Đề tài Ứng dụng kỹ thuật multiplex – PCR để phát hiện các gen độc lực của vi khuẩn escherichia coli phân lập từ phân bò, phân heo tiêu chảy và thịt bò

TÓM TẮT Đề tài được thực hiện nhằm xác định các gen độc lực stx1, stx2, eae, hly, lt-I, sta, stb, vt2e của vi khuẩn E. coli được phân lập từ 27 mẫu phân tiêu chảy của bò, heo, bê và 9 mẫu bề mặt thịt bò bằng kỹ thuật multiplex – PCR. Ghi nhận được khuẩn lạc hồng trên môi trường MAC; trên SMAC có 2 loại: khuẩn lạc hồng và khuẩn lạc trắng; khuẩn lạc trắng trên CT-SMAC. Mỗi nhóm chọn khoảng 6 – 10 khuẩn lạc riêng lẻ. Ly trích DNA theo nhóm khuẩn lạc và từng khuẩn lạc riêng lẻ theo phương pháp nhiệt. Kết quả multiplex - PCR được ghi nhận như sau: (1) Nhóm khuẩn lạc có mang gen độc lực thì chưa chắc từng khuẩn lạc riêng lẻ có mang gen độc lực đó. (2) Tần số phát hiện các gen độc lực của E. coli từ những mẫu phân tiêu chảy lần lượt là: 25% trên phân bò tiêu chảy (stx2, hly), 30% trên phân bê tiêu chảy (stx1, stx2, hly, eae), 88,89% trên phân heo tiêu chảy (stb, lt, vt2e, hly, stx1, eae). Điều này chứng tỏ rằng trên cả 3 nhóm đối tượng trên, E. coli mang các gen độc lực có thể là nguyên nhân quan trọng gây tiêu chảy. (3) 9 mẫu bề mặt thịt bò chưa phát hiện được gen độc lực của E. coli. (4) Chưa phát hiện được gen sta trong E. coli phân lập từ 27 mẫu phân tiêu chảy của bò, bê và heo. SUMMARY “Apply multiplex – PCR to detect some virulence genes of Escherichia coli isolated from diarrhea cattle and swine faeces, beef” The study was carried out to detect stx1, stx2, eae, hly, lt-I, sta, stb, vt2e genes of isolated E. coli from 27 diarrhea stools samples of cattles, calves, piglets, and 9 swabs of the beef surface by multiplex – PCR. Observation had one group of pink colony on MAC, white colony on SMAC, pink colony on SMAC, white colony on CT-SMAC. Each colony group was chosen about 6 – 10 separate colonies. DNA of the colony groups and each separate colony were extracted by heat method. The results of multiplex – PCR were showed that: (1) The colony group has virulence genes, the separate colony does or doesn’t have the genes. (2) Frequency of virulence genes of isolated E. coli from diarrhea stools samples was 25% from cattles (stx2, hly), 30% from calves (stx1, stx2, eae, hly), 88,89% from piglets (stb, lt-I, vt2e, hly, stx1, eae). (3) 9 swabs of the beef surface were detected that non virulence genes of E. coli. (4) Sta gene of E. coli isolated from 27 diarrhea cattle, calf, piglet stools samples weren’t detected. MỤC LỤC CHƯƠNG TRANG Trang tựa Lời cảm tạ iii Tóm tắt iv Summary v Mục lục vi Danh sách các chữ viết tắt viii Danh sách các hình x Danh sách các bảng xi 1. ĐẶT VẤN ĐỀ 1 2. TỔNG QUAN 3 2.1. Vi khuẩn E. coli 3 2.1.1. Định nghĩa 3 2.1.2. Nuôi cấy và đặc điểm sinh hóa 3 2.1.3. Yếu tố kháng nguyên 4 2.1.4. Cơ chế chung về khả năng gây tiêu chảy của E. coli 4 2.1.5. Phân loại E. coli 4 2.1.5.1. Nhóm STEC/ VTEC/ EHEC 4 2.1.5.2. Nhóm EPEC 7 2.1.53. Nhóm ETEC 8 2.2. Kỹ thuật PCR 11 2.2.1. Nguyên tắc 11 2.2.2. Các giai đoạn của phản ứng PCR 12 2.2.3. Các thành phần của phản ứng PCR 14 2.2.4. Phân tích kết quả PCR 15 2.2.5. Những ứng dụng của PCR 15 2.2.5.1. PCR được sử dụng để nghiên cứu lượng DNA nhỏ 15 2.2.5.2. PCR được sử dụng trong chẩn đoán lâm sàng 16 2.2.5.3. PCR được dùng để khuếch đại RNA 16 2.2.5.4. PCR được sử dụng để so sánh các genome khác nhau 17 2.2.6. Các hạn chế của PCR 17 3. NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 19 3.1. Thời gian và địa điểm thực hiện 19 3.2. Nội dung 19 3.3. Phương pháp nghiên cứu 19 3.3.1. Lấy mẫu 19 3.3.2. Nuôi cấy, phân lập và ly trích DNA của vi khuẩn E. coli 20 3.3.3. Xác định các gen stx1, stx2, eae, hly, stx2e, sta, stb, lt-I của E. coli phân lập được 23 3.3.4. Điện di trên gel aragose và đọc kết quả điện di 25 4. KẾT QUẢ VÀ THẢO LUẬN 27 4.1. Kết quả phân nhóm khuẩn lạc và xác định E. coli từ các khuẩn lạc phân lập được 27 4.1.1. Các loại khuẩn lạc trên môi trường thạch MAC, SMAC, và CT-SMAC 27 4.1.2. Xác định E. coli cho các khuẩn lạc được chọn. 27 4.2. Kết quả phát hiện các gen độc lực của E. coli phân lập được từ phân bò tiêu chảy 28 4.3. Kết quả phát hiện gen độc lực của E. coli phân lập được từ phân heo tiêu chảy 32 4.4. Kết quả phát hiện gen độc lực của E. coli phân lập được từ phân bê tiêu chảy 36 4.5. Kết quả phát hiện các gen độc lực của E. coli phân lập từ mẫu bề mặt thịt bò 38 4.6. Tổng kết kết quả phát hiện các gen độc lực của E. coli trên các mẫu khảo sát 39 5. KẾT LUẬN VÀ ĐỀ NGHỊ 41 5.1. Kết luận 41 5.2. Đề nghị 41 6. TÀI LIỆU THAM KHẢO 42 7. PHỤ LỤC 46 “ỨNG DỤNG KỸ THUẬT MULTIPLEX – PCR ĐỂ PHÁT HIỆN CÁC GEN ĐỘC LỰC CỦA VI KHUẨN ESCHERICHIA COLI PHÂN LẬP TỪ PHÂN BÒ, PHÂN HEO TIÊU CHẢY VÀ THỊT BÒ”.

doc51 trang | Chia sẻ: lvcdongnoi | Ngày: 03/06/2013 | Lượt xem: 2864 | Lượt tải: 3download
Bạn đang xem nội dung tài liệu Đề tài Ứng dụng kỹ thuật multiplex – PCR để phát hiện các gen độc lực của vi khuẩn escherichia coli phân lập từ phân bò, phân heo tiêu chảy và thịt bò, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
của primer, nhiệt độ để biến tính DNA thành dây đơn, hoạt động của enzyme và sự trung thực của kết quả. Nồng độ Mg2+ phải được xác định cho từng phản ứng qua nhiều thử nghiệm. Nồng độ MgCl2 trong hỗn hợp phản ứng cuối cùng thường biến thiên từ 0,5 – 5mM (Hồ Huỳnh Thùy Dương, 1998). 2.2.4. Phân tích kết quả PCR Sản phẩm của phản ứng PCR (đoạn DNA được khuếch đại) sẽ được phát hiện bằng phương pháp điện di. Nguyên tắc của phương pháp điện di là dựa vào đặc tính cấu trúc của các DNA. DNA là các đại phân tử tích điện âm đồng đều trên khắp bề mặt nên khi chịu tác động của một điện trường, chúng sẽ di chuyển về điện cực dương của điện trường. Sự di chuyển của phân tử trong bản gel dưới tác động của một điện trường phụ thuộc vào khối lượng của các phân tử (tức là số nucleotide), nồng độ các thành phần của gel và điện thế. Điện di được thực hiện theo phương nằm ngang hoặc đứng. Các DNA trong gel agarose được hiện ra dưới tia tử ngoại (UV) nhờ ethidium bromide. Chất này có khả năng gắn xen giữa các base của acid nucleic và phát huỳnh quang dưới tác dụng của tia UV (bước sóng =300 nm) thành vạch màu đỏ da cam. Để ước lượng kích thước DNA bằng gel agarose, người ta sử dụng một yếu tố đánh dấu “trọng lượng phân tử” (molecular weight make – MWM) là một tập hợp nhiều trình tự DNA có kích thước đã biết (DNA ladder). 2.2.5. Những ứng dụng của PCR 2.2.5.1. PCR được sử dụng để nghiên cứu lượng DNA nhỏ PCR có khả năng sử dụng một phân tử DNA đơn như là khuôn mẫu cho phản ứng khuếch đại. Việc khuếch đại thành công DNA được ly trích từ tế bào gốc chỉ chứa một copy đơn của bộ gen ở người đã chứng minh được điều này. Khía cạnh này của PCR đã được chứng minh là rất quan trọng trong các phân tích pháp lý, cho phép kỹ thuật genetic fingeprinting được sử dụng chỉ với một sợi tóc và thậm chí với những vết máu, khiến cho những tên tội phạm khó có thể lọt lưới pháp luật. PCR cũng được sử dụng để khuếch đại DNA từ xương của những nạn nhân bị giết (trong một vài trường hợp xác định danh tánh của họ) trong khi các phần thân xác còn lại đã bị phân rã, do đó không thể sử dụng các phương pháp phân tích thông thường. Tính nhạy cảm của PCR mở ra những khả năng mới trong khảo cổ và cổ sinh vật học, bằng cách làm cho các trình tự nucleotide được thu nhận từ các dấu vết DNA hiện diện trong các nguyên liệu được bảo tồn hay nguyên liệu hóa thạch. Phương pháp PCR cũng được sử dụng để nghiên cứu mối quan hệ di truyền của người cổ xưa thông qua khuếch đại và phân tích các trình tự di truyền từ các dấu vết DNA được giữ trong xương hay được bảo tồn trong các xác ướp. 2.2.5.2. PCR được sử dụng trong chẩn đoán lâm sàng Phương pháp PCR cho phép các thông tin giải trình tự được thu nhận một cách nhanh chóng, thông qua việc khuếch đại vùng liên quan trên genome dựa trên các kết quả phân tích trực tiếp từ các sản phẩm của PCR. Khả năng nhận biết đột biến một cách nhanh chóng không chỉ quan trọng trong chẩn đoán lâm sàng mà nó cũng làm gia tăng các nghiên cứu các bệnh di truyền. PCR cũng được ứng dụng trong chẩn đoán các tác nhân gây bệnh. Ví dụ: Khuếch đại DNA của các vi khuẩn, virus trong các mẫu bệnh phẩm trước khi các triệu chứng bệnh bắt đầu xuất hiện nhiều ngày, nhiều tuần, thậm chí nhiều tháng. Từ đó ta có thể đề ra cách chữa trị thích hợp và ngăn chặn được thiệt hại. 2.2.5.3. PCR được dùng để khuếch đại RNA PCR không chỉ khuếch đại các khuôn mẫu DNA, các khuôn mẫu RNA cũng được khuếch đại nếu ban đầu chúng được biến đổi thành DNA tái tổ hợp (cDNA) nhờ enzyme reverse transcriptase. Một ứng dụng có ích của RT – PCR là xác định số lượng tương đối của một mRNA trong các mô khác nhau hay trong cùng một mô nhưng tại các thời điểm khác nhau. Số lượng của một mRNA trong tế bào chính là sự phản ảnh về khả năng hoạt động của gen cha mẹ. Vì thế, sự xác định số lượng của mRNA tạo ra những thay đổi trong sự biểu hiện gen để chúng có thể được kiểm soát. 2.2.5.4. PCR được sử dụng để so sánh các genome khác nhau Sự khuếch đại ngẫu nhiên (random amplification) với các primer ngắn là kỹ thuật hữu dụng trong phát sinh chủng loại, khu vùng nghiên cứu liên quan đến sự tiến hóa và suy vong của các loài hay các nhóm sinh vật khác. Hai sinh vật có quan hệ thân tộc sẽ có nhiều band giống nhau hơn hai sinh vật có quan hệ thân tộc kém (Brown, 1994). 2.2.6. Các hạn chế của phương pháp PCR Do độ nhạy rất cao của PCR đồng thời với thao tác đơn giản, người ta có khuynh hướng sử dụng phương pháp này để giải quyết nhiều vấn đề. Tuy nhiên, ta không thể quên rằng phương pháp có nhiều hạn chế và đòi hỏi sự thận trọng đặc biệt khi tiến hành thí nghiệm cũng như khi phân tích kết quả. Có thể kể ba vấn đề lớn khi sử dụng phương pháp PCR: 2.2.6.1. Trong thực nghiệm, kích thước các đoạn cần khuếch đại là giới hạn đầu tiên Trừ vài trường hợp rất cá biệt, phương pháp PCR không hoạt động được với những đoạn DNA lớn hơn 3 kb. Việc sử dụng PCR đối với các DNA có độ dài dưới 1,5 kb cho kết quả tốt. Với những độ dài lớn hơn, điều kiện tối ưu cho phản ứng phải được xác định qua thực nghiệm. 2.2.6.2. Sự ngoại nhiễm là vấn đề lớn nhất đặt ra đối với PCR, gắn liền với khả năng khuếch đại bản sao đối với phương pháp này Vấn đề đặc biệt cấp thiết trong những ứng dụng về chẩn đoán vì hậu quả rất nghiêm trọng. Nguồn ngoại nhiễm lớn nhất thường là các sản phẩm khuếch đại của những lần thao tác trước. Người ta đã chứng minh được rằng việc mở nắp các ống nghiệm sau những lần khuếch đại trong một khoảng không gian kín trong phòng thí nghiệm sẽ khiến cho các phân tử đã được khuếch đại thoát ra khỏi ống nghiệm bay lơ lửng trong không khí và bám vào tường, cửa, thiết bị dung cụ…rồi nhiễm vào các phản ứng tiến hành sau đó. Có thể khắc phục một phần vấn đề này bằng một số biện pháp sau: - Các công đoạn thao tác khác nhau như thiết lập phản ứng PCR và phân tích các sản phẩm khuếch đại phải được tiến hành ở những địa điểm cách xa nhau. - Dụng cụ dùng để thiết lập phản ứng (micropipette) không sử dụng cho các thao tác khác. Đầu tip sử dụng với micropipette phải có lớp lọc tránh sự nhiễm vào đầu micropipette bởi các phân tử khuếch đại khi hút dung dịch phản ứng. - Dùng tia tử ngoại để loại bỏ các phân tử còn lại từ các lần khuếch đại trước. - Tất cả các thành phần phản ứng đều được chia thành những lượng nhỏ, tính toán sao cho 1, 2 lần thao tác. 2.2.6.3. Các sai sót gây ra do Taq polymerase Sự sao chép bởi Taq polymerase cho tỉ lệ sai khá cao (10-4, nghĩa là cứ 10000 nucleotide thì enzyme gắn sai 1 nucleotide). Đặc tính này không nghiêm trọng nếu ta chỉ cần xem xét kích thước hay sự có mặt của một sản phẩm khuếch đại, nhưng có ý nghĩa lớn nếu cần xác định chính xác trình tự nucleotide của DNA. Ta không thể loại bỏ hoàn toàn các sai khác này mà chỉ có thể giảm bớt; ví dụ như đảm bảo sự cân bằng nồng độ các nucleotide trong phản ứng, xác định trình tự của nhiều sản phẩm khuếch đại từ nhiều thao tác riêng biệt, so sánh trước khi đi đến trình tự chính thức,… Phần 3 NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1. Thời gian và địa điểm thực hiện 3.1.1. Thời gian: Từ tháng: 2/2005 - 7/2005 3.1.2. Địa điểm - Mẫu phân bò khảo sát được lấy từ hộ hoặc trại chăn nuôi ở Đồng Nai; mẫu phân heo được lấy ở Tiền Giang; mẫu bề mặt thịt bò được lấy ở lò mổ Dĩ An – Bình Dương. - Nuôi cấy, phân lập vi khuẩn được thực hiện tại phòng thực hành Kiểm nghiệm Thú sản và Môi trường, khoa Chăn nuôi – Thú y, Trường Đại học Nông Lâm Thành Phố Hồ Chí Minh. - Xác định các gen độc lực được thực hiện tại Trung Tâm Phân Tích Thí Nghiệm Hóa sinh Trường Đại học Nông Lâm TP. HCM. 3.2. Nội dung - Thu thập mẫu phân tiêu chảy của bò, bê, heo và mẫu bề mặt thịt bò. - Nuôi cấy, phân lập E. coli trên môi trường MAC, SMAC, CT-SMAC. - Chọn khuẩn lạc điển hình của E. coli / nhóm E. coli. - Giữ gốc khuẩn lạc riêng lẻ trên ống thạch NA - Ly trích DNA của E. coli phân lập được. - Thực hiện phản ứng multiplex – PCR để phát hiện gen gây độc của E. coli. 3.3. Phương pháp nghiên cứu 3.3.1. Lấy mẫu - Mẫu phân tiêu chảy Được lấy từ trực tràng bằng tăm bông rồi cho vào môi trường vận chuyển Carry Blair. Bảo quản ở 4 – 80C cho đến khi tiến hành xét nghiệm (mẫu được giữ tối đa 24 giờ). - Mẫu bề mặt thịt Dùng gạc y tế tẩm nước muối sinh lý quét đều lên bề mặt thịt, cho vào chai có sẵn 50 ml nước peptone đệm. Sau đó đậy chặt chai, cho vào túi ny lông buộc kỹ. Bảo quản 4 - 80C, chuyển về phòng thí nghiệm. - Số lượng mẫu: Số lượng mẫu khảo sát được tính là số mẫu đã phân lập được vi khuẩn E. coli từ các mẫu đã lấy. Bảng 3.1 Số lượng mẫu STT Đối tượng mẫu Số lượng 1 Phân tiêu chảy Phân bò 8 2 Phân bê 10 3 Phân heo 9 4 Thịt Bò 9 Tổng cộng 36 3.3.2. Nuôi cấy, phân lập và ly trích DNA của vi khuẩn E. coli 3.3.2.1. Môi trường nuôi cấy - Môi trường nuôi cấy, phân lập vi khuẩn: Mac Conkey (MAC), Sorbitol-SMAC, thạch dinh dưỡng (NA), peptone đệm, Cefixime-Tellurite-SMAC (CT- SMAC), hóa chất thử IMViC… 3.3.2.2. Nuôi cấy và phân lập (1) Mẫu phân tiêu chảy được cấy trực tiếp trên đĩa thạch MAC và SMAC để có những khuẩn lạc rời rạc sau 24 giờ ở 37oC. Mẫu bề mặt thịt được làm đồng đều trong 125 ml peptone đệm phosphate có bổ sung kháng sinh cefixime với nồng độ 0,0125 mg/l, vancomycin với nồng độ 8 mg/l (FDA, 2002). Ủ 24 giờ ở 37oC, cấy sang môi trường CT-SMAC. Vi khuẩn E. coli nhóm STEC phát triển tạo khuẩn lạc không màu hoặc xám với tâm đục, E. coli khác cho khuẩn lạc hồng giống như trên môi trường MAC. (2) Chọn khuẩn lạc điển hình của E. coli - Quan sát các loại khuẩn lạc hiện diện trên bề mặt thạch MAC, SMAC, CT-SMAC. - Mỗi nhóm khuẩn lạc chọn 6 – 10 khuẩn lạc rời rạc đại diện E. coli của mẫu khảo sát. Các nhóm khuẩn lạc như sau: 6 – 10 khuẩn lạc hồng MAC (Ký hiệu HM). 6 – 10 khuẩn lạc trắng SMAC (Ký hiệu TS). 6 – 10 khuẩn lạc đỏ hồng SMAC (Ký hiệu HS). 6 – 10 khuẩn lạc trắng CT – SMAC (Ký hiệu TC). (3) Tăng sinh, giữ gốc khuẩn lạc riêng lẻ trên môi trường thạch dinh dưỡng (NA). - Mỗi khuẩn lạc được chọn cấy chuyển vào ống thạch NA. Phần khuẩn lạc còn lại của mỗi nhóm được thu gom chung vào 1 eppendorf chứa sẵn 0,4 - 0,5ml nước cất khử ion vô trùng để ly trích DNA nhóm khuẩn lạc (DNA tổng). (4) Thử sinh hóa - Sau khi nuôi cấy, mỗi khuẩn lạc rời rạc trên được thử phản ứng IMViC để xác định E. coli. 3.2.2.3. Ly trích DNA khuẩn lạc Sau khi đã thu nhóm khuẩn lạc trong ống eppendorf và giữ gốc từng khuẩn lạc riêng lẻ. Mỗi gốc được cấy sang đĩa NA. Sau 24 giờ ở 37oC, thu 6 – 10 khuẩn lạc cho vào eppendorf chứa sẵn 0,4 - 0,5ml H2O cất khử ion vô trùng. Tiếp theo, chúng tôi tiến hành ly trích DNA đại diện nhóm khuẩn lạc và từng khuẩn lạc riêng lẻ. Dựa theo Cebula và ctv (1995), kết hợp với phương pháp ly trích DNA từ E. coli của Cerna và ctv (2003) và Botteldoorn và ctv (2003) để tiến hành ly trích DNA từ vi khuẩn E. coli phân lập được bằng phương pháp nhiệt như sau: đun sôi 10 phút rồi chuyển vào tủ -70oC để trong 10 phút, rã đông rồi ly tâm 13000 vòng/phút trong 3 phút. Thu phần nổi làm DNA khuôn mẫu (DNA xét nghiệm). - Quy trình phân lập vi khuẩn E. coli như sau: Mẫu Phân Thịt Peptone (vancomycin, cefixime) (37oC/24h) MAC (37oC/24h) SMAC (37oC/24h) CT - SMAC (37oC/24h) Thu tất cả phần còn lại của những khuẩn lạc đã chọn để cấy qua ống NA theo từng nhóm riêng, cho vào eppendorf chứa sẵn 0,4 - 0,5ml H2O cất khử ion 2 lần Cấy từng khuẩn lạc được chọn vào từng ống NA nghiêng (37oC/24h) Chọn 6-10 khuẩn lạc đỏ hồng Chọn 6-10 khuẩn lạc trắng và / hoặc đỏ hồng Chọn 6-10 khuẩn lạc trắng và / hoặc đỏ hồng Ly trích DNA (DNA nhóm khuẩn lạc) Multiplex - PCR Ly trích DNA riêng theo từng ống NA Loại bỏ các ống NA đã giữ gốc (+) Multiplex- PCR (-) Thử IMViC(+/-;+;-;-) Cạo tất cả những khuẩn lạc đã chạm theo từng nhóm riêng: (1) 6 – 10 khuẩn lạc đỏ hồng SMAC (2) 6 – 10 khuẩn lạc hồng MAC (3) 6 – 10 khuẩn lạc trắng SMAC (4) 6 – 10 khuẩn lạc hồng CT – SMAC (5) 6 – 10 khuẩn lạc trắng CT - SMAC Sơ đồ 3.1 Phân lập, xác định E. coli và phát hiện gen độc lực 3.3.3. Xác định các gen stx1, stx2, eae, hly, stx2e, sta, stb, lt-I của E. coli phân lập được bằng multiplex - PCR - Việc phát hiện các gen độc lực của E. coli được thực hiện bằng 2 phản ứng multiplex – PCR với máy luân nhiệt (thermal cycler): Multiplex – PCR1: Phát hiện các gen eae, hly, stx1, stx2. Multiplex – PCR2: Phát hiện các gen stx2e, sta, stb, lt-I. - Trong quá trình thực hiện phản ứng multiplex – PCR, mẫu đối chứng dương (EDL933 hoặc H44) được thực hiện đồng thời với mẫu khảo sát. EDL933 là đối chứng dương với các gen eae, hly, stx1, stx2. H44 là đối chứng dương với các gen stx2e, stb, lt-I. Hai mẫu đối chứng dương này được cung cấp từ Trường đại học Thú y Toulouse (Pháp). Multiplex – PCR1 * Trình tự các primer sử dụng trong multiplex – PCR1 Gen độc lực Primer Trình tự đoạn primer (5’® 3’) Kích cỡ đoạn DNA khuếch đại (bp) stx1 Stx1-F Stx1-R ATAAATCGCCATTCGTTGACTAC AGAACGCCCACTGAGATCATC 180 stx2 Stx2-F Stx2-R GGCACTGTCTGAAACTGCTCC TCGCCAGTTATCTGACATTCTG 255 eaeA Eae-F Eae-R GACCCGGCACAAGCATAAGC CCACCTGCAGCAACAAGAGG 384 hlyA HlyA-F HlyA-R GCATCATCAAGCGTACGTTCC AATGAGCCAAGCTGGTTAAGCT 534 (Dẫn liệu của Paton & Paton, 1998a) * Các thành phần của phản ứng multiplex – PCR1: PCR buffer 1X: Tris-HCl (pH 8,8 ở 25oC) 750 mM, (NH4)2SO4 200 mM, 0,1 % Tween 20; MgCl2 2mM; dNTP 200M; mỗi loại primer 250 mM. Taq – polymerase AB gene 0.5UI; DNA khuôn mẫu 1l; nước cất 2 lần khử ion vừa đủ 50l. * Chu trình nhiệt của phản ứng multiplex – PCR1 (Paton và Paton, 1998a): Bước 1 950C / 1 phút 650C / 2 phút 10 chu kỳ 720C / 1,5 phút Bước 2 950C / 1 phút 640C / 2 phút 1 chu kỳ 720C / 1,5 phút Bước 3 950C / 1 phút 630C / 2 phút 1 chu kỳ 720C / 1,5 phút Bước 4 950C / 1 phút 620C / 2 phút 1 chu kỳ 720C / 1,5 phút Bước 5 950C / 1 phút 610C / 2 phút 1 chu kỳ 720C / 1,5 phút Bước 6 950C / 1 phút 600C / 2 phút 10 chu kỳ 720C / 1,5 phút Bước 7 950C / 1 phút 600C / 2 phút 11 chu kỳ 720C / 2,5 phút Multiplex – PCR2 * Trình tự các đoạn primer được sử dụng trong multiplex – PCR2: Gen độc lực Primer Trình tự đoạn primer (5’® 3’) Kích cỡ đoạn DNA khuếch đại (bp) lt-I LT-F LT-R GGCGACAGATTATACCGTGC CCGAATTCTGTTATATATGTC 696 sta STa-F STa-R TTAATAGCACCCGTACAAGCAGG CTTGACTCTTCAAAAGAGAAAATTAC 147 stb STb-F STb-R ATCGCATTTCTTCTTGCATC GGGCGCCAAAGCATGCTCC 172 vt2e Vt2e-F Vt2e-R CCTTAACTAAAAGGAATATA CTGGTGGTGTATGATTAATA 230 (Dẫn liệu của Blanco và ctv, 1997) *Các thành phần của phản ứng multiplex – PCR2: PCR buffer 1X: Tris-HCl (pH 8,8 ở 25oC) 750 mM, (NH4)2SO4 200 mM, 0,1 % Tween 20; MgCl2 2mM; dNTP 200M; primer: LTa-F 150 ng, LTa-R 150 ng, STa-F 150 ng, STa-R 150ng, STb-F 45 ng, STb-R 45 ng, Vt2e-F 225 ng, Vt2e-R 225 ng; Taq - polymerase AB gen 0.5UI; DNA khuôn mẫu 3,5l; nước cất 2 lần khử ion vừa đủ 50l. 940C / 5 phút 950C / 45 giây 600C / 45 giây 25 chu kỳ 720C / 1 phút 720C / 10 phút * Chu trình nhiệt của phản ứng multiplex – PCR2 (Nguyen Ngoc Hai, 2002): 3.3.4. Điện di trên gel aragose và đọc kết quả điện di Sau phản ứng multiplex - PCR, 6l sản phẩm PCR cùng với 1,2l loading dye được điện di trên gel agarose 1,4% trong TBE 0,5X. Ladder cũng được điện di đồng thời. Thời gian điện di là 30 – 35 phút ở 100V, 250mA. Sau khi điện di, gel được ngâm trong 30 phút với dung dịch ethidium bromide 1mg/ml TBE. Sau đó rửa sạch bằng nước và chụp hình gel với tia UV bằng máy chụp gel với phần mềm Quality One 2000, Bio-Rad). Các band DNA được xác định bằng cách so với các band của đối chứng dương và ladder. stx2 (255bp) hly (534bp) stx1(180bp) eae (384bp) 1 2 EDL Lad 3 4 933 Hình 3.1 Kết quả điện di sản phẩm multiplex - PCR1 EDL933: Đối chứng dương (stx1, stx2, eae, hly). Lad: Thang chuẩn. 1, 2, 3, 4: các mẫu xét nghiệm 1 2 Lad H44 3 4 lt-I (696bp) vt2e (230bp) stb (172bp) Hình 3.2 Kết quả điện di sản phẩm multiplex - PCR2 H44: Đối chứng dương (lt-I, vt2e, stb). Lad: Thang chuẩn. 1, 2, 3, 4 là các mẫu xét nghiệm Hly(534bp) Eae(384) Stx2(255bp) Stx1(180bp) PHẦN 4 KẾT QUẢ VÀ THẢO LUẬN 4.1. Kết quả phân nhóm khuẩn lạc và xác định E. coli từ các khuẩn lạc phân lập được Sau khi nuôi cấy trên môi trường chọn lọc, phân lập và phân nhóm khuẩn lạc dựa vào kiểu hình trên môi trường MAC, SMAC, CT-SMAC và thử phản ứng sinh hóa (IMViC) cho các khuẩn lạc thu được từ 8 mẫu phân bò tiêu chảy, 10 mẫu phân bê tiêu chảy, 9 mẫu phân heo cai sữa tiêu chảy và 9 mẫu bề mặt thịt bò, kết quả lần lượt được trình bày như sau: 4.1.1. Các loại khuẩn lạc trên môi trường thạch MAC, SMAC, và CT-SMAC Mẫu phân tiêu chảy được cấy ria trực tiếp trên bề mặt thạch MAC. Ủ 37oC trong 24 giờ, quan sát và ghi nhận được chỉ một loại khuẩn lạc màu hồng điển hình của E. coli, được kí hiệu HM. MAC là môi trường chọn lọc cho vi khuẩn Gram âm, đặc biệt là E. coli. Muối mật có trong môi trường ức chế vi khuẩn Gram dương. Khi vi khuẩn Gram âm lên men lactose thì tạo ra acid làm cho pH của môi trường giảm, môi trường đỏ hơn và khuẩn lạc có màu đỏ (Koneman, 1983). Mẫu phân tiêu chảy nuôi cấy trên thạch SMAC, ta quan sát 2 loại khuẩn lạc: khuẩn lạc hồng (HS) và khuẩn lạc trắng (TS). Vi khuẩn không sử dụng sorbitol sẽ cho khuẩn lạc màu trắng. Đặc biệt các mẫu bề mặt thịt bò được tăng sinh trong môi trường peptone đệm bổ sung vancomycin và cefixime, đó là hai loại kháng sinh có tác dụng ức chế các vi khuẩn gram dương và một phần vi khuẩn gram âm trong đường ruột. Sau đó, cấy chuyển vi khuẩn lên môi trường thạch CT-SMAC với mục tiêu tăng sinh nhóm STEC, vì cefixime và tellurite có tác dụng ức chế vi khuẩn gram âm và các vi khuẩn E. coli sống hoại sinh trong ống tiêu hóa (FDA, 2002). Trên môi trường thạch CT-SMAC, chỉ quan sát được 1 loại khuẩn lạc màu trắng (TC). 4.1.2. Xác định E. coli cho các khuẩn lạc được chọn Sau khi giữ gốc vi khuẩn theo từng khuẩn lạc riêng lẻ trên ống thạch NA, thử phản ứng IMViC và khẳng định các gốc phân lập được là E. coli. 4.2. Kết quả phát hiện các gen độc lực của E. coli phân lập được từ phân bò tiêu chảy Mẫu phân bò tiêu chảy được cấy ria trực tiếp trên môi trường MAC và SMAC. Sau 24 giờ nuôi cấy ở 370C, chọn khuẩn lạc điển hình, dùng que cấy chạm nhẹ lên từng khuẩn lạc đã chọn rồi cấy chuyển vào từng ống NA riêng biệt. Những khuẩn lạc sau khi đã cấy chuyển thì phần còn lại được thu chung thành nhóm khuẩn lạc: HM (khuẩn lạc hồng trên môi trường MAC), TS (khuẩn lạc trắng trên môi trường SMAC), HS (khuẩn lạc hồng trên môi trường SMAC). Như đã đề cập ở mục 4.1.2, sau khi phân lập và xác định E. coli trong mỗi mẫu phân thì giữ gốc vi khuẩn theo nhóm khuẩn lạc (dựa vào kiểu hình) trên thạch MAC (1 nhóm) và SMAC (2 nhóm) và theo từng khuẩn lạc riêng lẻ (mỗi nhóm giữ được 6 – 10 gốc khuẩn lạc riêng lẻ). Trên cơ sở đó, chúng tôi ly trích DNA của vi khuẩn theo nhóm khuẩn lạc hoặc từng khuẩn lạc riêng lẻ. Kết quả trình bày ở mục 4.1.1 cho thấy: Trên thạch MAC chỉ có một loại khuẩn lạc hồng (HM). Như vậy nhóm khuẩn lạc này đại diện cho E. coli có trong mẫu phân khảo sát. Trên thạch SMAC có hai loại khuẩn lạc: HS và TS. Cả hai nhóm khuẩn lạc này được xác định là E. coli. Như vậy nhóm nào cũng đại diện được cho E. coli có trong mẫu phân khảo sát. Tuy nhiên, theo đặc điểm của những serotype E. coli không sử dụng sorbitol sẽ cho khuẩn lạc màu trắng, thuộc nhóm STEC. Do đó, nhóm khuẩn lạc trắng trên thạch SMAC (TS) là nhóm E. coli có thể sản sinh độc tố Shiga (Stx). Kết quả phát hiện các gen độc lực của E. coli phân lập từ phân bò tiêu chảy được trình bày ở bảng 4.1. Từ bảng 4.1 ta thấy có 2/8 (25%) mẫu phân chứa E. coli mang gen độc lực. Trong đó, 2/8 (25,5%) mẫu phát hiện được E. coli mang gen stx2, 1/8 (12,5%) mẫu phát hiện được E. coli mang gen hly. Nếu phân lập vi khuẩn này trên môi trường MAC thì có 1/8 mẫu phân (12,5%) chứa E. coli mang gen stx2. Nếu phân lập trên thạch SMAC và chỉ căn cứ theo nhóm khuẩn lạc đỏ hồng (HS), có 1/8 (12,5%) mẫu chứa E. coli mang gen stx2. Nếu căn cứ theo nhóm khuẩn lạc trắng (TS) thì có 2/8 (25%) mẫu chứa E. coli mang gen stx2, 1/8 (12,5%) mẫu chứa E. coli mang gen hly lẫn stx2. Bảng 4.1 Kết quả phát hiện các gen độc lực của từng nhóm khuẩn lạc đại diện cho E. coli trong phân bò tiêu chảy Mẫu Gen độc lực Thứ tự Loại khuẩn lạc stx1 stx2 eae hly lt sta stb vt2e HM TS HS 1 x - + - - - - - - x - + - - - - - - x - + - - - - - - 2 x - - - - - - - - x - + - + - - - - x - - - - - - - - 3 x - - - - - - - - x - - - - - - - - x - - - - - - - - 4 x - - - - - - - - x - - - - - - - - 5 x - - - - - - - - x - - - - - - - - x - - - - - - - - 6 x - - - - - - - - x - - - - - - - - 7 x - - - - - - - - x - - - - - - - - 8 x - - - - - - - - x - - - - - - - - Tổng 8 5 7 0 2 0 1 0 0 0 0 Tỉ lệ (%) 100 62,5 87,5 0 25% 0 12,5 0 0 0 0 Tóm lại, trên cùng môi trường phân lập E. coli, những mẫu phân có cùng khuẩn lạc giống nhau vẫn không chắc được rằng chúng mang các gen độc lực như nhau. Tuy nhiên, nhóm khuẩn lạc nào mà multiplex – PCR không phát hiện được gen độc lực thì nhóm đó không mang E. coli gây bệnh. Vì tiêu chảy là triệu chứng rối loạn hấp thu tại đường ruột. Nguyên nhân của triệu chứng này có nhiều nguồn gốc khác nhau. Hậu quả của biểu hiện này đều làm thay đổi hệ vi khuẩn đường ruột. Nếu xét theo nguồn gốc do E. coli thì tiêu chảy có thể do nhóm STEC, ETEC hoặc EPEC. Vì thế, từ 4 nhóm khuẩn lạc mang gen độc lực đã được xác định là 1HM, 1TS, 1HS và 2TS, chúng tôi tiến hành ly trích DNA từ các gốc khuẩn lạc riêng lẻ để xác định các gen độc lực, kết quả được trình bày ở bảng 4.2. Bảng 4.2 Kết quả phát hiện gen stx1, stx2, eae, hly của một số khuẩn lạc E. coli riêng lẻ phân lập được từ phân bò tiêu chảy Mẫu Gen độc lực Loại khuẩn lạc Thứ tự khuẩn lạc stx1 stx2 eae hly 1TS 1 - + - - 2 - + - - 3 - + - - 4 - + - - 5 - + - - 6 - + - - 7 - - - - 8 - + - - 9 - + - - 10 - + - - 1HS 1 - + - - 2 - + - - 3 - + - - 4 - + - - 5 - + - - 6 - + - - 7 - + - - 8 - + - - 9 - + - - 1HM 1 - + - - 2 - + - - 3 - + - - 4 - + - - 5 - + - - 6 - + - - 7 - - - - 8 - + - - 9 - + - - 2TS 1 - + - - 2 - - - - 3 - + - + 4 - - - - 5 - - - - 6 - - - - 7 + - 8 - - - Kết quả ở bảng 4.2 cho thấy: 9 khuẩn lạc riêng lẻ màu hồng trên môi trường MAC của mẫu số 1 (1HM), multiplex – PCR phát hiện được 8/9 (88,9%) khuẩn lạc mang gen stx2 . 9 khuẩn lạc riêng lẻ màu hồng trên môi trường SMAC của mẫu số 1 (1HS), multiplex – PCR phát hiện được 9/9 (100%) khuẩn lạc mang gen stx2. 10 khuẩn lạc riêng lẻ màu trắng trên môi trường SMAC của mẫu số 1(1TS), multiplex – PCR phát hiện 9/10 (90%) khuẩn lạc mang gen stx2. (4) 8 khuẩn lạc riêng lẻ màu trắng trên môi trường SMAC của mẫu số 2 (2TS), multiplex – PCR phát hiện được 3/8 (37,5%) khuẩn lạc mang gen độc lực. Trong đó, 1/8 (12,5%) khuẩn lạc mang gen stx2 và hly, 2/8 (25%) khuẩn lạc mang gen stx2. Chỉ có 1 khuẩn lạc (2TS3) mang gen hly trong tổng số 8 khuẩn lạc riêng rẽ thuộc nhóm 2TS phát hiện được gen hly. Tóm lại, nhóm khuẩn lạc có mang gen độc lực thì chưa chắc từng khuẩn lạc riêng lẻ có mang gen độc lực đó. Cho nên chọn từng khuẩn lạc để nghiên cứu là công việc chi tiết cần thiết để xác định thành phần các serotype của E. coli trong phân. Nếu mục tiêu này không được đặt ra cho nhà nghiên cứu thì việc lấy nhóm khuẩn lạc đại diện để phát hiện các gen độc lực là bước đi thích hợp hơn. 4.3. Kết quả phát hiện gen độc lực của E. coli phân lập được từ phân heo tiêu chảy Tương tự như mục 4.2, kết quả phát hiện các gen độc lực của E. coli phân lập được từ phân heo tiêu chảy trên hai môi trường MAC và SMAC lần lượt trình bày ở bảng 4.3 và bảng 4.4. Kết quả ở bảng 4.3 cho ta thấy trong 9 mẫu phân heo tiêu chảy có 8/9 mẫu (chiếm 88,89%) phát hiện được E. coli mang gen độc lực, trong đó: - 6 mẫu (66,67%) phát hiện được gen stb, chiếm tỉ lệ phát hiện cao nhất. - 5 mẫu (55,56%) phát hiện được gen lt. - 3 mẫu (33,33%) phát hiện được gen vt2e. - 2 mẫu (22,22%) phát hiện được gen hly. - 1 mẫu (11,11%) phát hiện được gen stx1. - 1 mẫu (11,11%) phát hiên được gen eae. - Không phát hiện được gen stx2 và sta của E. coli trong 9 mẫu phân heo tiêu chảy. - Gen stb của E. coli phân lập được từ phân heo tiêu chảy chiếm tỉ lệ cao nhất (66,67%). Blanco và ctv (1997) nhận thấy rằng gen stb xuất hiện với tần số cao nhất 78,4% (58/74 mẫu) so với các gen độc lực khác của E. coli phân lập được từ phân heo con tiêu chảy hoặc phù thủng. Ông kết luận rằng độc tố STb góp phần đáng kể vào triệu chứng tiêu chảy trên heo. Điều này cũng phù hợp với kết quả nghiên cứu của Moon và ctv (1986), Harel và ctv (1991), Handl và ctv (1992), Lê Thị Mai Khanh (2004). - Có 3/9 mẫu (33,33%) E. coli từ phân heo tiêu chảy mang gen vt2e. Tuy độc tố VT2e không liên quan đến bệnh trên người, nhưng nó chính là nguyên nhân gây bệnh phù thủng trên heo con cai sữa (DesRosiers và ctv, 2001). Kỹ thuật PCR trở thành phương pháp phát hiện nhanh và chính xác để phát hiện E. coli gây bệnh phù thủng (Bertschinger và Fairbrother, 1999). Bảng 4.3 Kết quả phát hiện các gen độc lực của từng nhóm khuẩn lạc đại diện cho E. coli trong phân heo tiêu chảy Mẫu Gen độc lực Thứ tự Loại khuẩn lạc stx1 stx2 eae hly lt sta stb vt2e HM TS HS 1 x - - - - - - - - x - - + + - - - - x - - + + - - - - 2 x - - - - - - - - x - - - - - - - - x + - - + - - - - 3 x - - - - - - + - x - - - - - - + - 4 x - - - - - - + - x - - - - + - + - x - - - - + - + + 5 x - - - - - - - - x - - - - + - + + 6 x - - - - + - + + x - - - - + - + - x - - - - - - + + 7 x - - - - + - + - x - - - - - - - - x - - - - - - - - 8 x - - - - + - + - x - - - - - - - - x - - - - - - - - 9 x - - - - - - - - x - - - - - - - - x - - - - - - - - Tổng 7 9 9 1 0 1 2 5 0 6 3 Tỷ lệ (%) 77,78 100 100 11,11 0 11,11 22,22 55,56 0 66,67 33,33 - Khác với bò, ở heo nhóm ETEC chiếm đa số trong mẫu phân tiêu chảy (stb (66,67%), lt (55,56%)). Phân bò được biết là nguồn lưu cữu tự nhiên của nhóm EHEC còn heo thì không. - Môi trường SMAC chọn lọc nhóm STEC, kết quả ở bảng 4.3 ta thấy các mẫu 1HS, 1TS, 2HS hiện diện các gen stx1, eae, hly; các mẫu 1HM, 2HM âm tính. Do kinh phí của đề tài có hạn, đối với phân heo tiêu chảy, các nhóm khuẩn lạc mang gen độc lực thì chúng tôi chỉ chọn ngẫu nhiên khoảng 2 – 3 khuẩn lạc riêng lẻ để ly trích DNA và chạy multiplex – PCR phát hiện các gen gây độc. Kết quả được trình bày ở bảng 4.4. Kết quả ở bảng 4.4 cho thấy (1) 4 khuẩn lạc riêng lẻ màu hồng trên MAC được lấy ngẫu nhiên, multiplex – PCR chỉ phát hiện được 1/4 số khuẩn lạc đó mang gen stb (25%). (2) 14 khuẩn lạc riêng lẻ màu hồng trên môi trường SMAC, multiplex – PCR phát hiện được 1/14 khuẩn lạc mang gen eae (7,1%); 4/14 khuẩn lạc mang gen lt (28,57%); 3/14 khuẩn lạc mang gen stb (21,43%); 4/14 khuẩn lạc mang gen vt2e (28,57%). (3) 9 khuẩn lạc riêng lẻ màu trắng trên môi trường SMAC, multiplex – PCR phát hiện được 3/9 khuẩn lạc mang gen lt (33,33%); 4/9 khuẩn lạc mang gen stb (44,44%) và 1/9 khuẩn lạc mang gen vt2e (11,11%). Bảng 4.4 Kết quả phát hiện các gen độc lực cho một số khuẩn lạc E. coli riêng lẻ phân lập được từ phân heo tiêu chảy Mẫu Gen độc lực Loại khuẩn lạc khuẩn lạc được chọn stx1 stx2 eae hly lt sta stb vt2e 1HS (Eae, hly) 1 - - - - - - - - 2 - - + - - - - - 3 - - - - - - - - 1TS (Eae, hly) 2 - - - - - - - - 3 - - - - - - - - 4 - - - - - - - - 2HS (stx1, hly) 4 - - - - - - - - 5 - - - - - - - - 6 - - - - - - - - 3HS 2 - - - - - - - - (stb) 5 - - - - - - - - 3TS (stb) 3 - - - - - - - - 4 - - - - - - - - 4HM (stb) 1 - - - - - - + - 3 - - - - - - - - 4HS (stb) 5 - - - - + - + + 6 - - - - - - + - 4TS (lt, stb) 1 - - - - + - + + 2 - - - - - - + - 6TS (lt, stb) 3 - - - - + - + - 4 - - - - + - + - 6HS (stb, vt2e, lt) 1 - - - - - - - + 6 - - - - + - + - 5HS (lt, stb, vt2e) 2 - - - - + - - + 6 - - - - + - - + 8HM (lt, stb) 1 - - - - - - - - 6 - - - - - - - - 4.4. Kết quả phát hiện gen độc lực của E. coli phân lập được từ phân bê tiêu chảy Bảng 4.5 Kết quả phát hiện các gen độc lực của từng nhóm khuẩn lạc đại diện cho E. coli trong phân bê tiêu chảy Mẫu Gen độc lực Thứ tự Loại khuẩn lạc stx1 stx2 eae hly lt sta stb vt2e HM TS HS 1 x - - - - - - - - x - - - - - - - - 2 x - - - - - - - - x - - - - - - - 3 x - - - - - - - - x - - - - - - - - 4 x + - - - - - - - x + - - - - - - - 5 x - - - - - - - - x - - - - - - - - 6 x + - + + - - - - x + - + + - - - - 7 x + + - - - - - x + + - - - - - - 8 x - - - - - - - - x - - - - - - - - 9 x - - - - - - - - 10 x - - - - - - - - Tổng 8 3 7 3 1 1 1 0 0 0 0 Tỉ lệ(%) 80 30 70 30 10 10 10 0 0 0 0 Kết quả phát hiện các gen độc lực của E. coli phân lập được từ 10 mẫu phân bê tiêu chảy được trình bày ở bảng 4.5. - Trong tổng số 10 mẫu phân có 3/10 (30%) mẫu phát hiện được E. coli mang gen độc lực, trong đó: 3/10 (30%) mẫu phân phát hiện được E. coli mang gen stx (stx1 hoặc/và stx2). 1/10 (10%) mẫu phân phát hiện được E. coli mang gen eae. 1/10(10%) mẫu phân phát hiện được E. coli mang gen hly. - Trong 10 mẫu phân bê tiêu chảy, không phát hiện được E. coli mang gen độc lực của nhóm ETEC, chỉ phát hiện được E. coli mang gen của nhóm STEC. Theo Beutin và ctv (1993), Chapman và ctv (1997), STEC được tìm thấy nhiều trong phân của bò, bê. Một vài dòng STEC có khả năng gây tiêu chảy cho bò, đặc biệt là bê (Smith và Scoland, 1998; Gyles, 1992). - Các gen stx1, stx2, eae, hly được phát hiện, trong khi gen vt2e thì không được phát hiện ở bất kì nhóm khuẩn lạc E. coli phân lập từ 10 mẫu phân bê tiêu chảy. Kết quả này là hoàn toàn hợp lý vì gen vt2e chỉ được tìm thấy trong nhóm STEC ở heo (Beutin và ctv, 1995). Theo Blanco và ctv (1997), gen vt2e là một biến chủng của gen stx2, biến chủng này chỉ được phát hiện ở những dòng E. coli gây phù thủng trên heo. Có 3 mẫu phát hiện được E. coli mang gen độc lực là mẫu 4, 6, 7. Ở mẫu phân 4 có 2 loại khuẩn lạc HS và HM. Cả hai loại khuẩn lạc này đều mang gen stx1. Ở mẫu phân 6 có hai loại khuẩn lạc HS và HM. Cả hai loại khuẩn lạc này đều mang gen stx1, eae, hly. Việc phát hiện nhiều gen độc lực trên cùng một mẫu sẽ tăng nguy cơ gây bệnh. Độc tố Hly gây xuất huyết ruột (Botteldoorn và ctv, 2003), gen hly có thể phát hiện cùng với gen stx1, stx2, eae trong phân của những bệnh nhân HUS (Paton và Paton, 1998a). Ở mẫu phân 7 có 2 loại khuẩn lạc HS và HM. Cả hai loại khuẩn lạc này đều mang gen stx1, stx2. - Như vậy, trên cùng một mẫu phân bê tiêu chảy được phân lập trên 2 loại môi trường SMAC, MAC đều cho kết quả phát hiện gen độc lực giống nhau. Điều này chứng tỏ không có sự khác biệt về khả năng phát hiện gen độc lực giữa các loại khuẩn lạc (Hồng trên MAC hoặc hồng trên SMAC). * Tổng kết việc phát hiện gen độc lực của E. coli từ những mẫu phân tiêu chảy trên, ta có những nhận xét sau: - Khả năng phát hiện các gen độc lực của E. coli từ những mẫu phân tiêu chảy lần lượt là 25% trên phân bò tiêu chảy, 30% trên phân bê tiêu chảy, 88,89% trên phân heo tiêu chảy. 4.5. Kết quả phát hiện các gen độc lực của E. coli phân lập từ mẫu bề mặt thịt bò Như đã trình bày ở phần 4.1.1, chúng tôi chỉ thu được nhóm khuẩn lạc trắng trên môi trường CT-SMAC (kí hiệu TC). Bảng 4.6 Kết quả phát hiện các gen độc lực của nhóm khuẩn lạc đại diện cho E. coli trong mẫu bề mặt thịt bò Mẫu Gen độc lực stx1 stx2 eae hly lt sta stb vt2e 1 - - - - - - - - 2 - - - - - - - - 3 - - - - - - - - 4 - - - - - - - - 5 - - - - - - - - 6 - - - - - - - - 7 - - - - - - - - 8 - - - - - - - - 9 - - - - - - - - Tổng 0 0 0 0 0 0 0 0 Tỷ lệ (%) 0 0 0 0 0 0 0 0 Qua bảng 4.6, kết quả phát hiện các gen độc lực stx1, stx2, eae, hly, lt, sta, stb, vt2e từ nhóm khuẩn lạc TC phân lập từ mẫu bề mặt thịt bò là âm tính. Kết quả này có thể giải thích như sau: - Có thể do số mẫu xét nghiệm ít. - Do quy trình giết mổ đảm bảo vệ sinh. - Do mẫu xét nghiệm âm tính thật sự vì bò lấy mẫu không mang dòng E. coli gây độc. 4.6. Tổng kết kết quả phát hiện các gen độc lực của E. coli trên các mẫu khảo sát Với 36 mẫu khảo sát gồm 8 mẫu phân bò tiêu chảy, 9 mẫu phân heo tiêu chảy, 10 mẫu phân bê tiêu chảy, và 9 mẫu bề mặt thịt bò, tổng kết kết quả phát hiện các gen độc lực của E. coli trên các mẫu khảo sát được trình bày ở bảng 4.7 và biểu đồ 4.1 Bảng 4.7 Tổng kết kết quả phát hiện các gen độc lực của E. coli trên các mẫu khảo sát Mẫu N n Gen độc lực stx1 stx2 eae hly lt-I sta stb vt2e Phân bò tiêu chảy 8 (%) 2 25 0 0 2 25 0 0 1 12,5 0 0 0 0 0 0 0 0 Phân heo tiêu chảy 9 (%) 8 88,89 1 11,11 0 0 1 11,11 2 22,22 5 55,56 0 0 6 66,67 3 33,33 Phân bê tiêu chảy 10 (%) 3 30 3 30 1 10 1 10 1 10 0 0 0 0 0 0 0 0 Bề mặt thịt bò 9 (%) 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Tổng 36 13 4 3 2 4 5 0 6 3 % 36,1 11,11 8,33 5,56 11,11 13,89 0 16,67 8,33 N: Số lượng mẫu khảo sát n: Số lượng mẫu phát hiện E. coli có mang gen độc lực Biểu đồ 4.1 Tổng kết kết quả phát hiện các gen độc lực của E. coli trên các mẫu khảo sát Như vậy, qua bảng 4.7 và biểu đồ 4.1, trong 36 mẫu khảo sát gồm 27 mẫu có nguồn gốc từ bò (8 mẫu phân bò tiêu chảy, 10 mẫu phân bê tiêu chảy, và 9 mẫu bề mặt thịt bò), và 9 mẫu phân heo tiêu chảy. Ở phân bò tiêu chảy phát hiện được E. coli mang gen stx2 (25%) và hly (12,5%). Ở phân bê tiêu chảy, phát hiện được E. coli mang gen stx1 (30%), stx2 (10%), eae (10%), hly (10%). Như vậy ở các mẫu khảo sát có nguồn gốc từ bò chỉ phát hiện được nhóm STEC. Điều này hợp lí so với kết quả nghiên cứu của Beutin và ctv (1993). Ông cho rằng phân bò là nguồn lưu cữu chủ yếu của nhóm STEC. Ở phân heo tiêu chảy, phát hiện được E. coli mang gen stb (66,67%), lt-I (55,56%), vt2e (33,33%), hly (22,22%), stx1 (11,11%), eae (11,11%). Như vậy, ở phân heo tiêu chảy phát hiện được E. coli nhóm STEC và ETEC. Phần 5 KẾT LUẬN VÀ ĐỀ NGHỊ 5.1. Kết luận Từ những kết quả thu nhận được trong quá trình thực hiện đề tài, chúng tôi rút ra những kết luận sau: E. coli trên môi trường thạch MAC chỉ xuất hiện 1 loại khuẩn lạc hồng (HM), trên môi trường thạch SMAC xuất hiện 2 loại khuẩn lạc trắng (TS) và hồng (HS), trên môi trường thạch CT-SMAC xuất hiện 1 loại khuẩn lạc trắng. Nhóm khuẩn lạc có mang gen độc lực thì chưa chắc từng khuẩn lạc riêng lẻ có mang gen độc lực đó. Tần số phát hiện các gen độc lực của E. coli từ những mẫu phân tiêu chảy lần lượt là: 25% trên phân bò tiêu chảy (stx2, hly), 30% trên phân bê tiêu chảy (stx1, stx2, hly, eae), 88,89% trên phân heo tiêu chảy (stb, lt, vt2e, hly, stx1, eae). Điều này chứng tỏ rằng trên cả 3 nhóm đối tượng trên, E. coli mang các gen độc lực có thể là nguyên nhân quan trọng gây tiêu chảy. 9 mẫu bề mặt thịt bò chưa phát hiện được vi khuẩn E. coli mang gen độc lực Chưa phát hiện được gen sta trong E. coli phân lập từ 27 mẫu phân tiêu chảy của bò, bê và heo. 5.2. Đề nghị (1) Có thể ứng dụng kỹ thuật multiplex – PCR để phát hiện gen độc lực của những dòng E. coli gây bệnh, góp phần chẩn đoán bệnh cho gia súc và người, kiểm tra vệ sinh an toàn thực phẩm. (2) Tăng số lượng mẫu khảo sát, định serotype bằng kháng huyết thanh chuẩn (antisera). TÀI LIỆU THAM KHẢO TIẾNG VIỆT Hồ Huỳnh Thùy Dương, 1998. Sinh học phân tử. Nhà xuất bản Giáo dục Thành phố Hồ Chí Minh. Lê Thị Mai Khanh, 2004. Phát hiện một số gen độc lực của Escherichia coli phân lâp được từ phân và thịt của bò, heo bằng kỹ thuật multiplex – PCR. Luận văn thạc sĩ khoa học nông nghiệp. Trường đại học Nông Lâm TP. HCM. Trần Thanh Phong, 1996. Bệnh truyền nhiễm do vi trùng trên heo. Tủ sách Trường Đại học Nông Lâm TP. HCM. TIẾNG NƯỚC NGOÀI. Barrett T. J., Kaper L. B., Jerse A. E., and Wachsmuth I. K., 1992. Virulence factors in Shiga-like toxin producing Escherichia coli isolated from humans and cattle. J. Infect. Dis. 165: 970-980. Bertschinger H. U. and Fairbrother J. M.,1999. Escherichia coli infections. In Diseases of swine (Eds. B. E. Straw, S. D’ Allaire, W. L. Mengeling, and D. J. Taylor). Iowa State University Press, Iowa, USA. Beutin L., Montenegro M. A., Orskov I., Orskov F., Prada J., Zimmermann S., and Stephan R., 1989. Close association of verotoxin (shiga-like toxin) producing Escherichia coli. J. Clin. Microbiol. 27:2559-2564. Beutin L., Geier D., Steinruck S., Zimmermann S., and Scheutz F., 1993. Prevalence and some properties of verotoxin (Shiga-like-toxin)-producing Escherichia coli in seven different species of healthy domestic animals. J. Clin. Microbiol. 31:2483-2488. Beutin L., Aleksic S., Zimmermann S., and Scheutz F., 1994. Virulence factors and phenotypic traits of verotoxigenic Escherichia coli isolated from human patients in Germany. Med. Microbiol. Immunol. (Berlin) 183:13-21. Beutin L., Geier D., Zimmermann S., and Karch H., 1995. Virulence markers of Shiga like toxin producing Escherichia coli strains originating from healthy domestic animals of different species. J. Clin. Microbiol. 33:631-635. Black R. E., Merson H. M., Huq I., Aleim A. R. M., and Yunus N., 1981. Incidence and severity of rotavius and Echerichia coli in rural Banglades. Lancet I:141-143. Blanco M., Blanco J. E., Gonzalez E. A., Mora A., Jansen W., Gomes T. A. T., Zerbini L. F., Yano T., de Castro A. F. P., and Blanco J., 1997. Gene coding for enterotoxins and Verotoxins in Porcine Escherichia coli strains belonging to different O:K:H serotype: relationship with phenotype. J. Clin. Microbiol. 35:2958-2963. Botteldoorn N., Heydrick M., Rijpens N., Herman L., 2003. Detection and characterization of verotoxigenic Escherichia coli by a VTEC/EHEC multiplex – PCR in porcine faeces in pig carcass swabs. Res. Microbiol. 154:97-104. Brown T. A., 1994. Gene cloning and introduction. 3rd edition. UMIST, Manchester, UK Butler D., 1996. Novel pathogens beat food safety check. Nature 384:397. Calderwood S. B., Acheson D. W. K., Keuch G. T., Barrett T. J., Griffin P. M., Strockbine N. A., 1997. Proposed new nomenclature for SLT (VT) family. ASM News 1997:118-119. Cebula T. A., Payne W. L., and Fegn P., 1995. Simultaneous identification of strains of Escherichia coli serotype 0157:H7 and their Shiga-like toxin type by Mismatch amplification mutation assay multiplex – PCR. J. Clin. Microbiol. 33:28-250. Cerna J. F., Nataro J. P, and Garcia T. E., 2003. Multiplex – PCR for detection of three plasmid borne genes of enteroaggregative Escherichia coli strains. J. Clin. Microbiol. 42:2138-2140. Chalmers R. M., Salmon R. L., Willshaw G. A., Cheasty T., Looker N., Davies I., and Wray C., 1997. Verocytotoxin-producing Escherichia coli O157 in a famer handling horses. Lancet 349:1816. Chapman P. A., and Siddons C. A., Cerdan Malo A. T., and Harkin M. A., 1997. A 1 – year study of Escherichia coli in cattle, sheep, pigs and poultry. Epidemiol. Infect. 119:245-250. Cocolin L., Manzano M., Cantoni C., Comi G., 2000. A multiplex-PCR method to detect enterohemorrhagic (EHEC) and enteropathogenic (EPEC) Escherichia coli in arttificially contaminated foods. Int. J. Hyg. Environ. Health. 203:159-164. DesRosiers A., Fairbrother J. M., Johnson R. P., Desautels C., Letellier A. Qeessy S., 2001. Phenotypic and genotypic characterization of Escherichia coli verotoxin-producing isolates from humans and pigs. J. Food Protect. 64:1904-1911 Donnenberg M. S., Tzipori S., McKee M. L., O Brien A. D., Alroy J., and Kaper J. B., 1993. The role of the eae gene of enterohemorrhagic Escherichia coli in intimate attachment in vitro and in a porcine model. J Clin. Invest. 92:1418-1424. FAO, 1992. Microbiological analysis in the food control laboratory. FDA, 2002. “Diarrheagenic Escherichia coli”, Bacteriological Analytical manual Online, CFSAN. September 2002. <URL: Gaastra W., and Svennerholm A. M., 1996. Colonization factors of human enterotoxigenic Escherichia coli (ETEC). Trends Microbiol. 4:444-452. Gyles C. L., 1992. Escherichia coli cytotoxins and enterotoxins. Can. J. Microbiol. 38:734-746. Handl C. E., Olsson E., and Flock J. I., 1992. Evaluation of three different STb assays and comparision of enterotoxin pattern over a five-year period in Swedish porcine Escherichia coli. Diagn. Microbiol. Infect. Dis. 15:505-510. Harel J., Lapointe H., Fallara A., Lorrtie A., Bigras-Poulin M., Lariviere S., and Faibrother J. M., 1991. Detection of genes for fimbrial antigens and enterotoxins associated with Escherichia coli serogroups isolated from pig with diarrhea. J. Clin. Microbiol. 29:745-752. Hitotsubashi S., Fujii Y., Yamanaka H., and Okamoto K., 1992. Some properties of purified Escherichia coli heat-stable enterotoxin II. Infect. Immum. 60:4468-4474. Karmali M. A.,1989. Infection by verocytotoxin – producing Escherichia coli. J. Clin. Microbiol. Rev. 2:15-38. Kenny B., DeVinney R., Stein M., Reinscheid D. J., Frey E. A., and Finlay B. B., 1997. Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell 91:511-520. Keskimaki M., 2001, Shiga toxin-producing and other diarrhoeagenic Escherichia coli in Finland: pheno-and genotypic epidemiology. Academic dissertation. The Faculty of Ariculture and Forestry of the University of Helsinky, Finland. Koneman E. W., Allen S. D., Dowell V. R., and Sommers H. M., 1983. Color Atlas and extbook of Diagnostic Microbiology. 2d ed., J.B. Lippincott Co., Philadelphia, PA, pp. 57-124. Leung P. H. M., Peiris J. S. M., Ng W. W. S., Robin-Browne R. M., Bettelheim K. A., and Yam W., C., 2003. A newly discovered verotoxin variant, VT2g, produced by bovine verocytotoxigenic Escherichia coli. Appl. Environ. Microbiol. 69: 7549-7553. Levine M. M., Xu J., Kapper J. B., Lior H., Prado V., Tall B., Nataro J. P., Karch H., and Wachsmuth K., 1987. A DNA probe to identify enterohemorrhagic Escherichia coli of O157:H7 and other serotypes that cause hemorrhagic colitis and hemolytic uremic syndrome. J. Infect. Dis. 156:175-182. Makino S., Kobori H., Asakura H., Watarai M., Shirahata T., Ikeda T., et al, 2000. Detection and characterization of Shiga toxin-producing Escheichia coli from seagulls. Epidemiol. Infect. 125:55-61. Moon H. W., Schneider R. A., and Moseley S. L., 1986. Comparative prevalence of four enterotoxin genes among Escherichia coli isolated from swine. Am. J. Vet. Res. 47:210-212. Nataro J. P. and Kaper J. B., 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11(1):142-201. Neter E., Westphal O., Luderitz O., Gimo R. M., and Gorzynski E. A., 1995. Demonstration of antibodies against enteropathogenic Escherichia coli in sera of children of various ages. Pediatrics. 16:801-808. Paton A. W. and Paton J. C., 1998a. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex - PCR assay for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfb0111, and rfbo157. J. Clinical Microbiol. 36(2):598-602. Paton J. C. and Paton A. W., 1998b. Phathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infection. Clin. Microbiol. Rev. 11:450-479. Pierard D., Muyldermans G., Moriau L., Stevens D., and Lauwers S., 1998. Identification of new verocytotoxin type 2 variant B-subunit genes in human and animal Echerichia coli isolates. J. Clin. Microbiol. 36:3317-3322. Protocol online <URL: Multiplex- PCR/ Radu S., Mutalib S. A., Rusul G., Ahmad Z., Morigaki T., Asai N., Kim Y. B., Okuda J., and Nishibuchi M., 1998. Detection of Escherichia coli O157:H7 in beef marketed in Malaysia. Appl. Environ. Microbiol. 64:1153-1156. Schmidt H., Beutin L., and Karch H., 1995. Molecular Analysis of the Plasmid-encoed Hemolysin of Escherichia coli O157:H7 strain EDL 933. Infec. Immunity. 63:1055-1061. Smith H. R., and Scotland S. M., 1998. Vero cytotoxin-producing strains of Escherichia coli. J. Med. Microbiol. 26:77-85. Timisjarvi A. T., Alatossava T., 2004. Rapid DNA preparation from milk and dairy process samples for the detection of bacteria by PCR. Food Microbiol. 21:365-368. Thomas A., Cheasty T., Chart H., and Rowe B., 1994. Isolation of vero cytotoxin-producing Escherichia coli serotypes O9ab:H- and O101:H-carrying VT2 variant gene sequences from a patient with haemolytic uraemic syndrome. Eur. J. Clin. Microbiol. Infect. Dis. 13:1074-1076. Toma C., Lu Y., Higa N., Nakasone N., Chinen I., Baschkier A., Rivas M., and Iwanaga M., 2003. Multipex – PCR Assays for identification of human diarrheagenic Escherichia coli. J. Clin. Microbiol. 41:2669-2671. Wang G., Clark C. G., and Rodgerst F. G., 2002. Detection in Escherichia coli of the genes defining the O157:H7 serotype, and components of the type 2 shiga toxin family by multiplex PCR. J. Clin. Microbiol. 40:3613-3619. Wieler L. H., Vieler E., Erpenstein C., Schlapp T., Steinruck H., Bauerfeind R., Byomi A., and Baljer G., 1996. Shiga toxin-producing Escherichia coli strains from bovines: Association of adhesion with carriage of eae and other genes. J. Clin. Microbiol. 34:2980-2984. PHỤ LỤC 1 MÔI TRƯỜNG VÀ THUỐC THỬ ØMôi trường CT-SMAC SMAC Peptone 20 g Sodium chloride 5 g Bile salts 1,5 g Sorbitol 10 g Crystal violet 0,001 g Neutral red 0,03 g Agar 15 g Nước cất vừa đủ 1.000 ml CT – SUPPLEMENT Cefixime 0,05 mg/l Potassium tellurite 2,5 mg/l MAC Bacto peptone 17 g Bacto Proteose peptone 3 g Bacto Lactose 10 g Bacto Bile salts 1,5 g Sodium Chloride 5 g Bacto Agar 13,5 g Neutral Red 0,03 g Bacto Crystal Violet 0,001g Nước cất vừa đủ 1000 ml NA Peptone 5 g Sodium chloride 5 g Beef Extract 1,5 g Yeast Extract 1,5 g Agar 15 g Nước cất vừa đủ 15 g pH = 7,4 ± 0,2 (250C) Nước peptone đệm Peptone 10 g Sodium chloride 5 g Disodium hydrogen phosphate 9 g Potassium dihydrogen phosphate 1,5 g Nước cất vừa đủ 1000 ml pH = 7 SIMMON CITRAE Sodium citrate 2 g NaCl 5 g K2HPO4 1 g NH4H2PO4 1 g MgSO4 0,2 g Bromothymol blue 0,08 g Agar 15 g Nước cất vừa đủ 1000 ml MR – VP Peptone 7 g Glucose 5 g K2HPO4 5 g Nước cất vừa đủ 800 ml pH = 6,9 ± 0,2 ØThuốc thử VP (Voges Proskauer) Dung dịch A: Alpha naphthol 5 g Ethanol tuyệt đối 100 ml Dung dịch B: Potassium hydroxyde 40 g Nước cất 100 ml MR (Methyl red) Methyl red 0,1 g Alcohol 300 ml Nước cất vừa đủ 500 ml HÓA CHẤT ĐIỆN DI TBE (0,5 X) Tris HCl 3,94 mg Acid Boric 1,39 g Na2EDTA 93,06 mg Nước cất vừa đủ 500ml pH = 8,3 Agarose (1,4%) Loading dye Bromophenol blue 0,25% Sucrose 40% TE 1X vừa đủ 100% HÓA CHẤT NHUỘM GEL TBE 1X Ẹthidium bromide 10 mg/ml PHỤ LỤC 2 CÁC VẤN ĐỀ THƯỜNG GẶP TRONG MULTIPLEX – PCR VÀ HƯỚNG GIẢI QUYẾT Vấn đềà Hướng giải quyết Sản phẩm không chuyên biệt * Nếu dài - Tăng nồng độ KCl (buffer) đến 1,2 – 2 X nhưng giữ nguyên nồng độ MgCl2 ở 1,5 – 2 mM. * Nếu ngắn - Giảm nồng độ buffer còn 0,7 – 0,9 X nhưng giữ nồng độ MgCl2 ở 1,5 – 2 mM. - Tăng dần nhiệt độ ủ bắt cặp. - Giảm lượng DNA xét nghiệm. - Giảm lượng primer. - Giảm lượng Taq – polymerase. - Tăng nồng độ MgCl2 đến 3 – 4,5 mM nhưng giữ nguyên nồng độ dNTP. - Thêm chất phụ gia, tốt nhất là dùng BSA (0,1 – 0,8 mg/ml: nồng độ cuối cùng). Có thể dùng 5% glycerol (v/v nồng độ cuối). * Nếu không có sản phẩm - Chạy PCR cho mỗi cặp primer được sử dụng trong multiplex với nhiệt độ ủ bắt cặp thấp hơn bình thường. - So sánh các sản phẩm không chuyên biệt cho mỗi cặp primer kiểm tra với sản phẩm không chuyên biệt nhìn thấy khi chạy multiplex – PCR. Điều này có thể chỉ ra mỗi cặp primer mang lại những sản phẩm không chuyên biệt trong phản ứng multiplex. - Kết hợp một vài hoặc tất cả những phương pháp trên. Sản phẩm yếu (mờ) - Giảm thời gian ủ bắt cặp. - Giảm nhiệt độ kéo dài xuống 62 – 680C. - Tăng thời gian kéo dài. - Tăng nồng độ DNA xét nghiệm. - Tăng tất cả lượng primer sử dụng. - Điều chỉnh nồng độ Taq – polymerase. - Thay đổi nồng độ buffer nhưng giữ nồng độ MgCl2 ở 1,5 – 2 mM. - Tăng nồng độ MgCl2 đến 3 – 4,5 mM nhưng giữ nguyên nồng độ dNTP. - Thêm chất phụ gia, tốt nhất là dùng BSA (0,1 – 0,8 mg/ml: nồng độ cuối cùng). Có thể dùng 5% glycerol (v/v nồng độ cuối). Sản phẩm dài và yếu (mờ) - Giảm nồng độ buffer còn 0,7 – 0,8 X nhưng giữ nồng độ MgCl2 ở 1,5 – 2 mM. - Tăng nồng độ MgCl2 lên 3 – 4,4 mM nhưng giữ nguyên nồng độ dNTPs. - Tăng thời gian biến tính. - Tăng thời gian ủ bắt cặp. - Giảm nhiệt độ ủ bắt cặp. - Tăng thời gian và nhiệt độ kéo dài. - Tăng lượng primer đối với sản phẩm PCR có băng mờ đồng thời giảm lượng primer cho băng đậm. - Thêm chất phụ gia, tốt nhất là dùng BSA (0,1 – 0,8 mg/ml). Nên thử 5% glycerol (v/v nồng độ cuối cùng). - Kết hợp một vài hoặc tất cả các phương pháp trên. Sản phẩm ngắn và yếu (mờ) - Tăng nồng độ buffer đến 1,2 – 2 X nhưng giữ nồng độ MgCl2 ở 1,5 – 2 mM. - Giảm thời gian biến tính. - Giảm thời gian ủ bắt cặp. - Giảm nhiệt độ ủ bắt cặp. - Giảm thời gian và nhiệt độ kéo dài. - Tăng lượng primer đối với sản phẩm PCR có băng mờ và giảm lượng primer có băng đậm. - Thêm chất phụ gia BSA (0,1 – 0,8 mg/ml), có thể thử 5% glycerol (v/v nồng độ cuối cùng). - Keát hôïp moät vaøi hoaëc taát caû caùc phöông phaùp treân.

Các file đính kèm theo tài liệu này:

  • docNOIDUNG.doc
  • docPHANDAU.doc
  • docTRANG BIA1+2.doc