 1 2 3 4 5 6 Protein tổng số được xử lý và điện di kiểm tra trên gel polyacrylamit 12,6% hình 3.13. kDa 66,2 FljB 45 35 25 18,8 14,4 Hình 3.13. Phân tích sản phẩm protein của tế bào E. coli BL21 mang gen fljB trên gel polyacrylamit 12,6% Đường chạy số 1- 4: Protein thu được sau khi cảm ứng IPTG ở các nhiệt độ 20- 37oC tương ứng của chủng E. coli BL21 mang plasmit pETfljB Đường chạy số 5: Thang protein chuẩn (Fermentas) Đường chạy số 6: Protein đối chứng Kết quả điện di đồ cho thấy băng protein biểu hiện được là một băng đậm, rõ nét với kích thước đúng như dự đoán khoảng 66 kDa ở các điều kiện nhiệt độ từ 20oC, 25oC, 30oC, 37oC. Trong đó ở 37oC lượng protein FljB là nhiều nhất và tốc độ sinh trưởng là tốt nhất. Tuy nhiên ở 37oC có nhiều proteaza nội bào phân cắt protein tái tổ hợp FljB trong E. coli. Còn ở điều kiện nhiệt độ 30oC tốc độ sinh trưởng của tế bào không quá nhanh, do đó protein FljB đóng gói tốt hơn để cho dạng cấu trúc hoàn thiện hơn. Vì những lí do đó chúng tôi lựa chọn nhiệt độ cảm ứng là 30oC cho các nghiên cứu tiếp theo. Từ kết quả này, bước đầu chúng tôi có thể nhận định protein biểu hiện được là protein mong muốn FljB. Phần lớn, các protein có hoạt tính đều ở trạng thái tan. Vì vậy để kiểm tra khả năng tan của protein tái tổ hợp, chúng tôi đã đánh giá trên cơ sở so sánh giữa pha tan và không tan của protein trong cùng một điều kiện cảm ứng. Sau khi phá tế bào bằng siêu âm pha tan là dịch nổi được thu lại bằng li tâm, phần cặn còn lại là pha không tan được hoà trở lại với dịch đệm TE để điện di kiểm tra trên gel polyacrylamit 12,6% hình 3.14. 1 2 3 4 5 kDa 66,2 66,2 kDa 45 35 25 18,8 14,4 Hình 3.14. Protein tan và không tan của E. coli BL21 mang gen fljB trên gel polyacrylamit 12,6%. Đường chạy 1: Protein tan biểu hiện ở nhiệt độ 25oC Đường chạy 2: Protein không tan biểu hiện ở nhiệt độ 25oC Đường chạy 3: Thang protein chuẩn (Fermentas) Đường chạy 4 : Protein tan biểu hiện ở nhiệt độ 30oC Đường chạy 5 : Protein không tan ở nhiệt độ 30oC Kết quả thu được trên điện di đồ cho thấy protein FljB dạng tan chiếm đa số ≈ 90% ở các nhiệt độ khác nhau (25oC, 30oC), bởi khi chúng tôi tăng nồng độ không tan lên gấp 4 lần so với nồng đọ đang tiến hành thí nghiệm, thì ở pha không tan không xuất hiện băng FljB do đó protein ở pha tan chiếm tỉ lệ ≈ 90% được thể hiện trên điện di đồ là các băng đậm nét, tăng dần theo nhiệt độ, tuy nhiên đậm nhất là ở 30oC trong tổng số protein tái tổ hợp thu được. Còn pha không tan lượng protein còn rất ít, điều đó được thể hiện ở các băng rất mờ trên điện di đồ. 3.6.2. ảnh hưởng nồng độ chất cảm ứng IPTG lên khả năng biểu hiện gen fljB Bên cạnh điều kiện về nhiệt độ thì nồng chất cảm ứng cũng là một trong những điều kiện quan trọng quyết định khả năng biểu hiện của gen ngoại lai. Hơn nữa đây là một cơ chất đắt tiền với điều kiện thí nghiệm của Việt Nam hiện nay, đòi hỏi việc xác định nồng độ IPTG tối thích cho quá trình biểu hiện protein ngoại lai là công việc cần thiết và có ý nghĩa thiết thực với quá trình sản xuất sau này. Chúng tôi tiến hành khảo sát khả năng biểu hiện của protein fjlB ở các nồng độ chất cảm ứng (0 mM, 0,05 mM, 0,1 mM, 0,2 mM, 0,4 mM, 0,6 mM, 0,8 mM, 1 mM, 2 mM), ở 30oC và thời gian cảm ứng là 4h. Kết quả được thể hiện trên điện di polyacrylamit 12,6% hình 3.12. 1 2 3 4 5 6 7 8 9 10 kDa 66,2 Protein tái tổ hợp FljB 45 35 25 18,8 Hình 3.15. Phân tích sản phẩm protein của tế bào E. coli BL21 mang gen fljB trên gel polyacrylamit 12,6% Đường chạy số 1- 9: Protein tái tổ hợp thu được sau khi cảm ứng IPTG ở các nồng độ: 0 mM, 0,05 mM, 0,1 mm, 0,2 mM, 0,4 mM, 0,6 mM, 0,8 mM, 1mM, 2mM tương ứng của chủng E. coli BL21 mang plasmit pETfljB Đường chạy số 10: Thang protein chuẩn (Fermentas) Kết quả điện di cho thấy khi protein không cảm ứng IPTG thì tốc độ sinh trưởng của E. coli BL21 tăng lên, tổng hợp được nhiều protein thể hiện có nhiều băng protein. Khi cảm ứng ở nồng độ thấp 50 ỡM sự sinh trưởng của chúng giảm xuống và fljB bắt đầu được biểu hiện. Khi cảm ứng với nồng độ cao hơn 100 ỡM protein fljB biểu hiện tốt hơn. Điều đó được thể hiện trên điện di đồ là một băng đậm, rõ nét với kích thước đúng như dự đoán khoảng 66 kDa. Lượng protein fljB tái tổ hợp được tổng hợp được ổn định ở các nồng độ IPTG khác nhau 0,05 mM, 0,1 mM, 0,2 mM, 0,4 mM, 0,6 mM, 0,8 mM, 1 mM, 2 mM. Như vậy ta có thể thu được lượng protein tái tổ hợp fljB tương đối lớn mà chỉ cần sử dụng một lượng chất cảm ứng rất nhỏ (0,1 mM). Đây là một là một trong những yếu tố quan trọng góp phần làm giảm chi phí cho quá trình sản xuất sau này. Nồng độ IPTG 0,1 mM được lựa chọn cho các nghiên cứu tiếp theo. 3.6.3. ảnh hưởng thời gian cảm ứng lên khả năng biểu hiện của gen fljB Thời gian cảm ứng có liên quan mật thiết đến số lượng và chất lượng của protein tái tổ hợp được biểu hiện. Do đó chúng tôi tiến hành khảo sát thời điểm thu mẫu khác nhau từ 0 giờ đến 5 giờ sau khi bổ sung chất cảm ứng IPTG với nồng độ 0,1 mM và nuôi cấy ở 30oC. Sau khi nuôi cấy, tế bào được thu lại bằng ly tâm và được phá bằng siêu âm trong đệm xử lý mẫu. Protein được kiểm tra trên gel điện di polyacrylamit 12,6% hình 3.16. kDa 66,2 45 35 25 18,8 14,4 1 2 3 4 5 6 7 FljB Hình 3.16. Phân tích sản phẩm protein của tế bào E. coli BL21 mang gen fljB trên gel polyacrylamit 12,6% Đườngchạy số 1: Thang proteinchuẩn Đường chạy số2-7: Protein thu được sau khi cảm ứng 0, 1, 2, 3, 4, 5 giờ của chủng E. coli BL21 mang plasmit pET32fljB Trên hình ảnh điện di ta thấy, ở các đường chạy 1, 2, 3, 4, 5 là đường chạy protein của các dòng mang gen được cảm ứng IPTG là 0,1 mM, ở nhiệt độ 30oC và 4 giờ sau khi cảm ứng lượng protein tái tổ hợp được tạo thành trong tế bào là tương đối ổn định. Vì vậy chúng tôi chọn thời gian cảm ứng là 4 giờ cho protein tái hợp biểu hiện. Như vậy, các điều kiện nuôi cấy thích hợp mà chúng tôi đã khảo sát được đó là nhiệt độ nuôi cấy 30oC, nồng độ chất cảm ứng IPTG 0,1 mM, và thời gian thu mẫu sau khi cảm ứng là 4 giờ. Tuy nhiên để có được vacxin tái tổ hợp chúng ta cần nghiên cứu tiếp theo trước hết là tinh sạch protein tái tổ hợp FljB. 3.7. Tinh sạch protein tái tổ hợp FljB Sau khi biểu hiện thành công protein tái tổ hợp FljB trong vi khuẩn E. coli BL21, chủng vi khuẩn này được nuôi cấy cảm ứng lượng lớn để tiến hành tinh sạch qua cột sắc kí ái lực His-tag. Protein tổng số được cho qua cột ái lực His-tag để tiến hành tinh sạch protein fljB. Protein được tổng hợp sẽ là một protein tái tổ hợp mang thêm 6 axit amin Histidin ở vùng nối Thioredoxin và fljB. Dưới điều kiện pH thích hợp (pH =7 hoặc hơi kiềm) và nồng độ của đệm gắn Imidazol phù hợp 50 mM, ion Ni gắn trên hạt Sepharoza tạo liên kết tĩnh điện với đuôi Histidin. Khi đó, protein tái tổ hợp sẽ được giữ lại trên cột. Sau khi đã rửa sạch những protein không mong muốn với nông độ của đệm rửa chứa100 mM Imidazol, protein tái tổ hợp được thu lại nhờ đệm thu mẫu có nồng độ Imidazol phù hợp ở 500 mM, làm cho liên kết tĩnh điện giữa Ion Ni và đuôi His-tag được phá vỡ. Vì vậy, protein tái tổ hợp theo dịch thu ra ngoài cột. 1 2 3 4 5 6 7 8 Sản phẩm protein tái tổ hợp được thu theo từng phân đoạn 2 ml một phân đoạn và được kiểm tra trên điện di polyacrylamit 12,6% hình 3.17. kDa 66,2kD FljB 18,8 66,2 45 35 25 14,4 Hình3.17. Phân tích protein tinh sạch trên gel polyacrylamit 12% Đường chạy 1: Protein thô chưa tinh sạch Đường chạy 2: Protein không bám lên cột Đường chạy 3: Protein được rửabằngđệm rửa Đường chạy 4: Thang protein chuẩn (Gibco) Đường chạy 5-8: Protein được tinh sạch theo các phân đoạn 1, 2, 3, 4. Trong quá trình tinh sạch, protein được thu theo các phân đoạn khác nhau được đánh số từ 5-8. Kết quả kiểm tra trên hình 3.17 cho thấy, từ đường chạy 5-6 xuất hiện những băng protein, đậm nét, nhất là với đường chạy 6 với kích thước phân tử khoảng 66 kDa. Kích thước của các băng protein đó phù hợp kích thước băng protein FljB biểu hiện trên hình 3.15 và bằng với protein thô 66 kDa, mặt khác protein ở đường chạy 3, 4 tiêu hao ra ngoài rất ít, biểu hiện trên hình rất mờ. Điều này chứng tỏ proein FljB biểu hiện trong E. coli đã tinh sạch thành công, với độ tinh sạch cao. Trong các phân đoạn protein thu được, phân đoạn 5 cho lượng protein tinh sạch thấp nhât, còn phân đoạn 6 cho lượng protein tinh sạch cao nhất (thể hiện là băng protein đậm nhất). Như vậy gen fljB mã hoá cho kháng nguyên roi H: 1,2 được kết luận là bước đầu của sự thành công. Vì điều kiện về thời gian nên chúng tôi mới nghiên cứu được đến đây. Tuy nhiên qua nghiên cứu các tài liệu thì chúng tôi thấy rằng kháng nguyên tái tổ hợp FljB, nguồn gốc từ S. typhimurium, có khả năng tạo đáp ứng miễn dịch đặc hiệu tốt. Khả năng này tương đương với khả năng đáp ứng miễn dịch của tự nhiên. Vì vậy chúng tôi hi vọng sẽ tạo ra được loại vacxin mới an toàn và hiệu quả trong việc phòng ngừa vi khuẩn gây bệnh S. typhimurium. Kết luận Trong quá trình trình thực hiện đề tài: “phân lập và biểu hiện gen fljB mã hoá cho kháng nguyên roi (H): 1,2 của S. typhimurium trong tế bào escherichia coli BL21” chúng tôi đã đạt được kết quả sau: 1. Tách chiết thành công hệ gen của vi kuẩn Salmonella Tách dòng thành công gen fljB vào vector pCR2.1, gen có trình tự tương đồng 100% với gen fljB trên ngân hàng gen mã số AF045151 Thiết kế thành công vector biểu hiện pET32fljB mang gen ngoại lai fljB Biểu hiện thành công gen fljB mã hoá kháng nguyên roi H: 1,2 của S. typhimurium trong tế bào E. coli BL21, gen biểu hiện tốt nhất ở 30oC trong môi trường có chất cảm ứng IPTG 0,1 mM và protein tan tốt ở trong nướckhoảng 90% Tinh chế thành công protein tái tổ hợp qua cột sắc kí ái lực His-tag. định hướng nghiên cứu Kiểm tra khả năng sinh đáp ứng miễn dịch của kháng nguyên tái tổ hợp ở gà Nghiên cứu tạo vacxin tái tổ hợp chống S. typhimurium ở gà TàI liệu tham khảo Tiếng Việt Lê Trần Bình, Phan Văn Chi, Nông Văn HảI, Trương Nam Hải, Lê Quang Huấn (2003) áp dụng kỹ thuật phân tử trong nghiên cứu tài nguyên sinh vật Việt Nam, Nhà xuất bản Khoa học và kỹ thuật Hồ Huỳnh Thùy Dương (1998) Sinh học phân tử, Nhà xuất bản giáo dục. Nguyễn Ngọc Lanh, Văn Đình Hoa (2003) Miễn dịch học, Nhà xuất bản Y học, Hà Nội. Nguyễn Đình Huyên (1999) Những điều cơ bản của kỹ thuật Di truyền, Nhà xuất bản Nông Nghiệp, TP. Hồ Chí Minh. Nguyễn Thị Hường, Đặng Đức Trạch, Nguyễn Đình Hương, Phạm Mạnh Hùng,Pondman K.W, Wright PE (1984) Miễn dịch học, University press University of Amsterdam. Phan Cự Nhân, Nguyễn Minh Công, Đặng Hữu Lanh (2003) Di truyền học tập 2, NXB Đai Học Sư phạm Hà Nội Nguyễn Thị Trung, Đỗ thị Huyền, Phạm Thuý Hồng, Trương Nam Hải- Trương Văn Dung (2003) Phân lập và biểu hiện gen fljB1 mã hoá epitope kháng nguyên H:1,2 của Salmonella typhimurium trong vi khuẩn escherichia coli BL21, Hội nghị Công nghệ Sinh học toàn quốc, Hà Nội trang 1224-1227 Nguyễn Thị Trung, Đỗ Thị Huyền, Phạm Thuý Hồng, Trương Văn Dung, Trương Nam Hải 2003 Phân lập và biểu hiện gen fljB2 mã hoá Epitope kháng nguyên H:1,2 của salmonella typhimurium trong vi khuẩn E. coli, Hội nghị Công nghệ Sinh học toàn quốc, Hà Nội .trang 25-31 Nguyễn Thị Trung, Đỗ thị Huyền, Phạm Thuý Hồng, Trương Nam Hải- Trương Văn Dung 2003 Phân lập và biểu hiện gen GM1 mã hoá cho epitope thuôch kháng nguyên H:GM của Salmonella enteritidis ATCC13076 Hội nghị Công nghệ Sinh học toàn quốc, Hà Nội trang 34-39 Trần Ngọc Tân, Đỗ Thị Huyền, Nguyễn Thị Thu Hằng, Nguyễn Minh Giang, Phạm Thuý Hồng, Tô Long Thành, Trương Nam Hải (2003) “Tách dòng và biểu hiện gen fliC3 mã hoá kháng nguyên roi H: i của vi khuẩn Salmonella typhimurium ATCC13076 trong tế bào Escherichia coli BL21”, Hội nghị Công nghệ Sinh học toàn quốc trang 1155-1158. Trần Ngọc Tân, Nguyễn Minh Giang, Đỗ Thị Huyền, Tô Long Thành, Phạm Thuý Hồng, Trương Nam Hải (2004) “Nghiên cứu khả năng đáp ứng miễn dịch của kháng nguyên tái tổ hợp FliC từ Salmonella typhimurium trong gà”, Tạp chí Công nghệ Sinh học, 2(1), trang. 65-70. Tiếng Anh Andrew TG, Peter OS, Clare KS, Laura JT, Curt HH, Alison DO, Andrew SN, James LM (2001) “Salmonella typhimurium translocates flagellin across intestinal epithelia, inducing a proinflammatory reponse”, Journal of Clinical Investigation, 107(1), pp. 99-109. Avian Di (2003) “Rapid detection of Salmonella from poultry by real- time polymerase chain reation with fluorescent hybridiization probes”, Epidemiol Infection, USA, pp. 380-386 Ann MA (2000) “Vaccines, Viral”, Encyclopedia of Microbiology, Academic press, UK, 4, pp. 779-787. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman J. G, Smith J. A, Struhl K (1995) Short Protocols in Molecular Biology. Compendium of Methods from Current Protocols in Molecular Biology. 3rd Edition, Wiley, USA. Axelsson F, Marie-Laure S (1997) Transia Salmonella, S-422 46 Hisings Backa, Sweden De Vries N, Zwaagstra KA, Huis in’t Veld JHJ, van Knapen F, van Zijderveld FG, Kusters JG (1998) “Production of Monoclonal Antibodies Specific for the i and 1,2 Flagellar Antigens of Salmonella typhimurium and Characterization of Their Respective Epitopes”, Applied and Enviromental Microbiology, 64(12), pp. 5033-5038 Baumler AJ, Heffron F, Reissbrodt R (1997) “Rapid detection of Salmonella enritica with primers specific for iroB”, Journal of Clinical Microbiology, 35 (5) p. 1224-1230. Carlos EH. (2002), “Salmonella”, infection and immunity, Encyclopedia of Immunology, Academic press, UK, Vol 3, pp. 2131-2133. Chris G (2002) “Endotoxin (lipopolysaccharide (LPS))”, Encyclopedia of Immunology, Academic press, UK, pp. 806-809. Christopher RB, Patricia F, Nancy B., Robert VT (2002) Salmonella, Annual summary, Department of Health and Human Services, USA. Clare KS, Stephen CD, Alison DO (1996) “The attenuated phenotype of a Salmonella typhimurium flgM mutant is related to expression of FliC Flagellin”, Journal of Bacteriology, 178(10), pp. 2911-2915. Fernandes JM, Hoeffler JP (2002) Gene expression systems, Academic Press, Harcourt Brace & Company, USA. Fierer J, Guiney DG (2001) “Diverse virulence traits underlying different clinical outcomes of Salmonella infection” The Journal of clinical investigation,107(7),p.1224-1230. Goeddal DV et, Al (1991) Gene Expression Technology, Academic Press, California. Gavin SC, Kelly TH (2000) “Coupling of Flagella gene Expression to Flagellar Assembly in Salmonella enterica Serovar Typhimurium and Escherichia coli”, Microbiology and Molecular Biology Review, 64(4), p. 694-708. Gordon A (2002) “Vaccines”, Encyclopedia of Immunology, Academic press, UK, pp. 2456-2465 Hans-Willi M, Barbel R, Anne K (2000) “cutting edge: role of B lymphocytes in protective immunity against Salmonella typhimurium Infection” Journal of Immunology, (164), pp. 1648-1652. Hoefer Scientific Instruments (1994) Protein electrophoresis, Applications Guide, San Fancisco, USA. Invitrogen life technologies (2002) “TOPO-TA cloning kit” James B. (2005) Vaccines & Immunomodulation, JH Immunology, Universityof Glasgow, UK John JD, Margaret AL (2002) “DNA vaccines”, Encyclopedia of Immunology, Academic press, UK, 2, pp. 771-774. Joshua F, Donald GG (2001) “Diverse virulence traits underlying different clinical outcomes of Salmonella infection”, Journal of Clinical Investigation, 107(7), pp. 775-780. Kenneth Todar  University of Wisconsin-Madison  Department of Bacteriology (2002) Mechanisms of bacterial pathogenicity endotoxins, Todar’s online Ttextbook of Bacteriology, USA. Kyoko Y, Shi-Ichi A, Shigeru Y (1995) “Flagellar Filament Structure and Cell Motility of Salmonella typhimurium Mutants Lacking Part of the Outer Domain of Flagellin”, Journal of Bacteriology, 177(4), pp. 1090-1093. Lisa LBK, Andrew P, Roy CH (1997) “Specific Detection of Salmonella typhimurium Proteins Synthesized Intracellularly”, Journal of Bacteriology, 179(11), pp. 3604-3612. Matthew AM, Karen WD, Gabriel ES, Scott J. H (2000) “Fimbriae, Pili“, Encyclopedia of Microbiology, Academic press, UK, 2, pp. 361-379. Methner U, Barrow PA, Berndt A, Steinbach G (1999) “Combination of vaccination and competitive exclusion to prevent Salmonella colonization in chickens: experimental studies”, International Journal of Food Microbiology, (49), pp. 35-42. Mierendort R, Yeager K, Novy R (1994) ‘’ The pET system: Your choice for expression’’, Novagen, Inc., 1(1), pp. 1-3. Novagen (1998) pET System Manual, No. 69337,UK. Noel H. Smith, Robert K. Selander (1990) “Sequence invariance of antigen coding central region of the phase 1 flagellar filament gene (fliC) among strain of Salmonella typhimurium”, Journal of Bacteriology, pp. 603 -609 Peter AB, Denise HW (1998) “Salmonellosis: No longer just a chicken and egg story”, Canadian medical association journal, (159), pp.63-64. Robert GW (1996) “DNA vaccines, Cyberspace and Self-Help Program”, Intervirology, (39), pp. 120-125. Roth JR (2001) “Salmonella”, Encyclopedia of Genetics, Academic Press, pp. 1766-1768. Ricardo A, Vanegas and Terence M. joys (1999) “ Moleucular analyses of the phase-2 antigen complex1,2. of Salmonella spp”, Journal of Bacteriology,(1),p. 3863-3864. Schmit Clare K, Darnell Stêphn C, O’Brien Alison D (1996) “ The Attenuated phenotype of a Salmonella typhimurium flgM Mutant is Related to expression of fliC flagellin”, Journal of Bacteriology, 178(10), pp. 2911-2915. Smith NH, Selander RK (1991) “Molecular genetic basis for complex flagella antigen expression in a triphasis (3 pha) serovar of Salmonella” Proceedings of the National Academy of Sciences,88 (3),pp. 956-960. Sambrook J, FritschEF.ManiatisT (1989) Molecullar Cloning, A loboratolory manual, 2nd ed, Cold Spring Harbor Laboratory Press, NY Snyder L, Champnes W (1997) Molercular genetics of Bacteriolygy, American Society for Microbiology,NY Sean DR, Robert KS, Thomas SW (1999) ”Sequence Diversity of Flagellin (fliC) Alleles in Pathogenic Escherichia coli”, Journal of Bacteriology, 181(1), pp. 153-160. Seifert HS, So M (1998) “Genetic mechanisms of bacterial antigenic variation”, Microbiological Reviews, 52, pp. 327-332. Shin-Ichi A (2000) “Flagella“, Encyclopedia of Microbiology, Academic press, UK, Vol 2, pp. 380-389. Shin-Ichi A, Tomoko K (1998) “Bacterial flagellation and cell division”, Genes to cells, (3), pp. 625-634. Stephen JM, Brad TC, Marc KJ (2002) “Characterization of CD4 + T cell responses during natural infection with Salmonella typhimurium”, Journal of Immunology, (164), pp. 986-993. Susan KH (2000) ”Vaccines, Bacterial”, Encyclopedia of Microbiology, Academic press, UK, Vol 4, pp. 767-778. Van Immerseel F, De Buck J, Pasmans F, Velge P, Botteau E, Fievez V, Haesebrouck F, Ducatelle R (2003) “Invasion of Salmonella enteritidis in avian intestial epithelia cells in vỉto is influenced by short – chain fatty acids”, Int J food micrrobiol,85(3), p. 237 – 238. Tài liệu trên internet g.htm http:/ww.emedicine.com/med/INFECTIOUS_DISEASES.htm http:www.sc.edu/library/spcoll/nathist/jenner2.html http:/www2.niaid.nih.gov/biodefense/public/images.htm

Các file đính kèm theo tài liệu này:

  • docnoi dung in.doc
  • docmuc luc.s.l4.doc
  • docphu luc 1in.doc
  • docViet tat.lvan.Hieu.sl4.doc
Luận văn liên quan