Đề tài Phát Hiện Và Đếm Coliforms Trong Nước Uống: Các Phương Pháp Hiện Thời Và Phương Pháp Tiếp Cận Nổi Bậc

Việc áp dụng FISH trong mẫu nước uống hiện nay đòi hỏi phải phát triển cao hơn nữa để đạt được việc đếm tối ưu các tế bào thiếu dinh dưỡng yếu đi. Thường coliforms được tìm thấy với số lượng nhỏ trong mẫu nước uống do đó việc điều tra ở cấp độ tế bào của tế bào mục tiêu lien quan đến việc lựa chọn. Mới đây Joux and Lebara (2000) phân tích những hạn chế về số lượng và chất lượng của công cụ phân tích huỳnh quang khác nhau (kính hiển vi huỳnh quang, flow cytometer, confocal scanning laser microscope and the new solid –phase laser scanning cytometer), Sự xuất hiện các phát hiện và thời gian thực của các phương pháp mới có lien quang đến sự cần thiết cho các chuẩn đoán đánh giá tốt hơn về chất lượng vi sinh của nước, Mục tiêu này có thể đạt được thong qua sự gia tăng trong việc phát hiện cụ thể và giảm thời gian phân tích Tuy nhiên kỹ thuật phức tạp và chi phí tương ứng cao hạn chế của mình để trở thành phương pháp chuẩn hóa cho việc phát hiện coliforms trong mẫu nước uống. Hơn nữa , với kiến thức hiện có trong công việc hiện tại ngoại trừ Delabre et al(2001) nghiên cứu, vẫn chưa chứng minh được rằng một tỷ lệ đáng kể các chỉ thị tế bào đựợc tìm thấy trong một trạng thái khả thi hoặc hoạt động nhưng không culturable trong hệ thống phân phối, Nếu đây là một trường hợp, các bước nghiên cứu tiếp theo sẽ là đánh giá khả năng tác động của các tế bào sống hoặc hoạt động nhưng không chỉ về khả năng gây bệnh, mà còn về khả năng tái sinh

doc43 trang | Chia sẻ: tienthan23 | Ngày: 18/02/2016 | Lượt xem: 2161 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Đề tài Phát Hiện Và Đếm Coliforms Trong Nước Uống: Các Phương Pháp Hiện Thời Và Phương Pháp Tiếp Cận Nổi Bậc, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
coli và đôi khi nhạy cảm hơn để phát hiện các TC. Gần đây, QuantiTray (QT) (IDEXX), mà là một phiên bản mở rộng của MPN kiểm tra Colilert (một phiên bản MPN với một số giới hạn các ống cũng đã được thương mại hóa ở giai đoạn đầu), được so sánh với các phương pháp MF, đặc biệt là mẫu nước uống, bởi Fricker et al. (1997), De Roubin et al. (1997) và Eckner (1998). Tất cả họ đều kết luận không có sự khác biệt đáng kể cho việc đếm E. coli giữa các phương pháp QT và MF, trong khi khả năng phục hồi của TC lớn hơn với kỹ thuật QT hơn so với phương pháp MF. McFeters et al. (1997a, b) tham khảo các tiêu chuẩn so sánh với các phương pháp thử nghiệm Colisure để phát hiện vi khuẩn chịu clo: với Colisure, thu hồi TC và E. coli bị tổn thương bởi clo được cải thiện hơn các phương pháp tiêu chuẩn, kết quả là một ước tính thực tế hơn vềchỉ số vi khuẩn trong nguồn cung cấp nước công cộng. Trong kết luận, kiểm tra dựa trên công nghệ bề mặt được xác định bằng cách sử dụng chất chromogenic và fluorogenic được áp dụng cho việc phát hiện và định lượng Coliform và E. coli trong nước uống. Các xét nghiệm này dễ sử dụng và cung cấp cho một ước tính nhanh hơn và thực tế hơn (đặc biệt là sự hiện diện của Clo dư) các chỉ số ô nhiễm vi khuẩn trong nước hơn so với trường hợp không có sự hiện diện cổ điển hay MTF. Những phương pháp này có thể tốn kém hơn so với phương pháp cổ điển khi sau này không cần các bước xác nhận bổ sung. Khi bước xác nhận được yêu cầu, các chi phí phát sinh trong cả hai phương pháp là tương đương. Trong mọi trường hợp, phương pháp enzyme đòi hỏi nhân lực ít hơn và do đó chi phí của họ về giá trị thương mại thấp hơn. 4.3. MF kỹ thuật liên hợp với phát hiện enzyme của vi khuẩn Dahlen và Linde (1973) đánh giá sự kết hợp của MUGlu vào môi trường thạch để phát hiện sự hiện diện của hoạt động B-D-glucuronidase (E. coli). Brenner et al. (1993) đã phát triển môi trường thạch MI, có chứa các MUGal fluorogenic và IBDG chromogenic, đồng thời phát hiện TC và E. coli trong nước. Phương pháp này đã được chứng minh là nhạy cảm, chọn lọc, cụ thể và nhanh chóng (kết quả có sẵn trong 24 h) (Brenner và cộng sự, 1996.). Gaudet et al. (1996) và Ciebin et al. (1995) liên quan MUGlu hoặc X-Glu với cổ điển m-TEC và thạch lauryl tryptose và so sánh với các phương pháp hiện đại thay đổi với các phương pháp cổ điển. Các môi trường hiện đại thay đổi môi trường thạch thường cho thấy sự phục hồi cao hơn hoặc tương tự như của TC và E. coli. Các môi trường nuôi cấy thương mại đang có sẵn để phát hiện các TC và E. coli. Chúng bao gồm các môi trường nuôi cấy môi trường thạch cổ điển được sử dụng cho E. coli và Coliform với các chất nền chromogenic và / hoặc fluorogenic cụ thể để phát hiện các B-D-glucuronidase và / hoặc B-D-galactosidase: thạch Chromocult Coliform (Merck, Darmstadt, Đức), thạch Fluo-rocult E. coli trực tiếp (Merck) và m-ColiBlue24 broth (Hach) (Grant, 1997). Việc sử dụng các phương pháp đếm đĩa, bao gồm cả chất chromogenic và / hoặc fluorogenic, cho phép nhiều hơn, nhanh chóng, dễ dàng hơn và các ước tính chính xác hơn về coliform và E.coli rất nhiều trong nước uống hơn so với việc sử dụng các phương pháp cổ điển. Chúng có thể được sử dụng bởi bất kỳ phòng thí nghiệm, có thể sử dụng phương pháp nuôi cấy truyền thống. Tuy nhiên, có nhiều tốn kém và giải quyết không thỏa đáng các vấn đề liên quan đến sự hiện diện của vi khuẩn chỉ thị không nuôi cấy. 4.4. Xác định trực tiếp hoạt tính của enzyme bằng fluorimetry Các phương pháp mô tả ở trên là dựa trên nuôi cấy để kiểm tra và vẫn thường đòi hỏi từ 18 đến 24 giờ để hoàn thành.Gần đây hơn, B-D-galactosidase và B-D-glucuronidase thuộc tính của TC và E. coli đã được khai thác trên nước ngọt (Berg và Fiksdal, 1988; George và cộng sự, 2000.)Và mẫu nước biển (Davies và cộng sự, 1995.) xét nghiệm nhanh chóng mà không cần bất kỳ bước nuôi cấy nào. George và cộng sự.(2000) hoàn thành một biên bản dựa trên nền fluorogenic MUGal và MUGlu cho một phát hiện enzyme trực tiếp của FC trong nước ngọt trong 30 phút. Những phương pháp này cho phép ước tính nhanh chóng và trực tiếp về mức độ ô nhiễm vi sinh nguồn nước mặt, nhưng giới hạn phát hiện của họ (20 CFU / 100 ml cho FC khoảng 340 CFU / ml cho 100 TC) ngăn cản việc sử dụng chúng để theo dõi nước uống. Một phân tích tự động (Colifast CA-100 (Colifast Systems, Oslo, Na Uy)) đã được phát triển trên cơ sở các thuộc tính enzyme của vi khuẩn (Ofjord et al, 1998; Berg và cộng sự, 1998.). Các mẫu được ủ (sau khi tập trung bằng cách lọc, nếu cần thiết) ở 37oC cho TC và 44oC FC trong một môi trường phát triển có chọn lọc cho coliforms và chứa MUGal. Nếu số lượng coliform trong mẫu là đủ, sự gia tăng huỳnh quang do MUGal thủy phân bởi các vi khuẩn hiện nay có thể được đo trong vòng chưa đầy 2 giờ. Nếu không, việc phát hiện một tín hiệu huỳnh quang quan trọng đòi hỏi sự phát triển của vi khuẩn trước. Việc phát hiện một môi trường nuôi cấy TC mất khoảng 11 giờ.Phương pháp này là như vậy, một quyết định trực tiếp của các hoạt động enzyme cho mẫu với coliform cao (nước mặt) và liên quan đến một giai đoạn tăng trưởng cho các mẫu với coliform thấp (nước uống). Các thử nghiệm Coli nhanh thường khuyến khích nhiều hơn cho nước tắm, và tiếp tục phân tích được thực hiện trong nước uống với phân tích này và các phương pháp khác vẫn được yêu cầu nếu kết luận được rút ra. Tuy nhiên, kể từ khi phân tích nước uống với các phân tích Coli nhanh đòi hỏi một giai đoạn tăng trưởng, hệ thống này sẽ không thể phát hiện vi khuẩn không nuôi cấy. 4.5. Phát hiện vi khuẩn bằng phương pháp sử dụng enzyme đếm tế bào pha rắn Chỉ tiêu đáng kể gần đây đã tập trung vào sự phát triển của phương pháp enzyme nhanh chóng áp dụng cho nước uống với mục tiêu đạt kết quả trong lịch trình một ngày làm việc của Văn Poucke và Nelis (1999) đánh giá phát hiện công cụ tín hiệu huỳnh quang để giảm thời gian phân tích của một màng enzyme kiểm tra lọc. Họ đã sử dụng một thiết bị quét laser (ScanRDI1-Chemunex, Ivry-sur-Seine, Paris, Pháp) trong đó phát hiện và liệt kê số lượng thấp của các tế bào huỳnh quang được kí hiệu bằng một kĩ thuật đếm tế bòa pha rắn (Brails-ford, 1996). Hệ thống này cung cấp một giới hạn phát hiện định lượng trực tiếp rất thấp cho phép phát hiện từ 1 đến 1000 tế bào có kí hiệu huỳnh quang phân phối trên màng. Sử dụng hệ thống này, Văn Poucke và Nelis (1999b) đề xuất một thử nghiệm cho phép phát hiện vi khuẩn E. coli và TC trong khoảng 3.5 h, về nguyên tắc cũng bao gồm các tế bào trao đổi chất hoạt động nhưng không nuôi cấy. Nguyên tắc của phương pháp cho các tế bào vi khuẩn E. coli như sau (Văn Poucke và Nelis, 1999b, 2000a): E. coli hiện diện trong mẫu nước uống được giữ lại trên một bộ lọc 0.4mm sau khi lọc chân không. Các tế bào E. coli bị mắc kẹt được điều trị bằng hóa chất để tạo ra các enzyme B-D-glucuronidase (3 giờ ở 37oC) và có kí hiệu (0,5 giờ ở0oC) các tế bào gây ra. Chỉ có B-D-glucuronidase của E. coli có thể được gây ra và do đó chỉ những vi khuẩn tách các chất nền không huỳnh quang (fluorescein-di-B-D-glucuro-nide), giữ lại huỳnh quang sản phẩm cuối cùng bên trong tế bào. Sự phát huỳnh quang của một tế bào đơn lẻ hoặc một khuẩn lạc nhỏ (mà có khả năng phát huỳnh quang) được phát hiện bởi các thiết bị ScanRDI1: quét laser qua màng cho phép đếm số tế bào huỳnh quang trong 3 phút. Một xác nhận hình ảnh của phát huỳnh quang được thực hiện bằng cách chuyển màng đến một kính hiển viepi-fluorescence được gắn với một giai đoạn cơ giới hóa được điều khiển bởi phần mềm ScanRDI1. Quy trình phát hiện các TC là tương tự, nhưng fluorescein-di-B-D-galactoside được sử dụng như là chất nền, cho phép phát hiện các B-D galactosidase (Văn Poucke và Nelis, 2000b). Áp dụng các phương pháp đề xuất cho E. coli và TC ô nhiễm một cách tự nhiên và nước giếng bị ô nhiễm, nước mặt và khai thác các mẫu nước đã chỉ ra hơn 90% vi khuẩn E. coli và hơn 92% lượng TC và tương đương với phương pháp tham khảo bao gồm thạch MFC (E. coli), thạch m-Endo (TC) và thạch Chromocult Coliform (E. coli và TC) (Văn Poucke và Nelis, 1999a, b, 2000a, b). Tính so với trung bình thứ hai, tỷ lệ âm tính giả là 3% đối với E. coli và 3,2% cho TC. Trong một số lượng hạn chế của mẫu, số lượng thấp (1 -3) của các sinh vật mục tiêu đã được phát hiện bằng cách quét laser và không phải bởi số lượng đĩa thông thường. Nếu những kết quả này được xác nhận trong tương lai, phương pháp này chắc chắn sẽ được quan tâm do thời gian ngắn cần thiết để phân tích một mẫu nước. 4.6. Kết luận về phương pháp enzyme Bổ sung chất fluorogenic và chromogenic vào môi trường nuôi cấy (agar và môi trường lỏng) để phát hiện hoạt động enzyme của TC và E. coli đã tăng độ nhạy và tốc độ nhanh chóng hơn các phương pháp cổ điển để ước lượng vi sinh vật trong nước uống. Mặc dù một số các xét nghiệm này có thể phát hiện vi khuẩn bịtổn thương, nhưng chúng không phù hợp để giải quyết vấn đề của việc phát hiện các tế bào không nuôi cấy.Việc phát hiện vi khuẩn huỳnh quang của đếm tế bào pha rắn là một cách đáng quan tâm để giảm lượng thời gian cần thiết đểđạt được kết quả, nhưng phương pháp này đòi hỏi một tế bào kế pha rắn. 5. Phương Pháp Phân Tử Phương pháp phân tử đã được phát triển để tăng nhanh chóng tốc độ của phân tích. Phương pháp nàycó thể đạt được một mức độ cao của độ nhạy và độ đặc hiệu mà không cần một canh tác phức tạp và bổ sung thêm các bước xác nhận. Do đó, những phương pháp này cho phép phát hiện các vi khuẩn có( khả năng và/ hoặc không nuôi cấy) cụ thể trong vòng vài giờ, thay vì vài ngày vớiyêu cầu các phương pháp truyền thống. Một số phương pháp phân tử áp dụng cho việc phát hiện cụ thể của Coliform trong nước và nước uống sẽ được thảo luận ở đây. 5.1. Phương pháp miễn dịch Phương pháp miễn dịch dựa trên ghi nhận cụ thể giữa kháng thể và kháng nguyên và các mối quan hệ cao, đó là đặc trưng của phản ứng công nhận này. Tùy thuộc vào mức độ phân loại các kháng nguyên mục tiêu, phương pháp miễn dịch cho phép phát hiện các kháng nguyên ở phân loài, chi, loài hoặc mức type huyết thanh. Có hai loại kháng thể có thể được sản xuất: kháng thể đơn dòng và đa dòng, nào là cụ thể hơn để các sinh vật mục tiêu. Các đặc tính của phức kháng nguyên - kháng thể có thể được sử dụng: Để thực hiện một miễn dịch bắt cặp( immunocapture) của các tế bào hoặc các kháng nguyên bởi liên kết enzyme xét nghiệm miễn dịch (IMS hoặc ELISA), hoặc Để phát hiện các tế bào mục tiêu của thử nghiệm miễn dịch huỳnh quang (IFA) hoặc miễn dịch enzyme khảo nghiệm (IEA). Hơn 10 năm qua, phương pháp miễn dịch đã được nỗ lực thực hiện để sử dụng để phát hiện các chỉ tiêu chất lượng nước trong nước uống.Obst et al. (1989) đã phát triển một phương pháp ELISA sử dụng kháng thể đơn dòng chống lại các kháng nguyên enterobacterial chung (ECA), mộtloạilipopolysaccharide , được liên kết trong màng ngoài của Enterobacteriaceae. Phương pháp này không đủ nhạy , tuy nhiên, do đónuôi cấy mẫu trước trong một canh chọn lọc trong 24 giờ là cần thiết để định giới hạn phát hiện của phương pháp ELISA (100.000 tế bào / ml) có thể đạt được. Hubner et al. (1992) tìm ra ELISA với kháng thể đơn dòng ECA để phát hiện thường xuyên của Enterobacteriaceae và cho thấy một mức độ tương tự 98% với phương pháp tiêu chuẩnTC (lên men nhiều ống). Levasseur et al. (1992) đã phân tích thấu đáo tính đặc hiệu của kháng thể đơn dòng ECA sau khi sàng lọc 259 chủng Enterobacteriaceae và 125 vi khuẩn Gram âm khác. Họ phát hiện ra phản ứng chéo (cross-reactivity) với những nhóm khác, chủng khác nhau của AeroMonas, đó là đối thủ cạnh tranh quan trọng để vi khuẩn Coliform phát triển trên môi trường nuôi cấy m-Endo .Phản ứng dương tính giảcùng đã được báo cáo bởi Hubner et al. (1992), người đã đề cập đến phản ứng chéo với một số vi khuẩn Gram âm(Pseudomonas và Aeromomas) và vi khuẩn Gram dương(Bacillus) , khi kháng thể đơn dòng ECA được sử dụng để phát hiện Enterobacteriaceae. ELISA là một thử nghiệm nhanh chóng, đơn giản và khá nhạy cảm, cho phép phát hiện ít hơn 10 -9 g protein kháng nguyên (Stryer, 1988). Tuy nhiên, khảo nghiệm có giới thường phụthuộc vào tính đặc hiệu của kháng thể được sử dụng, nồng độ của cả hai kháng thể và kháng nguyên và các loại dung dịch phản ứng được sử dụng.Ngoài ra, chất nền mẫuthường dẫn đến liên kết không đặc hiệu của kháng nguyên hoặc kháng thể thứ hai (Kfir và Genthe, 1993). Phương pháp này rất hữu ích để kiểm tra kháng thể đơn dòng hoặc phát hiện vi sinh vật tăng vọt. Tuy nhiên, ứng dụng của nó để phát hiện các tế bào cụ thể từ một mẫu bị ô nhiễm tự nhiên bị giới hạn (Hanai et al, 1997.).Mức độ của các đặc trưng của phương pháp ELISA có thể can thiệpmức độ cao của hệ vi và thợ lặn tài liệu không có mục tiêu liên quan đến mẫu . Khảo nghiệm miễn dịch huỳnh quang cho phép xác định và đếm một tế bào cụ thể duy nhất trong một mẫu tự nhiên (Campbell, 1993).Xét nghiệm có thể được thực hiện bằng cách trực tiếp hoặc gián tiếp .Trong phương pháp miễn dịch huỳnh quang trực tiếp, các kháng thể đặc biệt là liên hợp trực tiếp với một fluorochrome.Phương pháp gián tiếp liên quan đến sự liên kết của các kháng thể chính cụ thể đối với kháng nguyên mục tiêu tiếp theo là việc bổ sung một kháng thể được đánh dấu fluorochrome trực tiếp chống lại các kháng thể đầu tiên. Ưu điểm của cách làm này là các kháng thể thứ cấp có thể dễ dàng được lấy từ một nhà cung cấp thương mại với một loạt các fluorochromes liên hợp (Hoff, 1993). Phương pháp xác định huỳnh quang tế bào nhanh chóng có thể đạt được bằng cách sử dụng kính hiển vi epifluorescence hoặc pha rắn đếm tế bào sau khi lọc của mẫu nước, hoặc bởi dòng cytometry. Zaccone et al. (1995) áp dụng một xét nghiệm miễn dịch huỳnh quang trực tiếp trên màng cho việc đánh giá ô nhiễm phân trong các mẫu từ vùng nước ven biển và hồ. Họ so sánh FC phục hồi efficien- các chính IFA đạt được bằng cách epifluorescence kính hiển vi và phương pháp MF và cho thấy cao hơn IFA CFU tính 2 bậc độ lớn. Tuy nhiên, họ đã báo cáo sự tồn tại của một ngưỡng dưới đây mà các phương pháp IFA không thể được áp dụng (khi vi khuẩn cụ thể là dưới 1% tổng dân số) và chủ yếu liên quan đến các hạt can thiệp nội dung, khi khối lượng lớn được lọc. Trong khi IFA cho phép xác định cụ thể và phát hiện ở mức độ đơn bào, nó không cung cấp những thông tin về tình trạng sinh lý của tế bào, hoặc cho dù Vi sinh vật đang sống hay đã chết. Một sáng tạo xét nghiệmmiễn dịch huỳnh quang được phát triển bởi Rockabrand et al. (1999), trong đó xác định tình trạng sinh lý của tế bào bằng proteinđịnh hình trong giai đoạntăng trưởng cụ thể. Sự khác biệt của giai đoạn phát triển coliform được dựa trên sự hiện diện của baprotein nội bào( protein cytosolic): DnaK, một loại protein trao đổi chất ổn định; Dps, một protein quan trọng trong phaổn định hoặc các tế bào không tạm nghỉ ,Dpstương quan nghịch với tốc độ tăng trưởng; và Fis, mà đóng một vai trò quan trọng trong việc điều phối tổng hợp rRNA với tăng trưởng. Định lượng protein nộibào( cytosolicprotein)được thực hiện bằng cách sử dụng Enterobacteria fluorochrome nhãn kháng thể đơn dòng (kháng DnaK, kháng Dps và kháng Fis). Các đặc trưng của kháng thể thử nghiệm đã được kiểm tra bằng cách so sánh kết quả với những người thu được từ thử nghiệm 16S rRNA cụ thể với Enterobacteriaceae (Mittelman et al, 1997.) Trên các môi trườngthuần túy của sáu Enterobacteriaceae và một thành viên khác của phân gamma của lớp con Proteobacteria. Đồng thời thăm dò các mẫu nước thải với các kháng thể và DnaKOligonucleotide 16S rRNA cho thấy cả phương phápđã cho kết quả tương tự. Theo hiểu biết của chúng tôi, những kháng thể đặc hiệu chưa được áp dụng để phát hiện các vi khuẩn trong nước uống. Hạn chế chính của phương pháp miễn dịch áp dụng cho giám sát chất lượng nước uống được liên hệ với số lượng rất thấp của các tế bào mục tiêu trong các mẫu. Phân tích thực hiện trên số lượng lớn các mẫu nước lọc có giới hạn, tùy thuộc vào dung tích(Faude và Hofle năm 1997; Hanai và cộng sự, 1997). Tuy nhiên,Định lượngcác tế bào cụ thể pha loãng có thể thu được bằng phương pháp tách immunomagnetic (IMS, Dynal). Phương pháp này sử dụng hạt từ tính được phủ các kháng thể đơn dòng hoặc đa giá, làm cho nó có thể làm giảm nền mẫu liên quan đến bằng cách lọc và tập trung các tế bào mục tiêu. Mặc dù phương pháp IMS đã được áp dụng rộng rãi để phát hiện số lượng thấp của các tế bào từ các mẫu thực phẩm (Peng và Shelef năm 1999; Mansfield và Forsythe, 2000), một vài nghiên cứu báo cáo như thế nào nó thực hiện trên mẫu nước uống. Gần đây, Pyle et al. (1999) đề xuất một sự kết hợp của IMS và giai đoạn solid- tia laser đếm tế bào cho một phát hiện nhạy cảm của vi khuẩn E. coli O157: H7 tăng vọt trong nước.bước Làm sạch và côđặc đã được thực hiện bằng cách sử dụng hạt supermagnetic phủ chống O157 huyết thanh thỏ và một tách từ tính, làm cho nó có thể loại bỏ các tế bào cố định trên hạt từ mẫu. Họ đã thực hiện phân tích khác nhau trên các tế bào loại bỏ, chẳng hạn như địnhlượng các tế bào nuôi cấy và các tế bào hô hấp . Tế bào nuôi cấyđược liệt kê bởi MF và xác định bởi một phương pháp IFA trực tiếp kết hợp với phát hiện ScanRDI1. Phương pháp tiếp cận nhiều giai đoạn này áp dụng trên mẫu nước nhọn cho thấy một mức độ cao hơn của sự nhạy cảm hơn so với phương pháp dựa trên nuôi cấy Việc sử dụng các phương pháp miễn dịch cho việc pháthiện vi sinh vật cụ thể là một kỹ thuật nhanh chóng và đơn giản, độ chính xác trong đó chủ yếu là phụ thuộc vào đặc trưng của kháng thể (Kfir và Genthe, 1993). Một cách để tăng độ đặc hiệu là lựa chọn kháng thể đơn dòng có độ cụ thể trong tương táclại một epitope cụ thể. Tuy nhiên, kể từ khi một epitope có thể có mặt trong hơn một thuốc kháng nguyên, một thử nghiệm đặc hiệu nghiêm ngặt của các kháng thể đơn dòng tổng hợp với các chủng vi khuẩn liên quan chặt chẽ và xa phải đi trước thường xuyên các mẫu môi trường. Nhiều khả năng do cho vấn đề này có phản ứng chéo với các chủng vi khuẩn khác, việc sử dụng các phương pháp miễn dịch để phát hiện E.coli và coliforms vẫn chưa thành công. Hơn nữa, ở kiến thức của chúng tôi, các kháng thể thực để chống lại tất cả các chủng môi trường của vi khuẩn E. coli không tồn tại vào thời điểm này. Việc áp dụng các kháng thể đơn dòng để phát hiện các sinh vật cụ thể trong một môi trường tự nhiên, đặc biệt là các vi khuẩn trong nước uống, có thể cần điều tra phức tạp hơn hướng về kháng thể đặc hiệu và sự phong phú của vi khuẩn trong một mẫu nước uống. Bởi vì kháng thể đơn dòng có khoảng đặc trưng giống như các đầu dò oligonucleotide 16S rRNA và vì sự saûn của họ là nhiều hơn mất thời gian, không có lợi thế để sử dụng phương pháp miễn dịch huỳnh quang trong phương pháp lai tại chỗ (FISH) (xem phần sau). Một trong những lợi ích FISH sẽ đạtđược trong việc sử dụng của một kháng thể như chống Fis (Rockabrand et al., 1999) sẽ phân biệt tình trạng sinh lý của vi khuẩn được phát hiện trong mẫu nước. 5.2. Phương pháp dựa trên axit nucleic Hầu hết các phương pháp sử dụng acid nucleic tính lai phân tử, trong đó có việc công nhận trình tự bổ trợ giữa thực nghiệmnucleic và một mục tiêu nucleic.thăm dò và mục tiêu nucleic. Một phản ứng lai có thể được thực hiện giữa một tàu thăm dò nucleic DNA và một chuỗi DNA chromosomic (DNA - DNA hybrid- hóa) hoặc một rRNA hay tRNA tự (DNA - RNA lai). Đặc hiệu, ở đây, phụ thuộc vào mức độ - bảo tồn các mục tiêu trong nhóm mục tiêu phân loại. Những phương pháp này cung cấp thông tin phân loại ở các cấp độ khác nhau, chẳng hạn như các lớp học, chi, loài hoặc phân loài. Một số trong số họ có thể được thực hiện mà không cần một bước canh tác phức tạp, do đó cho phép phát hiện các vi khuẩn cụ thể trong vòng vài giờ, thay vì vài ngày cần thiết với các phương pháp canh tác dựa trên. Các phương pháp dựa trên nucleic acid thường xuyên hơn là sử dụng phản ứng chuỗi polymerase (PCR) và các phương pháp lai tại chỗ (ISH). Đánh giá hiệu suất của họ trong việc phát hiện vi khuẩn trong các mẫu nước uống được thảo luận dưới đây. 5.2.1. Phương pháp phản ứng chuỗi polymerase PCR cho phép một đoạn DNA mục tiêu được khuếch đại bằng cách sao chép vòng (cycling replication). Sao chép này, có thể được thực hiện trong ống nghiệm(in vitro) hoặc tại chỗ(in situ), ​​bao gồm một chuỗi phản ứng xúc tác bởi một DNA polymerase (Taq polymerase) và sử dụng các mồi oligonucleotidic. Đặc hiệu phát hiện phụ thuộc vào mức độ tương đồng và bổ sung giữa mục tiêu và mồi và nhiệt độ lai (hybridization temperature). Các vòng sao chép của PCR là kết quả trong một khuếch đại theo cấp số nhân của số lượng các chuỗi mục tiêu và làm tăng đáng kể khả năng phát hiện một chuỗi hiếm hoặc số tương đối thấp của các vi sinh vật mục tiêu trong một mẫu (Bej et al, 1990;.. Waage và cộng sự, 1999a , b;. Burtscher et al, 1999). Phương pháp PCRthường được áy dụng cho việc phát hiện và xác định các vi khuẩn bao gồm một sao chép vòng sau bước tách chiết DNA trong ống nghiệm (in vitro). Khuếch đại được thực hiện trên hàm lượng axit nucleic thu được bằng một ly giải tế bào theo sau là một chiết xuất hóa học. Các bước chiết táchcó thể được thực hiện trên màng lọc để giữ lại tế bào vi khuẩn(Bej và cộng sự, 1991a;. Juck và cộng sự, 1996;..Iqbal và cộng sự, năm 1997; Tsen et al., 1998). Quá trình khuếch đại PCR bao gồm: (i) một biến tính DNA từ mạch đôi- để DNA chuỗi đơn, (ii) mồi ủ với DNA sợi đơn ở nhiệt độ lai cụ thể, và (iii) mở rộng lót bởi một DNA polymerase Taq. Khuếch đại của một chuỗi bằng phương pháp PCR thường đòi hỏi 20 đến 40 chu kỳ. Sản phẩm PCR được phát hiện sau khi điện di trên gel agarose và sau khi nhuộm các sản phẩm khuếch đại bởi một loại thuốc nhuộm fluorochrome hoặc lai với một đầu dò được gắn nhãn. Phương pháp PCR thường được mô tả để phát hiện và xác định các vi sinh vật trong thực phẩm, đất, trầm tích và nước. Nếu chi tiết cols nguyên thủy cho việc sử dụng PCR trên ples thực sam- môi trường đã có sẵn trong nhiều năm (Trevors và van Elsas, 1995), áp dụng phương pháp này để xác định các vi sinh vật trong nước uống là gần đây. Một số thử nghiệm đã được phát triển để phát hiện các tổng coliform (total coliform) TC, coliform phân (faeacl coliform) FC (E. coli và vi sinh vật có liên quan) và tác nhân gây bệnh bao gồm cả vi khuẩn Salmonella spp. (Bảng 2). Đối với vi khuẩn, phát triển đoạn mồi đã gặp khó khăn kể từ khi nhóm coliform, theo quy định của ngành công nghiệp nước, là một nhóm đa dạng, bao gồm nhiều chi và loại trừ một số được liên kết chặt chẽ. Kết quả là, mồi phải đủ cụ thể mà họ không phát hiện chặt chẽ phylogenetically không liên quan đến vi khuẩn. Mồi dựa trên gen lacZ đã được sử dụng để phát hiện các vi khuẩn bởi vì phương pháp giám sát coliform thường được dựa trên các sản phẩm biểu thức (b-galactosidase) của gen này (Bej et al, 1990, 1991a, b;.Fricker và Fricker, 1994). Sản phẩm PCR của các kích cỡ khác nhau (326 và 264 bp) được tạo ra bằng cách sử dụng cặp mồi khác nhau và kết quả là phát hiện của TC với số lượng nhỏ như tế bào 1/100 ml sử dụng đầu dò gen đánh dấu phóng xạ (Bej et al., 1990, 1991a). Fricker và Fricker (1994) đã nghiên cứu đặc trưng của mồi cùng thiết lập như Bej et al. (1991a) trên 324 chủng trực khuẩn nuôi cấy. Họ kết luận rằng một bộ mồi nên được phát triển từ mức dựa vào gen lacZ không cho phép phân biệt đối xử của một số chủng odorifera Hafnia alvei và Serratia. Để phát hiện cụ thể của vi khuẩn E. coli, một vùng của gen malB này mã hóa một protein vận chuyển maltose là chuỗi mục tiêu đầu tiên đề xuất (Bej et al., 1990). Khu vực này bao gồm các gen mà thịt cừu mã hóa một protein bề mặt được công nhận bởi một E. coli- vi khuẩn cụ thể. Tuy nhiên, các thành viên của Shigella và Salmonella chi cũng có thể được phát hiện bằng cách sử dụng bộ mồi này. Việc sử dụng các gen uidA sau đó đã được đề xuất để phát hiện vi khuẩn E. coli (Bej et al., 1991a, b; Tsai và cộng sự., 1993). Cả hai khu vực quy định (uidR) và gen mã hóa các uidA dase BD-glucuroni- (GUD) enzyme được sử dụng sau đó có Một khu vực Amplified chi tiết: gen lacZ: mã hóa cho enzym b-galactosidase; gen cừu: mã hóa cho một protein bề mặt được công nhận cụ thể do vi khuẩn E. coli lambda; gen uidA: mã hóa cho enzym BD-glucuronidase; gen uidR: mã hóa cho khu vực quản lý của uidA; gen phoE: mã hóa cho một protein màng ngoài lỗ rỗng hình thành. Thành công (Fricker và Fricker, 1994;. Juck và cộng sự, 1996;.Iqbal và cộng sự, 1997). Các cặp mồi được cụ thể cho E. coli và Shigella spp. Bej et al. (1991b) đã báo cáo độ nhạy tốt hơn của phương pháp PCR so với các bài kiểm tra bề mặt được xác định dựa MUG-. Nhiều chủng E. coli MUG âm, trong đó bao gồm các E. coli gây bệnh của type huyết thanh O157: H7, đã được phát hiện sau khi PCR cation amplifi- của gen uidA. Hơn nữa, Phong et al. (1991) đã chỉ ra rằng nhiều chủng MUG âm có gen uidA ngay cả khi sản phẩm gen (enzyme b-D-glucuronidase) không được thể hiện. Cặp mồi khác được thiết kế cho hai khu vực khác nhau đã được đề xuất để phát hiện vi khuẩn E. coli, một trong số họ mã hóa cho một protein bên ngoài màng (gen phoE) (Spierings et al., 1993) và một trình tự DNA mã hóa cho các vùng V3 và V6 của gen 16S rRNA của bệnh và chủng không gây bệnh của vi khuẩn E. coli (Tsen et al., 1998). Những cặp mồi cho phép phát hiện cụ thể của vi khuẩn E. coli, mà còn của các loài vi khuẩn Shigella khi các trình tự đề nghị được khuếch đại. Để tăng tính đặc hiệu của việc phát hiện bằng phương pháp PCR, một số tác giả đã đề xuất việc sử dụng các phản ứng multiplex PCR, trong đó bao gồm đồng thời khuếch đại đoạn DNA khác nhau. Bej et al. (1991b) sửa đổi phương pháp này để phát hiện các trình tự gen liên quan đến nhóm TC và những người liên quan đến tác nhân gây bệnh đường ruột như E. coli, Salmonella spp. và Shigella spp. Multiplex PCR có thể không hoạt động tốt với tất cả các hỗn hợp mồi, tuy nhiên. Thành phần và chiều dài của pri- mer oligonucleotide, cũng như kích thước của các mảnh vỡ AMPLI-fied, có thể ảnh hưởng lẫn khuếch đại PCR. Ví dụ, khuếch đại multiplex của TC và E. coli được thực hiện bằng nồng độ cân bằng các mồi cả, trong khi nồng độ mồi đẳng phân tử không cần thiết cho việc phát hiện đồng thời Legion- viêm phổi Ella và tất cả các vi khuẩn thuộc chi (Bej et al., 1991a). Để phát hiện các mức thấp của tác nhân gây bệnh hoặc vi sinh vật chỉ thị trong các mẫu nước, một bước tập trung như lọc trước tiên phải được thực hiện. Bej et al. (1991a) báo cáo sử dụng phương pháp lọc và phát hành bởi DNA đóng băng - tan băng đi xe đạp mà không ảnh hưởng đến sự khuếch đại PCR. Khi trực quan của sản phẩm PCR được thực hiện bằng cách sử dụng lai tạo với các đầu dò phóng xạ, phương pháp này cho phép một giới hạn phát hiện lên đến 1 tế bào / 100 ml. Tuy nhiên, việc áp dụng phương pháp này để theo dõi thường xuyên có thể là khó vì trực quan của sản phẩm bởi hóa hybrid- với một đầu dò phóng xạ có thể yêu cầu 2-3 ngày kể từ khi phơi nhiễm. Hệ thống phát hiện không phóng xạ, giống như mồi biotinylated, có thể là một thay thế hữu ích cho nhiều phát hiện nhanh chóng của DNA mục tiêu thăm dò lai. Juck et al. (1996) đã phát triển một giao thức để phát hiện nhanh chóng nồng độ thấp của E. coli trong các mẫu nước dựa trên giao thức PCR lồng nhau và sự thay đổi của giao thức lọc bằng Bej et al. (1991a). Nested PCR bao gồm hai vòng utive consec- khuếch đại PCR. Việc chạy đầu tiên được thực hiện như bình thường, với mồi ủ với các khu vực mục tiêu cụ thể (mẫu) tiếp theo là phần mở rộng cho sion mồi. Vòng thứ hai sử dụng các sản phẩm của sự khuếch đại đầu tiên làm mẫu cho một vòng của ủ và mở rộng với sơn lót khác nhau Người ta thường liên minh sản phẩm của các kết quả khuếch đại thứ hai trong một mảnh đó là nội bộ để sản phẩm của vòng đầu tiên của khuếch đại PCR. Nested PCR tăng hiệu quả khuếch đại từ các cấp địa phương phát hiện sản phẩm PCR tạo ra trong vòng đầu tiên được khuếch đại để đạt được mức độ phát hiện ở vòng thứ hai.Việc sử dụng các đoạn mồi lồng nhau cung cấp một cấp độ quốc Ngoaøi tính cụ thể kể từ vòng PCR thứ hai chỉ có thể được thực hiện nếu đúng trình tự (plementary đồng để mồi bên trong) được khuếch đại trong vòng đầu tiên. Giao thức Nested PCR được sử dụng để phát hiện vi khuẩn E. coli (Juck et al, 1996.) Và một số tác nhân gây bệnh (Delabre et al, 1997.)Trong nước uống, trong khi Waage et al. (1999a, b) áp dụng chúng vào việc phát hiện số lượng thấp của Salmonella spp. và Y. enterocolitica tế bào ở vùng biển.Kỹ thuật này cho phép phát hiện một nhanh hơn (6-8 h) so với PCR thông thường (vài ngày), kể từ khi xác nhận của chuỗi khuếch đại chính xác bằng đầu dò lai là không còn cần thiết. Mặc dù độ nhạy cảm của mình, rất khó để sử dụng PCR để xác định số lượng vi sinh vật. Hai kỹ thuật chủ yếu được phát triển cho DNA định lượng bằng phương pháp PCR: (. Toranzos et al, 1993) các đại nhất có thể xảy ra, số lượng PCR và PCR cạnh tranh (thêm một đối thủ cạnh tranh cho giai đoạn DNA PCR để hiệu chỉnh hiệu quả PCR) (Zachar et al., 1993).Để kiến thức của chúng tôi, các kỹ thuật này chưa được áp dụng từ trước đến nay cho các định lượng coliform trong nước uống.Như vậy, hiện nay, nó dường như không thể định lượng mật độ coliform trong nước uống bằng phương pháp PCR.Cho đến nay, MPN-PCR vẫn không chính xác và PCR cạnh tranh đòi hỏi sự prepara- đáng kể trước đối thủ cạnh tranh DNA tốt được áp dụng cho các mẫu nước. Một cách tiếp cận đầy hứa hẹn là thời gian thực tích định lượng PCR, trong đó bao gồm giám sát các sản phẩm fluores- cently PCR khi chúng được khuếch đại (Heid et al., 1996). Động học của sản phẩm PCR là một giai đoạn tích lũy theo cấp số nhân theo sau là một giai đoạn cao nguyên. Sự xuất hiện của cao nguyên này phụ thuộc vào nhiều thông số soát không kiểm soát, chẳng hạn như dimerization mồi và sự xuất hiện của các chất ức chế. Cation thời gian thực quantifi- là đáng tin cậy hơn so với điểm cuối xác định số lượng vì các phép đo được thực hiện trong giai đoạn theo cấp số nhân. Nó cũng có thể phát hiện các vấn đề ition inhib- của phản ứng PCR do các chất ức chế đồng tinh khiết với DNA. Cách tiếp cận này gần đây đã được áp dụng cho việc phát hiện và enterohemorhagic enterotoxigenic E. coli chủng vi sinh lâm sàng (Bellin et al, 2001;. Carroll và cộng sự, 2001.). Khi sản phẩm PCR khuếch đại được nhuộm với thuốc nhuộm SYBR Green, sử dụng một LightCycler (Roche, Mannheim, Ger- nhiều) hoặc một GeneAmp (Applied Biosystems, Foster City, Mỹ), phương pháp PCR thời gian thực hiện nhanh chóng hơn và độ nhạy cao hơn và độ đặc hiệu trong sự so sánh với các xét nghiệm PCR song với phân tích gel truyền thống (Carroll et al., 2001). Tuy nhiên, phương pháp này chưa được áp dụng rộng rãi để phát hiện cụ thể của vi sinh vật hiện nay nồng độ thấp trong các mẫu môi trường, nhưng có thể được phát triển trong tương lai. Gần đây hơn, Tani et al. (1998) đã đề xuất một điều tra trực tiếp các tế bào mục tiêu bằng cách sử dụng trực tiếp trong xét nghiệm PCR tại chỗ. Sự khuếch đại của một trình tự cụ thể được thực hiện từ một gen đơn bản sao hiện diện trong các tế bào. Các giao thức PCR thông thường phải được sửa đổi để trình tự axit nucleic có thể được khuếch đại trong cơ thể. Với cố định và permeabilization những điều kiện thích hợp, mồi oligonucleotide và các thành phần phản ứng khác có thể khuếch tán vào các tế bào, và khi đi xe đạp nhiệt, khuếch đại trình tự mục tiêu cụ thể. Sản phẩm PCR được dán nhãn bởi digoxigenin-UTP (DIG- dUTP), và các mảnh vỡ chống DIG Fab 'liên hợp với thuốc nhuộm huỳnh quang được sử dụng để phát hiện bằng kính hiển vi huỳnh quang epifluores-. Cách tiếp cận này cho phép nhìn thấy trực tiếp các sản phẩm khuếch đại huỳnh quang ở một mức độ đơn bào và do đó một điều tra trực tiếp có thể được dán nhãn của các tế bào. Các tác giả đã áp dụng phương pháp PCR mới này với sự enumera- trực tiếp của E. coli từ mẫu nước ngọt.Kết quả cho thấy một tín hiệu cường độ huỳnh quang yếu của các tế bào mục tiêu.Tuy nhiên, họ kết luận rằng phân tích hình ảnh cho phép một điều tra trực tiếp các tế bào mục tiêu E. coli. Mặc dù trong giao thức PCR chỗ dường như ing promis-, nó đã không được sử dụng cho việc phát hiện thường xuyên và đếm số vi sinh vật trong nước. Nhiều hạn chế liên quan đến các đặc điểm kỹ AMPLI-PCR của DNA cần phải được giải quyết trước khi phương pháp này có thể được sử dụng để phân tích nhạy cảm của vi khuẩn trong mẫu nước uống. Mặc dù phương pháp này đã được sử dụng với một số thành công để phát hiện E.coli và coliforms, cần phải chỉ ra rằng hầu hết các nghiên cứu được thực hiện trên mẫu nước tăng vọt với các chủng nuôi cấy vi khuẩn (Bảng 2) và xác nhận là hiếm khi, hoặc không, được thực hiện trên các mẫu môi trường. Mặc dù thực tế là PCR được công nhận là một phát hiện và xác định phương pháp rất cụ thể, nó có thể trình bày một số hạn chế khi áp dụng cho việc phát hiện các tế bào trong một mẫu tự nhiên là khả thi hoặc trao đổi chất hoạt động mà không bị culturable. Thật vậy, khuếch đại PCR áp dụng đối với acid nucleic chiết xuất từ ​​tế bào sống và culturable, khả thi và không culturable hay đã chết. Do đó, xét nghiệm PCR không thể cung cấp thông tin về tình trạng sinh lý của tế bào mục tiêu. Một hạn chế cố hữu để phân tích PCR các mẫu môi trường là ức chế thường xuyên của các phản ứng enzym: Các chất humic được gọi là (ASE Taq-polymer-) enzyme trùng hợp chất ức chế, và chất keo có ái lực cao với DNA (Way và cộng sự, 1993. ). Sự hiện diện của các yếu tố này trong một mẫu nước do đó có thể đáng kể giảm năng suất khuếch đại PCR được áp dụng để phát hiện các vi khuẩn pha loãng rất nhiều. Họ cũng có thể hạn chế việc tiết lộ các sản phẩm khuếch đại (Straub et al., 1995). 5.2.2. Kỹ thuật lai in situ (In situ hybridization techniques) ISH sử dụng đầu dò oligonucleotide để phát hiệnchuỗi axit nucleic bổsung. Phương pháp này khai thác khả năng của axit nucleic để bám với nhau một cách bổ sung rất cụ thể để tạo giống lai. Các đầu dò được cụ thể bởi vì chúng được xây dựng từ, và được bổ sung vào, chọn nucleic acid chuỗi đó là duy nhất để đưa ra một vi sinh vật, các loài hoặc nhóm. Các đầu dò có thể nhắm mục tiêu hoặc là ADN hoặc các phân tử RNA. Sử dụng trình tự rRNA (5S, 16S và 23S) để nghiên cứu các mối quan hệ phát sinh loài trên cơ sở của sự phân kỳ của họ và để phát triển thiết bị thăm dò lai rất quyết tâm, bây giờ cũng được thành lập (Amann et al, 1995.). Trình tự của hơn 2500 của rRNA 16S loài vi khuẩn hiện trao các gen có giá trị thông tin rất cao ở một mức độ phát sinh loài. So sánh trình tự làm cho nó có thể để xác định các khu vực mục tiêu được bảo tồn hoàn hảo trong mức độ phân loại khác nhau và do đó cụ thể để các cấp, từ các tên miền để phân loài. Cũng quan tâm trong mục tiêu phân tử rRNA là mức cao của các phân tử rRNA bản, đó là lần lượt liên kết với số lượng lớn các ribosome trong tế bào. Số lượng ribosome khác nhau, thường từ 103 đến 105 trên vi khuẩn, theo các loài và trạng thái logic physio- của các tế bào, và được trực tiếp tương quan với tốc độ tăng trưởng của tế bào (Amann et al., 1995). Đầu dòcụ thể để rRNA (chủ yếu là 16S và 23S rRNA CES tuần tự) đã trở thành công cụ tiêu chuẩn để xác định sinh vật (Olsen và cộng sự, 1986.). Một số thiết bị thăm dò oligonucleotide thương mại hóa và lựa chọn xem có nên sử dụng chúng hay thiết kế, những người cụ thể mới phụ thuộc phần lớn vào ứng dụng. Để tìm chuỗi mục tiêu liên tục duy nhất cho một vi sinh vật cụ thể, các nhà nghiên cứu dựa vào máy tính hỗ trợ so sánh trình tự có sẵn trong cơ sở dữ liệu dự án ribosome (RDP) (Maidak et al., 1996), trong GenBank cho DNA (Benson et al., 1999), hoặc trong gói phần mềm ARB (Viện Max Planck, Bremen, Đức). Đối với đặc trưng tốt hơn, trình tự mục tiêu nên ngắn (15 đến 30 base) và có ít nhất 2-3 nucleotide khác nhau với chuỗi của các sinh vật liên quan chặt chẽ (DeLong, 1993) Làm việc sớm trong chỗ lai dựa vào thăm dò phóng xạ để phát hiện và phát hiện các mục tiêu lai probe- (Olsen và cộng sự, 1986.). Công việc hiện tại trên rRNA trong lai tại chỗ huỳnh quang sử dụng đầu dò nucleotide nhãn hầu như chỉ để phát hiện hóa hybrid- (FISH). Sự phổ biến của kỹ thuật FISH là do lợi thế của mình đối với nhãn phóng xạ, trong đó bao gồm độ nhạy, tốc độ của trực quan của tế bào đơn (bằng kính hiển vi hoặc các thiết bị cytometrical), sự ổn định của sản phẩm lai, an toàn, thời gian phát hiện giảm đi, nhiều nhãn (nhiều màu sắc) và dễ sử dụng (Richardson et al., 1991; DeLong, năm 1993; Swinger và Tucker, 1996). Huỳnh quang và thuốc nhuộm Rhodamine là fluorochromes xuyên sử dụng độ thường xuyên nhất (DeLong và cộng sự năm 1989,;. Amann và cs, 1990;. Manz và cộng sự, 1992;. Năm 1993;. Wagner và cộng sự, 1994), nhưng thuốc nhuộm CY3, sáng hơn và dẫn đến giảm huỳnh quang không đặc hiệu hơn so với rochromes fluo- khác, gần đây đã thu hút được sự chú ý nhiều hơn (Wessendorf và Brelje năm 1992; Glockner và cộng sự năm 1996,;. Zarda et al, 1997;. Kalmbach và cộng sự 1997a,;. Ouverney và Fuhrman, 1999). Trong thực tế, các bước thủ tục cá là: cố định tế bào, lai (đặc và nghiêm ngặt phụ thuộc vào nhiệt độ và thời gian lai, nồng độ muối, nồng độ thăm dò và chiều dài), rửa hậu lai (để loại bỏ ràng buộc hoặc không cụ thể tài liệu ràng buộc) và phát hiện. Tế bào lai này thường được phát hiện bằng kính hiển vi và một epifluorescence counterstain như vậy như DAPI (40,60-diamidino-2-phenylindole) hoặc màu cam acridine được sử dụng để xác định tổng số tế bào. Tùy thuộc vào nồng độ của các tế bào mục tiêu trong mẫu và để tăng độ phân giải, phát hiện cá có thể được thực hiện bằng các phương tiện lưu lượng hoặc pha rắn đếm tế bào. Đo dòng tế bào cho phép định lượng cường độ huỳnh quang cho mỗi mục tiêu thăm dò lai (Fuchs và cộng sự, 1998.). Đối với TC, sự phát triển của một cụ thể 16S rRNA thăm dò cho nhóm này là không thể, kể từ khi nhóm coliform theo quy định của ngành công nghiệp nước là một nhóm có chứa vi khuẩn từ chi được phylogeneti- Cally khác nhau. Kết quả là, các đầu dò (Bảng 3) đã được phát triển cho họ Enterobacteriaceae hơn là cho TC. Việc đầu tiên, Entero (Mittelman et al., 1997) đã được phát triển để phát hiện lâm sàng của nhiễm trùng đường tiểu. Thứ hai, ENT1 (Loge et al., 1999) đã được phát triển cho các ứng dụng trên các mẫu nước thải. Hai mẫu dò khác nhau trong thành phần của họ và trong các điều kiện lai. Các Entero thăm dò là dài 25 base có hàm lượng C + G 48% so với 17 cơ sở và 70% C + G cho đầu dò ENT1. Nghiên cứu trong RDP (Maidak et al., 1996) cho thấy tính đặc hiệu cao đối với đầu dò ENT1 cho các loài Enterobacteriaceae hơn so với thăm dò Entero (Rompre' và Baudart, NSERC Chủ tịch công nghiệp vào nước uống, Ecole Polytechnique Montreal,thong tin cá nhân). Trình tự rRNA thăm dò mục tiêu để phát hiện vi khuẩn E. coli cũng đã được công bố. Các đầu dò EC1531 (Poulsen et al., 1994), bổ sung cho một chuỗi 23S rRNA, bao gồm 20 nucleotide với nội dung C + G 55%. Shi et al. (1999) đã sử dụng đầu dò này để phát hiện vi khuẩn E. coli sau khi thay đổi các điều kiện lai, nhưng không có kết quả đã đề cập. Các đầu dò đã được sử dụng như một điều khiển trong một thí nghiệm bằng cách sử dụng một mô hình thu nhỏ chiết xuất tăng vọt với E. coli DNA. Gần đây hơn, Regnault et al. (2000) đã phát triển thăm dò Colinsitu để phát hiện vi khuẩn E. coli và E. fergusonii trong nước tiểu, nước (sông và nước thải) và các mẫu thực phẩm. Các đồng Colinsitu thăm dò mang đến những bổ một chuỗi 16S rRNA và bao gồm 24 nucleotide (C + G nội dung của 46%). thăm dò này cho thấy độ đặc hiệu tốt cho trực quan của E. coli từ các phương tiện truyền thông khác nhau đã được thử nghiệm và mới được sử dụng thành công để phát hiện vi khuẩn E. coli trong nước uống mẫu (Delabre et al., 2001). Kỹ thuật FISH dường như là một phương pháp phát hiện rất cụ thể ở cấp độ tế bào; Tuy nhiên, nó có thể có một số hạn chế khi áp dụng cho việc phát hiện các chất dinh dưỡng bị bỏ đói các tế bào vi khuẩn phổ biến trong drink- bảng 3 Đầu dò oligonucleotide được sử dụng để xác định các Enterobacteriaceae và E. coli trong môi trường Thăm dò liên tục (50 -30) rRNA vị trí mục tiêu đặc tài liệu tham khảo ENTEROa CATGAATCACAAAGTGGTAAGCGCC 16S, 1458-1482 Enterobacteriaceae Mittelman et al, 1997. ENT1 CCGCTTGCTCTCGCGAG 16S, 1273-1289 Enterobacteriaceae Loge et al, 1999. EC1531 CACCGTAGTGCTCGTCATCA 23S, 1531 -. 1550 E. coli Poulsen et al, 1994 COLINSINTU GAGACTCAAGATTGCCAGTATCAG 16S, 637-660 E. coli Regnault et al, 2000. PNA thăm dò GCAAAGCAGCAAGCTC 16S, 71-86 E. coli Prescott và Fricker, 1999 Ở đây Entero cho sự khác biệt dễ dàng hơn vì không có tên đã được đưa ra bởi các tác giả trong nước. Những hạn chế này có liên quan đến một nội dung ribosom của vi khuẩn nhỏ và do đó số lượng nhỏ các 16S rRNA mục tiêu của các tế bào, trong đó gây ra tín hiệu lai huỳnh quang yếu (Amann et al, 1995;. Lebaron et al, 1997.). Đây có lẽ là lý do tại sao cá hiếm khi được mô tả trong các tài liệu nước uống vào lúc này. Kết quả là, hệ thống khuếch đại rescence fluo-, chẳng hạn như nhiều thăm dò (thay vì monolabeled thăm dò trong kỹ thuật FISH ventional dựng), tính tương tác của các biotine - avidine phức tạp và / hoặc cải ngựa trăm oxydase liên hợp với fluorochrome - tyramide- nền , có thể đại diện cho một cách để tăng cường độ của tín hiệu huỳnh quang phát ra bởi các tế bào lai đói (Lebaron et al, 1997;. scho nhuber et al, 1997.). Gần đây, Prescott và Fricker (1999) báo cáo việc sử dụng một axit nucleic peptide (PNA) thăm dò cho lai tạo tại chỗ và phát hiện các vi khuẩn E. coli trong nước máy. Các kết quả lai cũng tương tự như những người thu được từ phương pháp đếm tấm. Một PNA là một axit nucleic tổng hợp, trong đó xương sống đường được thay thế bằng một xương sống peptide. Những lợi thế để sử dụng PNA thay vì đầu dò DNA bao gồm kháng tốt hơn để nuclease tấn công, hybrid- hóa độc lập với nồng độ muối, nhiều biệt ràng buộc cific và trình tự thăm dò ngắn hơn, để đạt được độ nhạy lớn hơn. Kể từ khi thăm dò PNA liên kết mạnh mẽ hơn với các trang web mục tiêu, phản ứng lai có thể được hoàn thành trong một thời gian ngắn (30 phút). Theo hiểu biết của chúng tôi, ngoại trừ tàu thăm dò E. coli PNA (Prescott và Fricker, 1999), không ai trong số những thiết bị thăm dò đã được sử dụng cho vi khuẩn hoặc vi khuẩn gây bệnh giám sát trong nước uống. Trước khi họ được chấp nhận như một phương pháp điều tra coliform nhạy cảm, họ phải đầu tiên phải chịu một giai đoạn xác nhận để thăm dò phù hợp nhất cho các mẫu phân tích có thể được lựa chọn và để tối ưu hóa các điều kiện lai nếu cần thiết. Khả năng di động là một câu hỏi lớn nảy sinh trong việc sử dụng cá để theo dõi ô nhiễm nguồn nước uống. Nó được thành lập rằng nội dung rRNA của các tế bào vi khuẩn có tương quan trực tiếp với tốc độ tăng trưởng (Amann et al., 1995). Tuy nhiên, nội dung rRNA của một loại vi khuẩn có thể không hoàn toàn phản ánh tình trạng sinh lý của nó. Có vẻ như một số lượng nhỏ các phân tử rRNA có thể duy trì trong một thời gian tương đối dài sau khi mất culturability. S. aureus và E. coli rRNA vẫn còn phát hiện 48 giờ sau khi kích hoạt vừa phải nhiệt hoặc tia UV (McKillip et al., 1998). Sheridan et al. (1998) vẫn còn tìm thấy vi khuẩn E. coli 16S rRNA 16 giờ sau khi ngừng hoạt động nhiệt ở mức 100, 80 và 60 C. Cuối cùng, Prescott và Fricker (1999) tiếp xúc với một chủng E. coli đến 1,5 mg / l clo cho đến 30 phút. Sử dụng đầu dò PNA và tyramide huỳnh quang hệ thống cation amplifi- (TSA bộ; Perkin Elmer Khoa học đời sống, Ontario, Canada), họ vi khuẩn vẫn phát hiện ngay sự sau khi khử trùng bằng clo, trong khi không có các tế bào được phát hiện bởi số lượng đĩa hoặc các phương pháp Colilert. Hai tuần sau khi khử trùng bằng clo, 10% các tế bào vẫn bị phát hiện bởi bộ PNA thăm dò-TSA. Điều này có thể được xem như là một lợi thế cho các phương pháp trong đó các hình thức coli- không culturable có thể được phát hiện, hoặc là một bất lợi trong đó các tế bào chết có thể được liệt kê. Nghiên cứu sâu hơn về tình trạng sinh lý của vi khuẩn được liệt kê bởi cá vẫn còn cần thiết để đi đến một kết luận về câu hỏi này. Một cách có thể để nghiên cứu vấn đề này là vài kỹ thuật số khả thi trực tiếp (DVC) (Kog- ure et al., 1979) với phát hiện FISH (Nishimura et al., năm 1993; Kalmbach et al., 1997b). Khớp nối này gần đây đã được áp dụng để phát hiện vi khuẩn E. coli trong nước uống của Delabre et al. (2001). Các tác giả thấy đáng kể cao hơn E. coli phong phú với giao thức của họ hơn bởi số lượng tấm. CÁ hiện đang được coi là một phương pháp phát hiện tế bào đặc hiệu cao, và là tương đối dễ dàng để thực hiện. Các đặc trưng của phát hiện phụ thuộc vào đặc trưng của tàu thăm dò oligonucleotidic và tính chặt chẽ các điều kiện sử dụng lai. Cation Identifi- của chuỗi mục tiêu vẫn còn tẻ nhạt, tuy nhiên, cá không thể được áp dụng để phát hiện các phi phylogenetically xác định vi sinh vật, chẳng hạn như vi khuẩn. Trong trường hợp này, công việc có thể được thực hiện trên nghieäp obacteriaceae, các phylogenetically xác định nhóm gần nhất mà có thể được coi là một chỉ số tiềm năng của ô nhiễm phân. 6. Kết Luận Mục đích của bài viết này là: Để truyền đạt inventory và gần đây hơn là phương pháp phát hiện nhóm coliforms, chủ yếu là những áp dụng cho phân tích chất lượng vi sinh Để đánh giá những hạn chế của phương pháp này về độ nhạy và ứng dụng của nó Ngày nay kỹ thuật màng lọc là một phương pháp phổ biến nhất cho việc đếm coliforms trong nước uống , kỹ thuật này đơn giản, dễ thực hiện và không tốn kém, đòi hỏi phải có thời gian ủ ít nhất là qua đêm ( 24-72 giờ hơn) sau khi điều tra khuẩn lạc ban đầu, Hơn nữa, khi tiêu chuẩn media môi trường thạch được sử dụng với kỹ thuật này là ức chế, coliforms yếu hoặc bị tổn thương phát triển trong môi trường đặc biệt như( m-T7) và việc bổ sung các hợp chất cụ thể ( như pyruvate) nâng cao tỷ lệ phục hồi của các tế bào yếu hoặc bị tổn thương, Ngoài ra, thời gian thực hiện dài, độ dài của nó phụ thuộc vào các thử nghiệm sinh hóa sử dụng cho các bước xác nhận, vẫn còn yếu tố hạn chế Những thách thức quan trọng đối với sự phát triển của phương pháp phát hiện coliforms mới là để cải thiện các đặc tính của phương pháp này, mà có thể loại bỏ làm tốn thời gian, để đưa vào các tế bào yếu hoặc bị tổn thương và để giảm thời gian phân tích Một cuộc điều tra hoạt động của enzyme cụ thể nên được cải thiện độ nhạy của việc phát hiện EColi, sử dụng β-D galactosidase và β-Dglucuronidase, Nhiều chất chromgenic và chất huỳnh quang tồn tại cho việc phát hiện hoạt động của enyme và thử nghiệm trên cơ sở các chất nền có sẵn, Rất nhiều so sánh giữa thử nghiệm này và các phương pháp tiêu chuẩn đã chỉ ra rằng nó có thể là lựa chọn phù hợp với kỹ thuật MF, Các bài kiểm tra dễ dàng thực hiện, chỉ yêu cầu thiết bị, phòng thí nghiệm cơ bản, hiển thị độ nhạy và độ đặc hiệu cao, Tuy nhiên phương pháp này đắc hơn, thậm chí nhiều hơn như vậy nếu thời gian ủ giảm (khoảng 18h ) và mất quá lâu để có kết quả trong ngày Phát hiện coliforms bằng phương pháp tiếp cận tìm hiểu enzyme ở mức độ tế bào kết hợp với các đầu dò huỳnh quang cũng có thể được đề xuất, các phương pháp này cho phép phát hiện rất cụ thể và nhanh chóng mà không cần một bước nuôi cấy nào, thời gian thực phương pháp phát hiện được phát triển bởi Van Poucke và Nelis ( 2000a,b),Phương pháp tiếp cận mới này cho phép tăng độ nhạy trong khi nhanh hơn so với thử nghiệm khác Phương pháp miễn dịch, phương pháp này đã rất phổ biến, dễ dàng áp dụng nhưng vẫn còn một số hạn chế lien quan đến phản ứng chéo của các tế bào không mục tiêu của kháng thể, Phương pháp PCR cung cấp một phát hiện ở mức độ đặc hiệu cao hơn, Neverless, phương pháp này có hạn chế lớn khi áp dụng cho các mẫu tự nhiên, bao gồm tỷ lệ khuếch đại thấp, liên quan đến sự hiện diện của các chất ức chế và thiếu thông tin về hoạt động sinh lý của tế bào. Phương pháp PCR yêu cầu đội ngủ nhân viên có tay nghề cao cũng như không gian phòng thí nghiệm chuyên dụng và thuốc thử cụ thể để tránh nhiểm bẩn của các mẫu AND bên ngoài, đặc biệt là khi nested-PCR yêu cầu. Phương pháp FISH cũng cần được xem xét như là 1 phương pháp đếm thay thế cho việc điều tra coliforms trong nước uống, như phương pháp này cũng chỉ hiện định lượng trong vòng 1 ngày. Hiện nay việc sử dụng các thiết bị thăm dò oligomicnucleonde cho việc đếm coliform là không phổ biến. Các vấn đề lớn với việc áp dụng FISH để đếm các tế bào có chỉ số phân trong mẫu nước uông lien quan đến tình trạng sinh lí của vi khuẩn nước uông (do chất khử trùng). Trên thực tế những tế bào vi khuẩn thường được đặc trưng bởi hàm lượng sibosome nhỏ, làm phức tạp việc phân tích của positne fluoucseent signals. Việc sử dụng các đầu dò PNA thay DNA hoặc sử dụng các hệ thấy khuếch đại huỳnh quang nên cường độ nhạy cao và cường độ huỳnh quang của positive signdes. Việc áp dụng FISH trong mẫu nước uống hiện nay đòi hỏi phải phát triển cao hơn nữa để đạt được việc đếm tối ưu các tế bào thiếu dinh dưỡng yếu đi. Thường coliforms được tìm thấy với số lượng nhỏ trong mẫu nước uống do đó việc điều tra ở cấp độ tế bào của tế bào mục tiêu lien quan đến việc lựa chọn. Mới đây Joux and Lebara (2000) phân tích những hạn chế về số lượng và chất lượng của công cụ phân tích huỳnh quang khác nhau (kính hiển vi huỳnh quang, flow cytometer, confocal scanning laser microscope and the new solid –phase laser scanning cytometer), Sự xuất hiện các phát hiện và thời gian thực của các phương pháp mới có lien quang đến sự cần thiết cho các chuẩn đoán đánh giá tốt hơn về chất lượng vi sinh của nước, Mục tiêu này có thể đạt được thong qua sự gia tăng trong việc phát hiện cụ thể và giảm thời gian phân tích Tuy nhiên kỹ thuật phức tạp và chi phí tương ứng cao hạn chế của mình để trở thành phương pháp chuẩn hóa cho việc phát hiện coliforms trong mẫu nước uống. Hơn nữa , với kiến thức hiện có trong công việc hiện tại ngoại trừ Delabre et al(2001) nghiên cứu, vẫn chưa chứng minh được rằng một tỷ lệ đáng kể các chỉ thị tế bào đựợc tìm thấy trong một trạng thái khả thi hoặc hoạt động nhưng không culturable trong hệ thống phân phối, Nếu đây là một trường hợp, các bước nghiên cứu tiếp theo sẽ là đánh giá khả năng tác động của các tế bào sống hoặc hoạt động nhưng không chỉ về khả năng gây bệnh, mà còn về khả năng tái sinh LỜI CẢM ƠN Đánh giá này là một phần của dự án nghiên cứu một cách tiếp cận toàn diện để kiểm soát toàn bộ coliforms trong hệ thống phân phối nước uống được hỗ trợ bởi Vivendi Water-US-Filter, Tác giả cám ơn tiến sĩ Camper và Dr.V.Gautheir cho những rà soát hữu ích của họ trong bản thảo.

Các file đính kèm theo tài liệu này:

  • doctieu_luan_phan_tich_vi_sinh_thuc_pham_6292.doc