Đề tài Thiết kế vector mang gen HA1 mã hóa protein bề mặt của virus H5N1

MỞ ĐẦU 1. Đặt vấn đề Cúm gà (avian influenza) là một bệnh truyền nhiễm cấp tính của các loài chim, kể cả gia cầm và thuỷ cầm, do các subtype khác nhau thuộc nhóm virus cúm A gây nên. Do có sức đề kháng tự nhiên tốt nên một số loài chim mang virus gây bệnh, nhưng không có biểu hiện của bệnh. Đây là mối nguy hiểm lan truyền bệnh cho các loài gia cầm khác. Ngoài ra, chúng còn là nơi cung cấp nguồn tàng trữ biến đổi nguồn gen tạo nên các subtype mới. Các subtype virus cúm A gây bệnh trên người đều có nguồn gốc tiến hoá biến thể và biến chủng từ động vật và sau khi thích ứng trên người thì gây bệnh, trước đây đã tạo nên những vụ dịch thảm khốc, rồi biến mất sau một thời gian lại tái hiện và gây nên đại dịch mới. Năm 2004 các đại dịch cúm gia cầm tại các nước châu Á (bao gồm dịch do H5N1 gây ra tại Trung Quốc, Nhật, Nam Triều Tiên, Thái Lan, Việt Nam, Indonesia, Campuchia và Lào; do H7N3 (Pakistan); do H5N2 ( Đài Loan) đã gây thiệt hại hàng trăm triệu gia cầm, làm chết hàng chục người ở Việt Nam và tại Thái Lan. Chủng H5N1 điển hình ở châu Á có tính kháng nguyên và di truyền giống với chủng A/Vietnam/1203/04. [1] Để phòng chống sự lây lan mạnh mẽ của đại dịch cúm gia cầm, hàng năm Việt Nam cần một lượng vaccine rất lớn để tiêm chủng cho hàng trăm triệu con gà vịt. Ngoài những công nghệ sẵn có Việt Nam đang tìm kiếm những công nghệ sản xuất vaccine có ý nghĩa kinh tế, an toàn và hiệu quả cao. Vaccine ăn được có nguồn gốc từ thực vật sẽ là nguồn vaccine đáp ứng được các tiêu điểm đó và sẽ đem lại nhiều lợi ích cho ngành thú y và được xem là hướng đi phù hợp với những nước đang phát triển vì mục đích chăm sóc sức khoẻ cộng đồng như Việt Nam. Chuyển gen mã hóa các vaccine tái tổ hợp vào thực vật cụ thể là vào các cây trồng là nguồn thức ăn chính cho con người, động vật nuôi là một trong những hướng đi chính hiện nay. Tuy nhiên bên cạnh đó, một xu hướng cũng được bắt đầu quan tâm nghiên cứu và ứng dụng là sử dụng hệ thống nuôi cấy sinh khối tế bào để sản xuất các dược phẩm sinh học tái tổ hợp. Do tế bào thực vật có ưu thế nuôi cấy dễ dàng, môi trường nuôi cấy đơn giản, rẻ tiền, dễ dàng sản xuất một lượng sinh khối lớn trong khoảng thời gian ngắn và quan trọng hơn cả tế bào thực vật nuôi cấy in vitro không mang các mầm bệnh cho người. Với mục đích tạo cơ sở cho việc nghiên cứu sản xuất vaccine cúm A/H5N1, căn cứ vào điều kiện phòng thí nghiệm cho phép và với phương pháp khả thi, chúng tôi lựa chọn đề tài cho luận văn thạc sỹ là: “Thiết kế vector mang gen HA1 mã hóa protein bề mặt của virus H5N1 và bước đầu chuyển gen HA1 tạo các dòng rễ tơ chuyển gen ở cây thuốc lá”.

doc76 trang | Chia sẻ: lvcdongnoi | Ngày: 04/06/2013 | Lượt xem: 2315 | Lượt tải: 4download
Bạn đang xem nội dung tài liệu Đề tài Thiết kế vector mang gen HA1 mã hóa protein bề mặt của virus H5N1, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Chọn dòng bằng colony-PCR Lựa chọn 10 dòng khuẩn lạc mọc trên đĩa chứa kháng sinh chọn lọc để thực hiện phản ứng colony-PCR với cặp mồi đặc hiệu HA1_Sac I_F và HA1_Hind III_R. Phản ứng này được thực hiện tương tự như phản ứng PCR thông thường, chỉ khác là DNA được thay bằng dịch khuẩn. Sản phẩm colony-PCR được điện di kiẻm tra trên gel agarose 0,8%. Chọn các khuẩn lạc dương tính với phản ứng colony-PCR để tiến hành nuôi lỏng trong môi trường YMP qua đêm ở 280C (50 ml YMP lỏng có bổ sung 100 µl cefotaxim 500 ml/L). Dịch khuẩn sử dụng cho việc tách chiết plasmid. Sau đó, thực hiện phản ửng cắt plasmid tách được bằng hai enzyme SacI và HindIII. Bảng 2.6. Thành phần phản ứng cắt bằng enzyme SacI và HindIII STT Thành phần Thể tích 1 Nước deion 4,5 2 Đệm Tango 2X 2 3 Enzyme HindIII 1 4 Enzyme SacI 1 5 DNA 1,5 Tổng 10 - Bổ sung lần lượt các thành phần trên của phản ứng vào ống eppendorf 0,5 ml, ủ ở 370C trong 2 giờ. - Chạy điện di kiểm tra sản phẩm trên gel agarose 0,8% - Vector chuyển gen mang gen mong muốn sẽ được sử dụng để chuyển vào vi khuẩn A. rhizogenes bằng xung điện tạo vector tái tổ hợp. 2.2.5. Biến nạp vector chuyển gen vào A. rhizogenes ATCC15834 a . Chuẩn bị tế bào khả biến A. rhizogenes ATCC15834 50 ml tế bào vi khuẩn A. rhizogenes nuôi cấy trên môi trường mới đến đầu pha log được thu lại bằng ly tâm lạnh. Cặn của tế bào vi khuẩn được làm sạch bằng cách rửa nhiều lần bằng nước khử ion và glyxerol 10% đã được làm lạnh trước. Các thao tác được thực hiện trong box vô trùng. Bước cuối cùng bổ sung 0,5 ml glycerol 10% chia đều 50 µl vào 10 ống eppendorf và giữ ở tủ -850C. b. Phương pháp biến nạp bằng xung điện Cơ sở lý thuyết Dưới tác động của điện trường cực lớn, lỗ màng tế bào mở ra, nhờ đó DNA di chuyển theo điện trường dễ dàng xâm nhập vào tế bào. Khi ngừng xung điện, cấu trúc màng tế bào hồi phục trong môi trường LB và giữ DNA lại trong tế bào. Tế bào chứa DNA tái tổ hợp có khả năng biểu hiện các gen kháng kháng sinh nên được chọn lọc trên môi trường chứa chất kháng sinh đó. Phương pháp - Rửa cuvette bằng cồn 700, rửa lại bằng nước khử ion vô trùng rồi thấm khô. - Tế bào khả biến đặt trong đá 15 phút. - Bổ sung 1 µl plasmid vào 50 µl tế bào khả biến và trộn nhẹ. - Chuyển tất cả hỗn hợp dịch tế bào khả biến và plasmid vào cuvette. - Xung điện: 2,5 kV, 25 µF, 200 Ω. - Bổ sung 500 µl YMP và mix nhẹ. - Chuyển sang ống eppendoft 2ml. - Nuôi lắc ở 280C trong 1 giờ. - Chuyển dịch ra đĩa môi trường YMP bổ sung 100 mg/L Spectinomycine Sự có mặt của vector chuyển gen được kiểm tra bằng phản ứng colony-PCR (mục 2.2.3. c) với cặp mồi đặc hiệu hoặc bằng phản ứng cắt bởi enzyme giới hạn SacI và HindIII (mục 2.2.2. a). 2.2.6. Chuyển cấu trúc mang gen mã hóa protein vỏ virus vào thuốc lá thông qua vi khuẩn A. rhizogenes ATCC15834 a. Cơ sở lý thuyết A. rhizogenes là vi khuẩn mang thành phần Ri plasmid có thể chuyển một gen mong muốn vào genome tế bào thực vật. Chủng A. rhizogenes ATCC15834 mang vector chuyển gen nhị thể, vùng vir được thiết kế sẵn trong tế bào vi khuẩn, trong khi T-DNA là vector chuyển gen pK7WG2D (1) mang cấu trúc HA1 vừa thiết kế được chuyển vào tế bào bằng xung điện. b. Quy trình Quy trình chuyển gen vào giống thuốc lá N. tabacum K326 thông qua vi khuẩn A. Rhizogenes ATCC15834 được tiến hành theo phương pháp của Topping có cải tiến (Topping, 1998). Các bước chính như sau: - Chuẩn bị chủng A. rhizogenes ATCC15834 mang cấu trúc HA1: một ngày trước khi biến nạp, nuôi một khuẩn lạc vào 5 ml YMP lỏng có bổ sung cefotaxim 500 mg/L, nuôi lắc 200 v/p ở 28oC. - Chuẩn bị mảnh lá thuốc lá có kích thước 1 cm2 được làm tổn thương bằng lưỡi dao cắt bốn cạnh xung quanh, đặt trên môi trường WPM trong 2 ngày. - Hút 1 ml dịch khuẩn nuôi lỏng ở trên cho vào 50 ml YMP lỏng, đo OD600 = 0,7 - 1 là có thể được sử dụng cho biến nạp. - Các mảnh lá sau 2 ngày nuôi cảm ứng trên môi trường WPM, được nhặt ra một bình tam giác mới có bổ sung 5 ml MS. - Đổ dịch khuẩn vào bình tam giác có chứa các mảnh cấy lá thuốc lá ở trên. - Sau 30 phút chuyển các mảnh cấy lên giấy thấm đã khử trùng, thấm khô và cấy lên môi trường WPM. Sau 2 ngày chuyển sang môi trường WPM có bổ sung kháng sinh cefotaxim 500 mg/L và kanamycin 100 mg/L. - Sau 2 - 4 tuần các mảnh cấy bắt đầu cảm ứng tạo rễ được cắt và chuyển sang môi trường WPM có bổ sung cefotaxim 400 mg/l và kanamycin 100 mg/l. 2.2.7. Phương pháp đánh giá cây trồng chuyển gen a. Sàng lọc cây chuyển gen bằng chất chọn lọc Do không phải toàn bộ các tế bào và các mẫu chuyển gen đều mang gen chuyển nên nhất thiết phải tiến hành sàng lọc các tế bào chuyển gen. Dựa vào các gen chọn lọc được thiết kế trong vector chuyển gen mà người ta sử dụng các kháng sinh phù hợp để thu được các tế bào, mẫu mang gen chuyển. Gen chọn lọc điển hình là các gen mã hóa cho các loại enzyme có khả năng khử độc đối với kháng sinh như kanamycin (nptII), hygromycine (hyg), gentamycine (gent),… hoặc chất diệt cỏ glyphosate hay basta (bar),… Chỉ những tế bào mang gen biến nạp có thể sống sót trên môi trường chứa chất kháng sinh hoặc chất diệt cỏ [3]. Các loại vector này đã được ứng dụng và mang lại thành công trong việc chọn lọc nhiều đối tượng cây trồng chuyển gen như cây đu đủ, cây hồng, cây lúa, cây bông vải, cây thuốc lá, … [2], [5], [6], [10], [14]. b. Phương pháp nhuộm mô tế bào Có thể nhuộm hóa tế bào để khẳng định sự của mặt của sản phẩm thông qua một loại gen chỉ thị được sử dụng phổ biến trong chuyển gen thực vật là gen gus hay gen uidA. Gen gus nằm ở locus uid của vi khuẩn E. coli và mã hóa cho enzyme β-glucuronidase. Đây là một enzyme hydrolase có khả năng phân hủy các hợp chất có gốc β- glucuronide tạo thành chất trung gian, khi chất này bị oxi hóa sẽ có màu xanh đậm đặc trưng. Do đó, enzyme này được xác định rất dễ dàng và thuận tiện bằng hợp chất indole- β-glucuronide. Người ta thường sử dụng dung dịch muối 5-Br-4-Cl-3-indolyl β-D-glucuronide cyclohexylamine (X-Gluc) để nhuộm mô tế bào [8], [15]. Sản phẩm sơ cấp 5-Br-4-Cl-3indolyl vẫn còn là một chất dễ tan, không màu. Nhưng ngay sau đó sản phẩm này bị ôxy hóa và dimmer hóa thành một phức hệ không tan có màu xanh. Sự có mặt của ferri và ferrocyanide trong dung dịch nhuộm làm tăng quá trình hình thành sản phẩm cuối cùng, đồng thời cũng góp phần hạn chế việc khuếch tán sản phẩm sơ cấp đến vùng không có gus [3]. Các bộ phận khác nhau của cây chuyển gen được ngâm trong dung dịch đệm cơ chất X-Gluc. Sau 24-48 giờ mẫu nhuộm được tẩy hết diệp lục bằng Ethanol 70% và quan sát trên kính lúp soi nổi. Biểu hiện hoạt động của gen gus sau khi chuyển vào tế bào thực vật là phản ứng tạo màu đặc trưng trên các tế bào, mô, bộ phận của cây chuyển gen. Nhuộm gus được thực hiện trong thí nghiệm xác định biểu hiện tạm thời, mô sẹo, chồi mầm và rễ mới tái sinh. Nhuộm gus cũng để khẳng định gen chuyển được di truyền sang thế hệ sau khi nhuộm phôi của hạt hình thành từ cây chyển gen [3], [12]. 2.2.8. Phương pháp xử lý số liệu Thiết kế mồi, và dữ liệu trình tự DNA được xử lý bằng phần mềm Lasergene version 7 của DNASTAR Inc., USA; BLAST (Basic Local Alignment Search Tool; Altschul et al., 1990); BioEdit version 7 (Tom Hall, Department of Microbiology , North Carolina State University, NC) và Primer3 Input Version 4 ( [9]. CHƯƠNG 3. KẾT QUẢ VÀ THẢO LUẬN 3.1. Kết quả tách dòng gen HA1 HA1 là một trong ba tiểu phần cấu tạo nên protein HA, cho phép nhận biết tế bào đích của động vật có xương sống và hoàn thành quá trình nhận biết bằng cách gắn kết với thụ thể chứa sialic acid của những tế bào này. Trên cơ sở trình tự của gen HA1 đã được xác định, với mục đích ghép nối đoạn gen HA1 vào vector pENTR/cal (mục 2.2.2) ở 2 vị trí cắt của enzyme giới hạn SacI và HindIII, chúng tôi thiết kế cặp mồi đặc hiệu HA1_SacI_F (mồi xuôi) và HA1_Hind III_R (mồi ngược) để nhân đoạn gene HA1 từ gen HAop (đây là gen đã được tối ưu hóa mã để biểu hiện ở thực vật) được Phòng công nghệ tế bào thực vật cung cấp. Cặp mồi được thiết kế tạo được mã mở đầu và mã kết thúc cho gen HA1 khi được nhân lên và có chứa điểm nhận biết của enzyme cắt giới hạn SacI và Hind III. Với các yêu cầu trên, chúng tôi đã thiết kế cặp mồi có các thông số trình bày ở bảng 3.1 Bảng 3.1. Trình tự và các thông số cần thiết của hai mồi HA1_F và HA1_R Mẫu Mồi Trình tự Tm (0C) HA1 HA1_F 5’-GGGGAGCTCGATCAGATCTGCATTGGAT-3’ 74 HA1_R 5’-GGGAAGCTTTTACCTTCTTTCTCTCTGTGG-3’ 69 Từ nguồn nguyên liệu ban đầu là gen HAop (pUC18/Haop) chứa đoạn gen HA1, chúng tôi tiến hành nhân đoạn gen HA1 bằng phản ứng PCR. 3.1.1. Kết quả PCR nhân đoạn gen HA1 50ng DNA plasmid pUC18/HAop được sử dụng trong phản ứng PCR để nhân đoạn gene HA1 sử dụng cặp mồi đặc hiệu đã thiết kế ở trên. Sản phẩm của phản ứng PCR được điện di kiểm tra trên gel agrose 0,8% với thang DNA 1kb (Hình 3.1 A). Kết quả cho thấy, chúng tôi đã nhận được một đoạn DNA có kích thước khoảng gần 1000 bp phù hợp với chiều dài của gen HA1 quan tâm mà theo tính toán lý thuyết là 978bp. Đồng thời, kết quả điện di cho thấy, sản phẩm PCR là đặc hiệu và đủ hàm lượng cho mục đích tách dòng gen. 3.1.2. Kết quả tinh sạch sản phẩm PCR 1000 bp 978 bp 1000bp A B Hình 3.1. Kết quả PCR và tinh sạch gen HA1 từ pUC18/HAop A. Sản phẩm nhân đoạn gen HA1 bằng cặp mồi HA1_SacI_F và HA1_HindIII_R B. Sản phẩm tinh sạch gen HA1 M: Thang marker DNA 1kb. Để ghép nối sản phẩm PCR - đoạn gen HA1 vào vector tách dòng có hiệu quả thì sản phẩm PCR phải được làm sạch, loại bỏ các thành phần tạp chất có trong sản phẩm PCR như: mồi, đệm, enzyme vv… Khi dung dịch qua cột tinh sạch, DNA sẽ được gắn vào các phân tử có ái lực cao với chúng cố định trên màng lọc của cột. Dịch đệm cùng agarose được loại bỏ nhờ ly tâm với tốc độ cao. DNA được thu lại bằng nước khử ion. Sản phẩm tinh sạch được kiểm tra trên gel agarose 0,8% (hình 3.1 B) Kết quả trên hình 3.1 B cho thấy, sản phẩm tinh sạch có hàm lượng cao, không bị đứt gẫy, đúng với kích thước như tính toán lý thuyết, đảm bảo cho các bước thí nghiệm tiếp theo. 3.1.3. Ghép nối đoạn gen HA1 vào vector pENTR/cal Hình 3.2. Kết quả cắt đoạn gen HA1 và pENTR/cal bằng enzyme giới hạn SacI và HindIII 2500 bp 2544 bp 978 bp 1000 bp Sản phẩm PCR sau khi được tinh sạch và vector pENTR/cal (mục 2.2.2.a), sẽ được cắt bởi enzyme giới hạn SacI và HindIII để tạo đầu dính. Sau đó sản phẩm PCR và pENTR/cal được tinh sạch qua cột và thực hiện phản ứng lai để ghép nối đoạn gen HA1 vào vector pENTR/cal. Plasmid tái tổ hợp được tạo ra từ phản ứng lai sẽ được biến nạp vào tế bào khả biến E.Coli DH-5α bằng phương pháp sốc nhiệt để chọn lọc, nhân nhanh plasmid với số lượng lớn. Kết quả ở hình 3.2 cho thấy, sau khi cắt bằng enzyme giới hạn SacI và HindIII, chúng tôi thu được 2 vạch điện di đúng kích thước như lý Hình 3.3. Kết quả biến nạp plasmid tái tổ hợp pENTR/HA1 vào E.Coli thuyết của vector pENTR/cal (giếng số 1) và sản phẩm PCR - gen HA1 (giếng số 2). Kết quả của quá trình biến nạp vào tế bào E.Coli DH-5α được thể hiện ở hình 3.3 cho thấy, chúng tôi đã thu được rất nhiều khuẩn lạc mọc được trên môi trường chọn lọc (LB bổ sung kháng sinh Kanamycin 50mg/L). Từ đây, có thể kết luận tạm thời đã biến nạp thành công plasmid tái tổ hợp pENTR/HA1 vào tế bào E.Coli. Tuy nhiên, các khuẩn lạc này có thể mang vector tái tổ hợp hoàn chỉnh hoặc chỉ là khuẩn lạc mang các plasmid thông thường không chứa gen mong muốn hay gen đích bị đứt gẫy. Vì vậy, để có thể chọn lọc được những dòng khuẩn lạc mang vector chứa gen HA1 như mong muốn, chúng tôi tiến hành PCR các khuẩn lạc thu được với mồi M13. Hình 3.4. Kết quả điện di 7 khuẩn lạc mọc trên môi trường chọn lọc Chúng tôi tiến hành lựa chọn 7 khuẩn lạc trong số các khuẩn lạc mọc trên môi trường chọn lọc. Khuẩn lạc được lựa chọn là những khuẩn lạc tròn đều, không quá to hoặc quá nhỏ, được đánh số lần lượt từ 1 đến 7. Kết quả điện di sản phẩm PCR trên gel agrose 0,8% cho thấy, mẫu 1, 2, 4, 6, 7 dương tính, kết quả thể hiện trên hình 3.4. Sau khi thu được 5 dòng dương tính, chúng tôi tiến hành giữ dòng trong glyxerol 100% bảo quản ở nhiệt độ -800C để phục vụ cho các nghiên cứu tiếp theo. Đồng thời tiến hành đọc trình tự các dòng dương tính đã thu được. Kết quả đọc trình tự cho thấy, trình tự thu được giống với trình tự HA1 theo thiết kế ban đầu với tỷ lệ 100%. Kết quả đọc và phân tích trình tự (hình 3.5) đã chứng tỏ gen HA1 đã được chuyển vào vector pENTR. Ngoài ra, việc xác định trình tự cũng đã cho thấy các vị trí enzyme giới hạn, trình tự đoạn tín hiệu calreticulin và các vị trí attL1 và attL2 không bị lỗi đảm bảo cho phản ứng LR Gateway xảy ra chính xác. < - - - - - - calreticulin - - - - - - - - - -- - - -- - - -- - - - - - - calreticulin - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - --> < - - - - HA1 - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - HA1 - - - - - - - - - - - - - - >< - - - - - attL2 - - - - - - - - - - attL2 - - - - - Hình 3.5. Trình tự ghép nối gen HA1 trên vector pENTR221/cal Trình tự đoạn gen HA1 được trình bày tại phụ lục 3. Từ kết quả trên, chứng tỏ rằng đoạn gen HA1 đã được chèn thành công vào vector pENTR/cal tạo ra vector tái tổ hợp pENTR/cal/HA1 làm nguyên liệu cho việc thiết kế vector chuyển gen bằng kỹ thuật Gateway®. 3.2. Thiết kế vector tái tổ hợp mang gen HA1 bằng kỹ thuật Gateway®. 3.2.1. Tạo vector tái tổ hợp theo phản ứng LR Kỹ thuật Gateway là một phương pháp nhân dòng phổ biến, cho phép gắn trình tự DNA mong muốn vào hệ thống vector một cách nhanh và nhạy. Trong nghiên cứu này, chúng tôi thực hiện phản ứng LR (mục 2.2.4.b) giữa plasmid tiếp nhận pENTR/cal/HA1 và vector đích pK7WG2D. Sản phẩm của phản ứng LR là một vector tái tổ hợp được kí hiệu là pK7WG2D/cal/HA1, là vector chuyển gen cần thiết kế để chuyển vào cây tạo ra giống cây trồng có khả năng tạo vaccine thực vật khi con người sử dụng. Để thu nhận được dòng plasmid pK7WG2D/cal/HA1, hỗn hợp phản ứng LR được biến nạp vào tế bào khả biến E.coli DH-5α. Sản phẩm của quá trình biến nạp được nuôi trên môi trường chọn lọc có chứa kháng sinh. Kết quả thu được một lượng lớn khuẩn lạc trên đĩa thạch. Những khuẩn lạc mọc trên đĩa thạch là những khuẩn lạc có mang plasmid pK7WG2D mà gen ccdB của nó đã bị đột biến hoặc mang vector pK7WG2D/HA1. Do đó, để chọn ra những dòng khuẩn lạc như mong muốn (mang vector chuyển gen), chúng tôi đã tiến hành kiểm tra bằng phản ứng PCR colony và phản ứng cắt bằng hai enzyme giới hạn SacI và Hind III. 3.2.2. Kết quả kiểm tra vector tái tổ hợp bằng phản ứng colony-PCR Chúng tôi tiến hành chọn 10 khuẩn lạc để tiến hành phản ứng colony-PCR với mồi đặc hiệu. Những khuẩn lạc được chọn là những khuẩn lạc tròn đều, không quá to hoặc quá nhỏ. Kết quả colony-PCR được thể hiện ở hình 3.6. 1000 bp 978 bp Hình 3.6. Kết quả PCR colony pK7WG2D/cal/HA1 Qua hình 3.6 cho thấy, 10 khuẩn lạc thí nghiệm đều cho kết quả dương tính, xuất hiện một băng vạch có kích thước 978 bp cho thấy kết quả biến nạp đã thành công. 3.2.3. Kết quả kiểm tra vector tái tổ hợp bằng enzyme giới hạn Chúng tôi tiếp tục sử dụng 10 khuẩn lạc vừa thu được để tách plasmid và tiến hành phản ứng cắt bằng enzyme hạn chế. Kết quả thể hiện ở hình 3.7. Hình 3.7. Kết quả cắt pK7WG2D/cal/HA1 bằng SacI và Hind III M: Thang marker DNA 1kb 1 – 10: Các mẫu pK7WG2D/cal/HA1 11: mẫu pK7WG2D 11.159 bp 10000 bp 1201 bp 1000 bp 978 bp 434 bp 500 bp Theo lý thuyết, vector pK7WG2D(1) có kích thước 12794bp với 4 điểm cắt nhận biết của hai enzyme giới hạn SacI và Hind III. Theo tính toán, khi cắt pK7WG2D bằng SacI và Hind III sẽ thu được 3 đoạn có kích thước 434bp, 1201bp và 11159 bp, và khi cắt plasmid pK7WG2D/cal/HA1 sẽ thu được 4 đoạn, gồm 3 đoạn của vector pK7WG2D và 1 đoạn gen HA1 mới ghép nối thêm. Nhìn vào hình 3.7, cho thấy thực tế thí nghiệm thu được trùng với các tính toán lý thuyết. Qua đó có thể khẳng định, chúng tôi đã biến nạp thành công vector chuyển gen pK7WG2D/cal/HA1. 3.3. Kết quả biến nạp pK7WG2D/cal/HA1 vào vi khuẩn A.rhizogenes Chúng tôi sử dụng 50-100 ng plasmid pK7WG2D/cal/HA1 để biến nạp vào tế bào khả biến A.rhizogenes. Sản phẩm của quá trình biến nạp được nuôi trên môi trường YMP chọn lọc có chứa 100 mg/L Spectinomycin, ủ đĩa ở 28oC. Sau 2 ngày, kết quả thu được một lượng lớn khuẩn lạc trên đĩa thạch. Để chọn ra những dòng khuẩn lạc như mong muốn (mang vector chuyển gen), chúng tôi đã tiến hành kiểm tra bằng phản ứng colony-PCR. Kết quả kiểm tra vector tái tổ hợp bằng phản ứng colony- PCR. Chọn 10 dòng khuẩn lạc mọc trên đĩa thạch để tiến hành phản ứng PCR colony bằng cặp mồi đặc hiệu trên gen: HA1_Sac I _ F và HA1_Hind III_R. Sản phẩm phản ứng được điện di kiểm tra trên gel agarose 0,8%, kết quả thể hiện trong hình 3.8 1000 bp 978 bp Hình 3.8. Kết quả clony-PCR bằng cặp mồi HA1_SacI_F và HA1_Hind III_R M: Thang marker DNA 1kb Giếng 1 - 10: Các dòng khuẩn lạc. Qua kết quả thu được ở trên, cho thấy: có 8 trong 10 dòng khuẩn lạc được lựa chọn cho kết quả dương tính với phản ứng PCR với 1 băng duy nhất có kích thước 978bp (trừ dòng số 1 và 10 cho kết quả âm tính). Với tỷ lệ như vậy, cho thấy đã biến nạp thành công vector pK7WG2D/cal/HA1 vào vi khuẩn A. rhizogens. Như vậy, chúng tôi đã tạo được chủng A. rhizogens ATCC15834 mang plasmid tái tổ hợp pK7WG2D/cal/HA1. Đây chính là nguồn nguyên liệu phục vụ cho mục đích chuyển gen tạo vaccine thực vật. 3.4. Kiểm tra hệ thống tạo rễ tơ chuyển gen thông qua A.rhizogenes sử dụng gen chỉ thị Gus Để kiểm tra trước khả năng biến nạp thành công gen HA1 vào rễ tơ thuốc lá thông qua vi khuẩn A. rhizogens, chúng tôi sử dụng vector pPTN289 mang gen Gus (pPTN289/Gus), là gen chỉ thị mã hóa enzyme glucuronidase, enzyme này sẽ phân giải cơ chất X-Gluc (5-Bromo-4-chloro-3-indoxyl-beta-D-glucuronide cyclohexylamine) và chuyển thành màu xanh các mô mang gen chuyển (mục 2.2.7.b). Sau khi đưa được vector pPTN289/Gus vào vi khuẩn A. rhizogens, chúng tôi tiến hành biến nạp vào mảnh lá cây thuốc lá đã được cảm ứng trong môi trường WPM trước 2 ngày. Hình 3.9. Mảnh lá thuốc lá cảm ứng trên môi trường WPM Sau hai ngày nuôi cộng sinh, chúng tôi tiến hành cấy chuyển các mảnh lá sang môi trường WPM có bổ sung Cefotaxim 500 mg/L và ppt 2mg/L. Tỷ lệ chọn lọc sơ bộ của các mảnh lá trên môi trường chọn lọc được thể hiện qua bảng 3.2. Bảng 3.2. Tỷ lệ mô lá chuyển gen pPTN289/gus trên môi trường chọn lọc Tổng số mô lá Số mô sống sót sau 1 tuần Số mô sống sót sau 2 tuần Số mô sống sót sau 3 tuần Số mô sống sót sau 4 tuần Số mô cảm ứng tạo rễ 200 135 103 97 91 10 Qua bảng 3.2, chúng tôi nhận thấy số lượng mô lá sống sót trên môi trường chọn lọc giảm dần theo thời gian, điều này cho thấy khả năng những mô lá tồn tại và phát triển được là những mô mang các tế bào đã được chuyển gen. Tuy nhiên, chúng tôi cũng nhận thấy một số lượng lớn các mô sống sót và phát triển trên môi trường chọn lọc nhưng không cảm ứng tạo rễ. Sau 3 - 4 tuần, chỉ có 10/90 mô lá sống sót trên môi trường chọn lọc bắt đầu cảm ứng tạo rễ tơ. Tiến hành nhuộm số rễ thu được trong dung dịch X-gluc ở điều kiện 370C qua đêm, thu được kết quả thể hiện ở hình 3.10. Như vậy thông qua kết quả biểu hiện của gen Gus ở các dòng rễ tơ thuốc lá chuyển gen, có thể tạm thời kết luận, phương pháp chúng tôi đang tiến hành có khả năng thành công cao với tỉ lệ cảm ứng tạo rễ tơ chuyển gen là 5% (10/200). Hệ thống nuôi cấy và tạo rễ tơ chuyển gen ở thuốc lá để sản xuất các dược phẩm sinh học tái tổ hợp đã được sử dụng trong rất nhiều nghiên cứu [28], [31], [69]. Phương pháp nuôi cấy đơn giản, không đòi hỏi nhiều thời gian: trong khoảng từ 3-4 tuần có thể tạo được các dòng rễ tơ chuyển gen ổn định; và sau 6-8 tuần có thể đưa vào nuôi cấy lỏng tạo sinh khối để sản xuất các protein tái tổ hợp. Phương pháp này cũng có thể được sử dụng để thử nghiệm các cấu trúc gen mới biểu hiện trong các tế bào thực vật [55]. Trong giới hạn nghiên cứu của đề tài, chúng tôi tiếp tục nghiên cứu tạo rễ tơ thuốc lá chuyển gen HA1 thông qua A.rhizogenes. Hình 3.10. Kết quả biến nạp A. rhizogens mang vector pPTN289/Gus A. Rễ âm tính B. Rễ dương tính (chuyển xanh do gen Gus) 3.5. Kết quả chuyển gen HA1 vào mảnh lá thông qua A. rhizogens để tạo các dòng rễ tơ chuyển gen HA1 Để chuẩn bị cho thí nghiệm này, chúng tôi cũng tiến hành cảm ứng mảnh lá cây thuốc lá trong môi trường WPM trước 2 ngày. Đồng thời, chúng tôi tiến hành nuôi khuẩn A. rhizogens mang vector pK7WG2D/HA1 trong môi trường YMP bổ sung kháng sinh spectinomycin 100 mg/L. Hình 3.11. Mảnh lá cảm ứng trong môi trường WPM Sau hai ngày cảm ứng, các mảnh lá được sử dụng để biến nạp (mục 2.2.6). Các mảnh lá được nuôi cộng sinh từ 2-3 ngày và được cấy chuyển các mảnh lá sang môi trường WPM có bổ sung kháng sinh Cefotaxim 500 mg/L và kanamycin 100 mg/L để chọn lọc. Tỷ lệ chọn lọc và hình ảnh của các mảnh lá trên môi trường chọn lọc được thể hiện qua bảng 3.3 và hình 3.10. Bảng 3.3. Tỷ lệ mô lá chuyển gen pK7WG2D/cal/HA1 trên môi trường chọn lọc Tổng số mô lá Số mô sống sót sau 1 tuần Số mô sống sót sau 2 tuần Số mô sống sót sau 3 tuần 200 143 97 92 Qua bảng 3.3, tương tự như kết quả chuyển gen chỉ thị Gus, số lượng mô lá sống sót trên môi trường chọn lọc giảm dần theo thời gian, và hiện nay (sau 3 tuần) một vài mô lá sống sót bắt đầu cảm ứng tạo rễ tơ (hình 3.11). Các dòng rễ tơ này sẽ tiếp tục được kiểm tra bằng các kỹ thuật sinh học phân tử như PCR và lai miễn dịch. Các dòng rễ tơ chuyển gen sẽ được chuyển sang nuôi cấy lỏng tạo sinh khối để tách chiết protein HA1 tái tổ hợp. Trong nghiên cứu này, chúng tôi đã sử dụng trình tự nucleotide tín hiệu Calreticulin ở đầu 5’ của gen HA1, đoạn tín hiệu này có chức năng dẫn protein tái tổ hợp biểu hiện ra môi trường nuôi cấy giúp làm đơn giản hơn rất nhiều trong quá trình tinh sạch các protein tái tổ hợp ở các bước tiếp theo [55]. Hình 3.10. Mô lá chuyển gen pK7WG2D/HA1 trên môi trường chọn lọc Hình 3.11. Rễ tơ ở các mô lá chuyển gen KẾT LUẬN VÀ KIẾN NGHỊ I. Kết luận 1. Đã ghép nối thành công gen HA1 mã hóa tiểu phần protein vỏ virus H5N1 vào vector pENTR221/cal, tạo vector tái tổ hợp pENTR/cal/HA1. 2. Đã thiết kế được vector chuyển gen vào thực vật - pK7WG2D/cal/HA1- mang cấu trúc gen mã hóa protein vỏ của virus H5N1 bằng kỹ thuật lai Gateway phục vụ cho mục đích chuyển gen tạo vaccine thực vật. Vector này đã được biến nạp thành công vào vi khuẩn A.rhizogenes ATCC15834 để tạo các dòng rễ tơ chuyển gen biểu hiện vaccine tái tổ hợp HA1. 3. Đã kiểm tra khả năng thành công của quy trình chuyển gen tạo rễ tơ thông qua A.rhizogens sử dụng vector chuyển gen pPTN289 mang gen chỉ thị gus. Kết quả đã thu được các dòng rễ tơ mang gen gus với tỉ lệ cảm ứng tạo rễ tơ chuyển gen là 5%. 4. Thành công bước đầu trong việc chuyển gen HA1 vào cây thuốc lá tạo rễ tơ thông qua A. rhizogenes. Đã chọn lọc được 92 mô sống sót sau 3 tuần nuôi cấy trên môi trường chọn lọc, trong số đó 3 mô đã bắt đầu cảm ứng tạo rễ tơ trên môi trường chọn lọc. II. Kiến nghị Để tiếp tục phát triển các kết quả nghiên cứu, chúng tôi đề xuất một số kiến nghị như sau: 1. Tiếp tục sàng lọc và đánh giá khả năng chuyển gen và mức độ biểu hiện của protein HA1 ở rễ tơ thuốc lá chuyển gen. 2. Sử dụng vector chuyển gen pK7WG2D/cal/HA1 đã thiết kế thành công để chuyển vào các cây trồng khác (cây họ cà, họ bầu bí, họ đậu vv…) tạo ra sự đa dạng và nâng cao hiệu suất trong việc tạo vaccine thực vật. TÀI LIỆU THAM KHẢO I. Tài liệu tiếng Việt 1. Bùi Quang Anh (2006), Báo cáo tình hình cúm gia cầm tại Việt Nam, Hội nghị phòng chống dịch cúm gia cầm do Bộ Nông nghiệp và phát triển Nông thôn. 2. Lê Trần Bình (2008), Phát triển cây trồng chuyển gen ở Việt Nam, Bộ sách chuyên khảo, NXB Khoa học và Công nghệ. 3. Lê Trần Bình (2003), Tài liệu thực hành công nghệ tế bào thực vật, Phòng Công nghệ tế bào thực vật, Viện Công nghệ Sinh học. 4. Lê Trần Bình, Hồ Hữu Nhị, Lê Thị Muội (1997), Công nghệ sinh học thực vật trong cải tiến giống cây trồng, NXB Nông nghiệp, Hà Nội. 5. Lê Tấn Đức, Nguyễn Hữu Hổ, Nguyễn Văn Uyển (2003), Tạo cây Hông (Paulownia fortune) chuyển gen kháng sâu thông qua Agrobacterium. 6. Trần Thị Cúc Hòa, Lê Trần Bình, Bùi Bá Bổng (2004), Chuyển nạp gen kháng sâu cryIAb và cryIAc vào các giống lúa bằng phương pháp Agrobacterium và chọn lọc Mannose, Nông nghiệp-Nông thôn-Môi trường, 6, tr. 21-26. 7. Nguyễn Ánh Hồng (2000), Cơ sở Khoa học Công nghệ chuyển gen ở thực vật, NXB Nông nghiệp Hà Nội. 8. Lê Đình Lương (2002), Nguyên lý kỹ thuật di truyền, NXB Khoa học và kỹ thuật, Hà Nội. 9. Chu Văn Mẫn (2003), Ứng dụng tin học trong sinh học, NXB Đại học Quốc Gia, Hà Nội. 10. Đỗ Tiến Phát, Đinh Thị Phòng, Chu Hoàng Hà (2008), Đánh giá ảnh hưởng của thời gian nhiễm khuẩn tới hiệu quả chuyển gene vào cây bông (Gossypium hirsutum L) thông qua Agrobacterium tumefaciens, Tạp chí Công nghệ sinh học, 6(4A), tr. 689-695. 11. Nguyễn Đức Thành (2003), Chuyển gen ở thực vật, NXB Khoa học và kỹ thuật, Hà Nội. 12. Nguyễn Đức Thành (2000), Nuôi cấy mô tế bào thực vật - Nghiên cứu và ứng dụng, NXB Nông nghiệp, Hà Nội. 13. Lê Duy Thành (2001), Cơ sở di tryền chọn giống thực vật, NXB Khoa học và kỹ thuật, Hà Nội. 14. Phạm Thị Vân, Nguyễn Văn Bắc, Lê Văn Sơn, Chu Hoàng Hà, Lê Trần Bình (2008), Tạo cây thuốc lá kháng bệnh khảm dưa chuột bằng ký thuật RNAi, Công nghệ sinh học, 6(4A), tr. 679-687. 15. Hà Minh Trung, Vũ Đình Phú, Ngô Vĩnh Viễn, Mai Thị Liên (2002), Công nghệ tuyển chọn và nhân giống cây có múi sạch bệnh, Cục trồng trọt, Bộ Nông nghiệp và Phát triển Nông thôn. II. Tài liệu tiếng Anh 16. Alam, K., M.N. Nagi, O.A. Badary, O.A. Al-Shabanah, A.C. Al-Rikabi, and A.M. Al-Bekairi (1999), The protective action of thymol against carbon tetrachloride hepatotoxicity in mice, Pharmacol Res, 40(2): p. 159-63. 17. Alexander, D.J. (2007), Summary of avian influenza activity in Europe, Asia, Africa, and Australasia, 2002-2006. Avian Dis, 51(1 Suppl): p. 161-6. 18. Basler, C. (2007), Influenza viruses: basic biology and potential drug targets, Infect Disord Drug Targets, 7(4): p. 282-93. 19. Bosch, F., M. Orlich, H. Klenk, and R. Root (1979), The structure of the hemagglutinin: a determinant for the pathgencity of Influenza virus, Virology, 95: p. 197-207. 20. Britton, M.T., M.A. Escobar, and A.M. Dandekar (2008), The oncogenes of Agrobacterium tumefaciens and Agrobacterium rhizogenes in Agrobacterium: From Biology to Biotechnology, T. Tzfira and V. Citovsky, Editors. Springer: New York, p. 524-65. 21. Chen, H., G. Deng, Z. Li, G. Tian, Y. Li, and P. Jiao (2004), The evolution of H5N1 influenza viruses in ducks in southern China, Proc Natl Acad Sci USA, 101: p. 10452-10457. 22. Chen, L., C. Davis, H. Zhou, N. Cox, and R. Donis (2008), Genetic compatibility and virulence of reassortants derived from contemporary avian H5N1 and human H3N2 influenza A viruses. PLoS Pathog, 4(5): p. e1000072. 23. Chilton, M.D., and e. al. (1982), Agrobacterium rhizogenes inserts T-DNA into the genomes of the host plant root cells, Nature, p.432-34. 24. Christey and M.C. (2001), Use of Ri-mediated transformation for production of transgenic plants. In Vitro Cell, Dev, Biol-Plant, p. 687-700. 25. de Wit, E. and R.A.M. Fouchier (2008), Emerging influenza, J Clin Virol, 41: p. 1-6. 26. Doherty, P., S. Turner, R. Webby, and P. Thomas (2006), Influenza and the challenge for immunology. Nat Immunol, 7(5): p. 449-55. 27. Doran, P.M. (2000), Foreign protein production in plant tissue cultures. Curr Opin Biotechnol, 11(2): p. 199-204. 28. Drake PMW, Chargelegue DM, Vine ND, van Dolleweerd CJ, Obregon P, and M. JKC (2003), Rhizosecretion of a monoclonal antibody protein complex from transgenic tobacco roots. Plant Molecular Biology, 52(1): p. 233-241. 29. Drake, P.M.W., D.M. Chargelegue, N.D. Vine, C.J. van Dolleweerd, P. Obregon, and J.K.C. Ma (2003), Rhizosecretion of a monoclonal antibody protein complex from transgenic tobacco roots. Plant Molecular Biology, 52(1): p. 233-241. 30. Gambotto, A., S. Barratt-Boyes, M.d. Jong, G. Neumann, and Y. Kawaoka (2008), Human infection with highly pathogenic H5N1 influenza virus. Lancet, 371(9622): p. 1464-1475. 31. Gaume A, Komarnytsky S, Borisjuk N, and R. I (2003), Rhizosecretion of recombinant proteins from plant hairy roots. Plant Cell Rep, 21(12): p. 1188-1193. 32. Gaume, A., S. Komarnytsky, N. Borisjuk, and I. Raskin (2003), Rhizosecretion of recombinant proteins from plant hairy roots. Plant Cell Rep, 21(12): p. 1188-93. 33. Hellwig, S., J. Drossard, R.M. Twyman, and R. Fischer (2004), Plant cell cultures for the production of recombinant proteins. Nat Biotechnol, 22(11): p. 1415-22. 34. Hilleman, M. (2002), Realities and enigmas of human viral influenza: pathogenesis, epidemiology and control. Vaccine, 20(25-26): p. 3068-3087. 35. Hoa, L.T., D.D. Khang, P.V. Chi, N.V. Hai, T.N. Hai, N.T.B. Nga, and L.T. Binh (2006), Molecular characterization of the H5 gene for the highly pathogenic A/H5N1 strains isolated in Vietnam during 2004 - 2006. Proceedings of International Workshop on Biotechnology in Agriculture, p. 68-71. 36. Horimoto, T. and Y. Kawaoka (2001), Pandemic threat posed by avian influenza A viruses. Clin Microbiol Rev, 14: p. 129-149. 37. Horimoto, T. and Y. Kawaoka (2006), Strategies for developing vaccines against H5N1 influenza A viruses. Trends Mol Med, 12(11): p. 506-514. 38. Hulse-Post, D., K. Sturm-Ramirez, J. Humberd, P. Seiler, E. Govorkova, S. Krauss, C. Scholtissek, P. Puthavathana, C. Buranathai, T. Nguyen, H. Long, T. Naipospos, H. Chen, T. Ellis, Y. Guan, J. Peiris (2005), Role of domestic ducks in the propagation and biological evolution of highly pathogenic H5N1 influenza viruses in Asia. Proc Natl Acad Sci USA, 102(30): p. 10682-10687. 39. Jin, U.H., J.A. Chun, J.W. Lee, Y. Young Byung, S.W. Lee, and C.H. Chung (2004), Expression and characterization of extracellular fungal phytase in transformed sesame hairy root cultures. Protein Expr Purif, 37(2): p. 486-92. 40. Keawcharoen, J., A. Amonsin, K. Oraveerakul, S. Wattanodorn, T. Papravasit, S. Karnda, K. Lekakul, R. Pattanarangsan, S. Noppornpanth, R. Fouchier, A. Osterhaus, S. Payungporn, A. Theamboonlers, and Y. Poovorawan (2005), Characterization of the hemagglutinin and neuraminidase genes of recent influenza virus isolates from different avian species in Thailand. Acta Virol, 49(4): p. 277-280. 41. Kelly, T.R., M.G. Hawkins, C.E. Sandrock, and W.M. Boyce (2008), A review of highly pathogenic avian influenza in birds, with an emphasis on Asian H5N1 and recommendations for prevention and control. J Avian Med Surg, 22(1): p. 1-16. 42. Kodihalli, S., H. Goto, D. Kobasa, S. Krauss, Y. Kawaoka, and R. Webster (1999), DNA vaccine encoding hemagglutinin provides protective immunity against H5N1 influenza virus infection in mice. J Virol, 73: p. 2094-2098. 43. Krug, R. M, W. Yuan, D.L. Noah, and A.G. Latham (2003), Intracellular warfare between human influenza viruses and human cells: the roles of the viral NS1 protein. Virology, 309: p. 181 – 189. 44. Le, Q., M. Kiso, K. Someya, Y. Sakai, T. Nguyen, K. Nguyen, N. Pham, H. Nguyen, S. Yamada, Y. Muramoto, T. Horimoto, A. Takada, H. Goto, T. Suzuki, Y. Suzuki, and Y. Kawaoka (2005), Avian flu: isolation of drug-resistant H5N1 virus. Nature, 437(7062): p. 1108. 45. Li, K., Y. Guan, J. Wang, G. Smith, K. Xu, and L. Duan (2004), Genesis of a highly pathogenic and potentially pandemic H5N1 influenza virus in eastern Asia. Nature, 430: p. 209-213. 46. Luong, G. and P. Palese (1992), Genetic analysis of influenza virus. Curr Opinion Gen Develop, 2: p. 77-81. 47. Medina-Bolivar, F., R. Wright, V. Funk, D. Sentz, L. Barroso, T.D. Wilkins, W. Petri, Jr., and C.L. Cramer (2003), A non-toxic lectin for antigen delivery of plant-based mucosal vaccines. Vaccine, 21(9-10): p. 997-1005. 48. Munster, V.J., C. Baas, P. Lexmond, T.M. Bestebroer, J. Guldemeester, W.E. Beyer, E. de Wit, M. Schutten, G.F. Rimmelzwaan, A.D. Osterhaus, and R.A. Fouchier (2009), Practical considerations for high-throughput influenza A virus surveillance studies of wild birds by use of molecular diagnostic tests. J Clin Microbiol, 47(3): p. 666-73. 49. Murphy, B. and R. Webster (1996), Orthomyxoviruses. Lippincott-Raven Publishers, p. 1397-1445. 50. Nayak, D., E. Hui, and S. Barman (2004), Assembly and budding of influenza virus. Virus Res, 106(2): p. 147-165. 51. Neumann, G, M.A. Whitt, and Y. Kawaoka (2002), A decade after the generation of a negative-sense RNA virus from cloned cDNA – What have we learned. Journal of General Virology, 83: p. 2635 – 62. 52. Neumann, G. and Y. Kawaoka (1999), Genetic engineering of influenza and other negative-strand RNA viruses containing segmented genomes. Advances in Virus Research, 53: p. 265 – 300. 53. Nicholson, K., J. Wood, and M. Zambon (2003), Influenza. Lancet, 362: p. 1733-1745. 54. Palazón, J., and e. al. (1997), Effect of rol genes from Agrobacterium rhizogenes TL-DNA on nicotine production in tobacco root cultures. Plant Physiol Biochem, 35: p. 155-62. 55. Pham NB. (2009), Production and secretion of recombinant sweet-tasting thaumatin from suspension cells and hairy roots of Nicotiana tabacum. University of Heidelberg, PhD Thesis. 56. Sevon, N. and K.M. Oksman-Caldentey (2002), Agrobacterium rhizogenes-mediated transformation: root cultures as a source of alkaloids. Planta Med, 68(10): p. 859-68. 57. Subbarao, K. and C. Luke (2007), H5N1 viruses and vaccines. PLoS Pathog, 3(3): p. e40. 58. Suzuki, Y (2005)., Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses. Biol Pharm Bull, 28(3): p. 399-408. 59. Tian, G., S. Zhang, Y. Li, Z. Bu, P. Liu, J. Zhou, C. Li, J. Shi, K. Yu, and H. Chen (2005), Protective efficacy in chickens, geese and ducks of an H5N1-inactivated vaccine developed by reverse genetics. Virology, 341(1)(153-162). 60. Uiprasertkul, M., R. Kitphati, P. Puthavathana, R. Kriwong, A. Kongchanagul, K. Ungchusak, S. Angkasekwinai, K. Chokephaibulkit, K. Srisook, N. Vanprapar, and P. Auewarakul (2007), Apoptosis and pathogenesis of avian influenza A (H5N1) virus in humans. Emerg Infect Dis, 13(5): p. 708-712. 61. Urnovitz, H.B. and W.H. Murphy (1996), Human endogenous retroviruses: nature, occurrence, and clinical implications in human disease. Clin Microbiol Rev, 9(1): p. 72-99. 62. Wagner, R., M. Matrosovich, and H. Klenk (2002), Functional balance between haemagglutinin and neuraminidase in influenza virus infections. Med Virol, 12(3): p. 159-166. 63. Wagner, R., M. Matrosovich, and H.D. Klenk (2002), Functional balance between haemagglutinin and neuraminidase in influenza virus infections. Rev Med Virol, 12(3): p. 159-66. 64. Weber, T. and N. Stilianakis (2007), Ecologic immunology of avian influenza (H5N1) in migratory birds. Emerg Infect Dis, 13(8): p. 1139-1143. 65. Webster, R.G. (1998), Influenza: an emerging disease. Emerg Infect Dis, 4(3): p. 436-41. 66. Webster, R.G., Y. Guan, M. Peiris, D. Walker, S. Krauss, N.N. Zhou, E.A. Govorkova, T.M. Ellis, K.C. Dyrting, T. Sit, D.R. Perez, and K.F. Shortridge (2002), Characterization of H5N1 influenza viruses that continue to circulate in geese in southeastern China. J Virol, 76: p. 118-126. 67. Weiss, R.A. (2003), Cross-species infections. Curr Top Microbiol Immunol, 278: p. 47-71. 68. Wongsamuth, R., and P.M. Doran (1997), Production of monoclonal antibodies by tobacco hairy roots. Biotechnol Bioeng, 54(5): p. 401-415. 69. Wongsamuth, R. and P. Doran (1997), Production of monoclonal antibodies by tobacco hairy roots. Biotechnol Bioeng, 54(5): p. 401-415. 70. Wu, W., Y. Chen, P. Wang, W. Song, S. Lau, J. Rayner, G. Smith, R. Webster, J. Peiris, T. Lin, N. Xia, Y. Guan, and H. Chen (2008), Antigenic profile of avian H5N1 viruses in Asia from 2002 to 2007. J Virol, 282(4): p. 1798-17807. 71. Yamada, S., Y. Suzuki, T. Suzuki, M. Le, C. Nidom, Y. Sakai-Tagawa, Y. Muramoto, M. Ito, M. Kiso, T. Horimoto, KShinya, T. Sawada, M. Kiso, T. Usui, T. Murata, Y. Lin, A. Hay, L. Haire, D. Stevens, R. Russell, S. Gamblin, J. Skehel, and Y. Kawaoka (2006), Haemagglutinin mutations responsible for the binding of H5N1 influenza A viruses to human-type receptors. Nature, 444(7117): p. 378-382. 72. Zhao, Z., K. Shortridge, M.G. M, Y. Guan, and X. Wan (2008), Genotypic diversity of H5N1 highly pathogenic avian influenza viruses. J Gen Virol, 89(9): p. 2182-2193. 73. Zhou, H., M. Jin, Z. Yu, X. Xu, Y. Peng, H. Wu, J. Liu, H. Liu, S. Cao, and H. Chen (2007), Effective small interfering RNAs targeting matrix and nucleocapsid protein gene inhibit influenza A virus replication in cells and mice. Antiviral Res, 76(2): p. 186-93. PHỤ LỤC Phụ lục 1: Thành phần các loại môi trường Môi trường Thành phần YMP đặc 0,4 g/l Yeast extract + 0,5 g/l K2HPO4.3H2O + 10 g/l mannitol + 2 g/l MgSO4.7H2O + 0,1 g/l NaCl + 15 g/l bacto agar, pH = 7 YMP lỏng 0,4 g/l Yeast extract + 0,5 g/l K2HPO4.3H2O + 10 g/l mannitol + 2 g/l MgSO4.7H2O + 0,1 g/l NaCl, pH = 7 LB đặc 5 g/l Yeast extract + 10 g/l Bacto tryptone + 10 g/l NaCl + 15 g/l bacto agar, pH = 7 LB lỏng 5 g/l Yeast extract + 10 g/l Bacto tryptone + 10 g/l NaCl, pH = 7 WPM đặc WPM I (20ml/L) + WPM II (10ml/L) + WPM III (10ml/L) + WPM IV (10ml/L) + WPM V (10ml/L) + 30 g đường + 8 g thạch, pH = 5,8 WPM lỏng WPM I (20ml/L) + WPM II (10ml/L) + WPM III (10ml/L) + WPM IV (10ml/L) + WPM V (10ml/L) + 30 g đường, pH = 5,8 MS đặc 20ml/L MS I + 10ml/L MS II + 10 ml/L MS III + 10 ml/L MS IV + 10 ml/L MS V + 30 g đường + 8 g thạch, pH = 5,8 MS lỏng 20ml/L MS I + 10ml/L MS II + 10 ml/L MS III + 10 ml/L MS IV + 10 ml/L MS V + 30 g đường, pH = 5,8 ½ MS 10 ml/L MS I + 5 ml/L MS II + 5 ml/L MS III + 5 ml/L MS IV + 5 ml/L MS V, pH = 5,8 Phụ lục 2: Sơ đồ các vector chuyển gen dùng trong thí nghiệm - Cấu trúc của vector pENTR 221/cal - Cấu trúc của vector pK7WG2D(1) - Cấu trúc vector pPTN289, nằm trong chủng vi khuẩn Agrobacterium EHA101 Phụ lục 3. Trình tự gen HAop và HA1 a. Trình tự gen HAop (pCU18/HA1) BssHII AscI BamHI BclI GGCGCGCCGGATCCGAAAAGATTGTGCTTTTGCTTGCTATTGTGTCTCTTGTGAAGTCTG 1 ---------+---------+---------+---------+---------+---------+ CCGCGCGGCCTAGGCTTTTCTAACACGAAAACGAACGATAACACAGAGAACACTTCAGAC E__K__I__V__L__L__L__A__I__V__S__L__V__K__S__D BglII ATCAGATCTGCATTGGATACCACGCTAACAACTCTACTGAGCAAGTGGATACAATTATGG 61 ---------+---------+---------+---------+---------+---------+ TAGTCTAGACGTAACCTATGGTGCGATTGTTGAGATGACTCGTTCACCTATGTTAATACC __Q__I__C__I__G__Y__H__A__N__N__S__T__E__Q__V__D__T__I__M__E AAAAGAACGTGACTGTTACTCACGCTCAGGATATTCTTGAAAAGACTCACAACGGAAAGT 121 ---------+---------+---------+---------+---------+---------+ TTTTCTTGCACTGACAATGAGTGCGAGTCCTATAAGAACTTTTCTGAGTGTTGCCTTTCA __K__N__V__T__V__T__H__A__Q__D__I__L__E__K__T__H__N__G__K__L TGTGCGCTCTTGATGGTGTTAAGCCACTTATTCTTAGGGATTGCTCTGTTGCTGGATGGC 181 ---------+---------+---------+---------+---------+---------+ ACACGCGAGAACTACCACAATTCGGTGAATAAGAATCCCTAACGAGACAACGACCTACCG __C__A__L__D__G__V__K__P__L__I__L__R__D__C__S__V__A__G__W__L TTCTTGGAAACCCAATGTGTGATGAGTTCATTAACGTGCCAGAGTGGTCTTATATTGTGG 241 ---------+---------+---------+---------+---------+---------+ AAGAACCTTTGGGTTACACACTACTCAAGTAATTGCACGGTCTCACCAGAATATAACACC __L__G__N__P__M__C__D__E__F__I__N__V__P__E__W__S__Y__I__V__E AflII AGAAGGCTAACCCAGTGAACGATCTTTGCTACCCTGGTGATTTCAACGATTACGAAGAGC 301 ---------+---------+---------+---------+---------+---------+ TCTTCCGATTGGGTCACTTGCTAGAAACGATGGGACCACTAAAGTTGCTAATGCTTCTCG __K__A__N__P__V__N__D__L__C__Y__P__G__D__F__N__D__Y__E__E__L TTAAGCACCTTCTTTCTAGGATTAACCACTTCGAGAAGATTCAGATTATTCCAAAGTCAT 361 ---------+---------+---------+---------+---------+---------+ AATTCGTGGAAGAAAGATCCTAATTGGTGAAGCTCTTCTAAGTCTAATAAGGTTTCAGTA __K__H__L__L__S__R__I__N__H__F__E__K__I__Q__I__I__P__K__S__S CTTGGTCATCTCACGAGGCTTCTCTTGGAGTTTCTTCTGCTTGCCCATACCAGGGAAAGT 421 ---------+---------+---------+---------+---------+---------+ GAACCAGTAGAGTGCTCCGAAGAGAACCTCAAAGAAGACGAACGGGTATGGTCCCTTTCA __W__S__S__H__E__A__S__L__G__V__S__S__A__C__P__Y__Q__G__K__S CATCTTTCTTCAGGAACGTTGTTTGGCTTATTAAGAAGAACTCTACTTACCCAACTATTA 481 ---------+---------+---------+---------+---------+---------+ GTAGAAAGAAGTCCTTGCAACAAACCGAATAATTCTTCTTGAGATGAATGGGTTGATAAT __S__F__F__R__N__V__V__W__L__I__K__K__N__S__T__Y__P__T__I__K BglII EcoRI AGAGGTCTTACAACAACACTAACCAGGAAGATCTTTTGGTTCTTTGGGGAATTCACCACC 541 ---------+---------+---------+---------+---------+---------+ TCTCCAGAATGTTGTTGTGATTGGTCCTTCTAGAAAACCAAGAAACCCCTTAAGTGGTGG __R__S__Y__N__N__T__N__Q__E__D__L__L__V__L__W__G__I__H__H__P CAAATGATGCTGCTGAACAGATTAAGTTGTACCAGAACCCAACTACTTACATTTCTGTGG 601 ---------+---------+---------+---------+---------+---------+ GTTTACTACGACGACTTGTCTAATTCAACATGGTCTTGGGTTGATGAATGTAAAGACACC __N__D__A__A__E__Q__I__K__L__Y__Q__N__P__T__T__Y__I__S__V__G GAACTTCTACTCTTAACCAGAGGCTTGTGCCAAGAATTGCTACTAGGTCTAAGGTGAACG 661 ---------+---------+---------+---------+---------+---------+ CTTGAAGATGAGAATTGGTCTCCGAACACGGTTCTTAACGATGATCCAGATTCCACTTGC __T__S__T__L__N__Q__R__L__V__P__R__I__A__T__R__S__K__V__N__G EcoRI AflII GACAATCTGGAAGGATGGAATTCTTCTGGACTATTCTTAAGCCAAACGATGCTATTAACT 721 ---------+---------+---------+---------+---------+---------+ CTGTTAGACCTTCCTACCTTAAGAAGACCTGATAAGAATTCGGTTTGCTACGATAATTGA __Q__S__G__R__M__E__F__F__W__T__I__L__K__P__N__D__A__I__N__F TCGAGTCTAACGGAAACTTCATTGCTCCAGAGTACGCTTACAAGTTGGTGAAGAAGGGTG 781 ---------+---------+---------+---------+---------+---------+ AGCTCAGATTGCCTTTGAAGTAACGAGGTCTCATGCGAATGTTCAACCACTTCTTCCCAC __E__S__N__G__N__F__I__A__P__E__Y__A__Y__K__L__V__K__K__G__D ScaI ATAGTACTATTATGAAGTCTGAGCTTGAGTACGGAAACTGCAACACTAAGTGCCAAACTC 841 ---------+---------+---------+---------+---------+---------+ TATCATGATAATACTTCAGACTCGAACTCATGCCTTTGACGTTGTGATTCACGGTTTGAG __S__T__I__M__K__S__E__L__E__Y__G__N__C__N__T__K__C__Q__T__P CAATGGGAGCTATTAACTCTTCTATGCCATTCCACAACATTCACCCACTTACTATTGGAG 901 ---------+---------+---------+---------+---------+---------+ GTTACCCTCGATAATTGAGAAGATACGGTAAGGTGTTGTAAGTGGGTGAATGATAACCTC __M__G__A__I__N__S__S__M__P__F__H__N__I__H__P__L__T__I__G__E AGTGCCCAAAGTACGTGAAGTCTAACAGGCTTGTGCTTGCTACTGGACTTAGGAACTCTC 961 ---------+---------+---------+---------+---------+---------+ TCACGGGTTTCATGCACTTCAGATTGTCCGAACACGAACGATGACCTGAATCCTTGAGAG __C__P__K__Y__V__K__S__N__R__L__V__L__A__T__G__L__R__N__S__P CACAGAGAGAAAGAAGGGGACTTTTCGGAGCTATTGCTGGATTCATTGAGGGAGGATGGC 1021 ---------+---------+---------+---------+---------+---------+ GTGTCTCTCTTTCTTCCCCTGAAAAGCCTCGATAACGACCTAAGTAACTCCCTCCTACCG __Q__R__E__R__R__G__L__F__G__A__I__A__G__F__I__E__G__G__W__Q AGGGAATGGTTGATGGATGGTACGGATACCATCACTCTAACGAGCAAGGATCTGGATATG 1081 ---------+---------+---------+---------+---------+---------+ TCCCTTACCAACTACCTACCATGCCTATGGTAGTGAGATTGCTCGTTCCTAGACCTATAC __G__M__V__D__G__W__Y__G__Y__H__H__S__N__E__Q__G__S__G__Y__A CTGCTGATAAGGAATCTACTCAGAAAGCTATTGATGGTGTTACTAACAAGGTGAACTCTA 1141 ---------+---------+---------+---------+---------+---------+ GACGACTATTCCTTAGATGAGTCTTTCGATAACTACCACAATGATTGTTCCACTTGAGAT __A__D__K__E__S__T__Q__K__A__I__D__G__V__T__N__K__V__N__S__I BstBI TTATTGATAAGATGAACACTCAGTTCGAAGCTGTTGGAAGAGAGTTCAACAACCTTGAGA 1201 ---------+---------+---------+---------+---------+---------+ AATAACTATTCTACTTGTGAGTCAAGCTTCGACAACCTTCTCTCAAGTTGTTGGAACTCT __I__D__K__M__N__T__Q__F__E__A__V__G__R__E__F__N__N__L__E__R GAAGGATTGAGAACCTTAACAAGAAAATGGAAGATGGATTCCTTGATGTGTGGACTTACA 1261 ---------+---------+---------+---------+---------+---------+ CTTCCTAACTCTTGGAATTGTTCTTTTACCTTCTACCTAAGGAACTACACACCTGAATGT __R__I__E__N__L__N__K__K__M__E__D__G__F__L__D__V__W__T__Y__N ACGCTGAGTTGCTTGTGCTTATGGAAAACGAGAGGACTCTTGATTTCCACGATTCTAACG 1321 ---------+---------+---------+---------+---------+---------+ TGCGACTCAACGAACACGAATACCTTTTGCTCTCCTGAGAACTAAAGGTGCTAAGATTGC __A__E__L__L__V__L__M__E__N__E__R__T__L__D__F__H__D__S__N__V TGAAGAACCTTTACGATAAAGTGAGGCTTCAGCTTAGGGATAACGCTAAAGAGCTTGGAA 1381 ---------+---------+---------+---------+---------+---------+ ACTTCTTGGAAATGCTATTTCACTCCGAAGTCGAATCCCTATTGCGATTTCTCGAACCTT __K__N__L__Y__D__K__V__R__L__Q__L__R__D__N__A__K__E__L__G__N BglII ACGGTTGCTTCGAGTTCTACCACAAGTGCGATAACGAGTGCATGGAATCTGTGAGATCTG 1441 ---------+---------+---------+---------+---------+---------+ TGCCAACGAAGCTCAAGATGGTGTTCACGCTATTGCTCACGTACCTTAGACACTCTAGAC __G__C__F__E__F__Y__H__K__C__D__N__E__C__M__E__S__V__R__S__G ScaI AflII GAACTTACGATTACCCACAGTACTCTGAAGAAGCTAGGCTTAAGAGGGAAGAGATTTCTG 1501 ---------+---------+---------+---------+---------+---------+ CTTGAATGCTAATGGGTGTCATGAGACTTCTTCGATCCGAATTCTCCCTTCTCTAAAGAC __T__Y__D__Y__P__Q__Y__S__E__E__A__R__L__K__R__E__E__I__S__G GTGTTAAGTTGGAGTCTATTGGTATTTACCAGATTCTTTCTATTTACTCTACTGTGGCTT 1561 ---------+---------+---------+---------+---------+---------+ CACAATTCAACCTCAGATAACCATAAATGGTCTAAGAAAGATAAATGAGATGACACCGAA __V__K__L__E__S__I__G__I__Y__Q__I__L__S__I__Y__S__T__V__A__S CTTCTCTTGCTCTTGCTATTATGGTGGCTGGACTTTCTCTTTGGATGTGCTCTAACGGAT 1621 ---------+---------+---------+---------+---------+---------+ GAAGAGAACGAGAACGATAATACCACCGACCTGAAAGAGAAACCTACACGAGATTGCCTA __S__L__A__L__A__I__M__V__A__G__L__S__L__W__M__C__S__N__G__S BamHI PacI CTCTTCAGTGCAGGATCTGCATTGGATCCTTAATTAA 1681 ---------+---------+---------+------- GAGAAGTCACGTCCTAGACGTAACCTAGGAATTAATT __L__Q__C__R__I__C__I__ b. Trình tự gen HA1 10 20 30 40 50 60 GATCAGATCT GCATTGGATA CCACGCTAAC AACTCTACTG AGCAAGTGGA TACAATTATG 70 80 90 100 110 120 GAAAAGAACG TGACTGTTAC TCACGCTCAG GATATTCTTG AAAAGACTCA CAACGGAAAG 130 140 150 160 170 180 TTGTGCGCTC TTGATGGTGT TAAGCCACTT ATTCTTAGGG ATTGCTCTGT TGCTGGATGG 190 200 210 220 230 240 CTTCTTGGAA ACCCAATGTG TGATGAGTTC ATTAACGTGC CAGAGTGGTC TTATATTGTG 250 260 270 280 290 300 GAGAAGGCTA ACCCAGTGAA CGATCTTTGC TACCCTGGTG ATTTCAACGA TTACGAAGAG 310 320 330 340 350 360 CTTAAGCACC TTCTTTCTAG GATTAACCAC TTCGAGAAGA TTCAGATTAT TCCAAAGTCA 370 380 390 400 410 420 TCTTGGTCAT CTCACGAGGC TTCTCTTGGA GTTTCTTCTG CTTGCCCATA CCAGGGAAAG 430 440 450 460 470 480 TCATCTTTCT TCAGGAACGT TGTTTGGCTT ATTAAGAAGA ACTCTACTTA CCCAACTATT 490 500 510 520 530 540 AAGAGGTCTT ACAACAACAC TAACCAGGAA GATCTTTTGG TTCTTTGGGG AATTCACCAC 550 560 570 580 590 600 CCAAATGATG CTGCTGAACA GATTAAGTTG TACCAGAACC CAACTACTTA CATTTCTGTG 610 620 630 640 650 660 GGAACTTCTA CTCTTAACCA GAGGCTTGTG CCAAGAATTG CTACTAGGTC TAAGGTGAAC 670 680 690 700 710 720 GGACAATCTG GAAGGATGGA ATTCTTCTGG ACTATTCTTA AGCCAAACGA TGCTATTAAC 730 740 750 760 770 780 TTCGAGTCTA ACGGAAACTT CATTGCTCCA GAGTACGCTT ACAAGTTGGT GAAGAAGGGT 790 800 810 820 830 840 GATAGTACTA TTATGAAGTC TGAGCTTGAG TACGGAAACT GCAACACTAA GTGCCAAACT 850 860 870 880 890 900 CCAATGGGAG CTATTAACTC TTCTATGCCA TTCCACAACA TTCACCCACT TACTATTGGA 910 920 930 940 950 960 GAGTGCCCAA AGTACGTGAA GTCTAACAGG CTTGTGCTTG CTACTGGACT TAGGAACTCT 970 CCACAGAGAG AAAGAAGG MỤC LỤC LỜI CAM ĐOAN …………………………………………………………...i LỜI CẢM ƠN ………………………………………………………………ii MỤC LỤC …………………………………………………………………iii DANH MỤC CHỮ VIẾT TẮT ……………………………………………vi DANH MỤC CÁC BẢNG ………………………………………………..vii DANH MỤC CÁC HÌNH ………………………………………………..viii MỞ ĐẦU 1 CHƯƠNG 1. TỔNG QUAN TÀI LIỆU 3 1.1. Cúm A/H5N1 3 1.1.1. Cấu tạo 3 1.1.2. Độc lực và tính thích ứng vật chủ 5 1.1.3. Khả năng gây bệnh của virus cúm A/H5N1 7 1.1.4. Cơ chế xâm nhiễm gây bệnh của virus cúm A trong tế bào vật chủ 8 1.2. Kháng nguyên HA 10 1.3. Tình hình nghiên cứu cúm A và vấn đề nghiên cứu vaccine cúm A/H5N1 ở Việt Nam và trên thế giới 12 1.3.1. Tình hình nghiên cứu cúm A/H5N1 ở Việt Nam và trên thế giới.. 12 1.3.2. Nghiên cứu phát triển vaccine cúm A/H5N1 ở Việt Nam và trên thế giới 16 1.4. Kỹ thuật chuyển gen thông qua A.rhizogens và ứng dụng 19 1.4.1. Giới thiệu vi khuẩn A.rhizogens 19 1.4.2. Hệ vector nhị thể 21 1.4.3. Ứng dụng nuôi cấy rễ tơ trong sản xuất dược phẩm sinh học tái tổ hợp 23 CHƯƠNG 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 25 2.1. Vật liệu, hóa chất và thiết bị 25 2.1.1. Vật liệu 25 2.1.2. Hóa chất 25 2.1.3. Thiết bị 26 2.2. Phương pháp nghiên cứu 26 2.2.1. Phương pháp nhân đoạn gen HA1bằng kỹ thuật PCR 26 2.2.2. Phương pháp ghép nối đoạn gen HA1vào pENTR221/cal 28 2.2.3. Biến nạp sản phẩm ghép nối gen vào tế bào khả biến E. coli DH-5α bằng phương pháp sốc nhiệt 30 2.2.4. Tạo vector chuyển gen bằng kỹ thuật Gateway 32 2.2.5. Biến nạp vector chuyển gen vào A. rhizogenes ATCC15834 35 2.2.6. Chuyển cấu trúc mang gen mã hóa protein vỏ virus vào thuốc lá thông qua vi khuẩn A. rhizogenes ATCC15834 36 2.2.7. Phương pháp đánh giá cây trồng chuyển gen 37 2.2.8. Phương pháp xử lý số liệu ………………………………………. 39 CHƯƠNG 3. KẾT QUẢ VÀ THẢO LUẬN 40 3.1. Kết quả tách dòng gen HA1 40 3.1.1. Kết quả PCR nhân đoạn gen HA1 40 3.1.2. Kết quả tinh sạch sản phẩm PCR 41 3.1.3. Ghép nối đoạn gen HA1 vào vector pENTR/cal 42 3.2. Thiết kế vector tái tổ hợp mang gen HA1 bằng kỹ thuật Gateway®. 47 3.2.1. Tạo vector tái tổ hợp theo phản ứng LR 47 3.2.2. Kết quả kiểm tra vector tái tổ hợp bằng phản ứng colony-PCR 48 3.2.3. Kết quả kiểm tra vector tái tổ hợp bằng enzyme giới hạn 48 3.3. Kết quả biến nạp pK7WG2D/cal/HA1 vào vi khuẩn A.rhizogenes 49 3.4. Kiểm tra hệ thống tạo rễ tơ chuyển gen thông qua A.rhizogenes sử dụng gen chỉ thị Gus 51 3.5. Kết quả chuyển gen HA1 vào mảnh lá thông qua A. rhizogens để tạo các dòng rễ tơ chuyển gen HA1 53 KẾT LUẬN VÀ KIẾN NGHỊ 56 TÀI LIỆU THAM KHẢO 57 PHỤ LỤC …………………………………………………………………. 66

Các file đính kèm theo tài liệu này:

  • docThiết kế vector mang gen HA1 mã hóa protein bề mặt của virus H5N1.doc
Luận văn liên quan