Khóa luận Nghiên cứu sự đa dạng di truyền của nấm Metarhizium anisopliae dựa vào trình tự gen PR1 và vùng RDNA- ITS

MỤC LỤC CHưƠNG TRANG Trang tựa Lời cảm tạ .iii Tóm tắt iv Mục lục v Danh śch ćc chữ viết tắt .viii Danh śch ćc bảng .ix Danh śch ćc hình x ̀ 1. MƠ ĐÂU 1̉ 1.1.Đặt vấn đề . 1 1.2.Mục tiêu v̀ yêu cầu đề t̀i 2 1.2.1. Mục tiêu 2 1.2.2. Yêu cầu đề tai 2̀ 1.3.Đối tượng nghiên cứu .2 2. TỔNG QUAN TÀI LIỆU 3 2.1. Giơi thiêu nấ m Metarhizium anisopliae .3́ ̣ 2.2. Sơ lược về phương thức xâm nhiễm của nấm ký sinh trên côn trùng. .6 2.3. Hoạt t́nh sinh học .7 2.4. Hiệu quả phòng trừ sâu hại bằng chế phẩm nấm 2.5. Một số nghiên cứu trong nước v̀ ngòi nước về nấm Metarhizium anisopliae v̀ những nấm ký sinh côn trùng kh́c ứng dụng để phòng trừ sâu hại. .8 2.5.1. Nghiên cứu trong nước .8 2.5.2. Nghiên cứu ngòi nước .9 2.6. Giơi thiêu gen Pr1 10́ ̣ 2.7. Vai tro cua Protease Pr1 . 10̀ ̉ 2.8.Tông quan về ITS-rDNA . 10̉ 2.8.1. Giơi thiêu về vung rDNA va vung ITS 10́ ̣ ̀ ̀ ̀ 2.9. Môt số nghiên cưu trong nươc va nươc ngoai về sư đa dang cua nấ m ̣ ́ ́ ̀ ́ ̀ ̣ ̣ ̉ Metarhizium anisopliae dưa vao gen Pr1 v̀ vùng rDNA-ITS . 12̣ ̀ 2.9.1. Nghiên cưu nươc ngoai . 12́ ́ ̀ 2.9.2. Nghiên cưu trong nươc 14́ ́ 2.10. Phương phap phat hiên gen Pr1 v̀ vùng rDNA-ITS . 14́ ́ ̣ 3. VẬT LIỆU VÀ PHưƠNG PHÁP NGHIÊN CỨU . 16 3.1. Thời gian v̀ địa điểm . 16 3.1.1. Thời gian . 16 3.1.2. Địa điểm 16 3.2. Vật liệu v̀ hó chất . 16 3.2.1. Vật liệu 16 3.2.2. Hó chất 17 3.2.3. Ćc thiết bị ch́nh 17 3.3.Nội dung nghiên cứu . 18 3.4. Phương ph́p nghiên cứu 18 3.4.1.Kiêm tra DNA tông số đươc ly trich tư cac dong nấ m ̉ ̉ Metarhizium ̣ ́ ̀ ́ ̀ anisopliae . 18 3.4.2. Khuếch đại gen Pr1 . 18 3.4.3. Khuế ch đai vung rDNA-ITS .21̣ ̀ 3.5. Tiế n hanh giai trinh tư gen gây đôc Pr1 v̀ vùng ITS 22̀ ̉ ̀ ̣ ̣ ̉ 3.6. Tinh sach san phâm PCR 22̣ ̉ 3.7. Tinh sạch sản phẩm đọc trình tự .24 3.8. Phương phap phân tich trinh tư 24́ ́ ̀ ̣ 4. KẾT QUẢ VÀ THẢO LUẬN .26 4.4. DNA cua cac mâu nấ m Metarhizium anisopliae đươc dung trong nghiêñ ̣ ̉ ́ ̀ cưu .26́ 4.5. Kế t qua tinh sach DNA tông số 28̉ ̣ ̉ 4.6. Kế t qua khuế ch đai vung ITS1-5.8S-ITS2. 28̉ ̣ ̀ 4.7. Kế t qua giai trinh tư vung ITS1-5.8S-ITS2 29̉ ̉ ̀ ̣ ̀ 4.8. Kế t quả khuếch đại gen Pr1 .36 4.9. Kế t qua đoc trinh tư gen Pr1 36̉ ̣ ̀ ̣ 5. KẾT LUẬN VÀ ĐỀ NGHỊ 42 5.4. Kết luận 42 5.4.2. Ph́t hiện v̀ đọc trình tự gen Pr1 .42 5.4.3. Ph́t hiện v̀ đọc trình tự vùng rDNA-ITS 42 5.5. Đề nghị .43 5.6. Hạn chế của đề t̀i .43 6. TÀI LIỆU THAM KHẢO 44 7. PHỤ LỤC .47 DANH SÁCH CÁC BẢNG BẢNG TRANG Bảng 2.1 Giơi thiêu nấ m Metarhizium anisopliae .3́ ̣ Bảng 3.1 Nguồ n nấ m Metarhizium anisopiae đươc thu thâp ơ môt số đia ̣ ̣ ̉ ̣ ̣ phương dung trong thi nghiêm 16̀ ́ ̣ Bảng 3.2 Th̀nh phần của phản ứng PCR khuếch đại gen Pr1 vơi căp primer ́ ̣ METPR1/METPR4 . 19 Bảng 3.3 Th̀nh phần của phản ứng PCR khuếch đại gen Pr1 vơi căp primer ́ ̣ METPR2/METPR5 .20 Bảng 3.4 Th̀nh phần của phản ứng PCR khuếch đại gen vùng rDNA -ITS .21 Bảng 3.5 Th̀nh phần của phản ứng đọc trình tự 23 Bảng 4.1 Ćc ngùn nấm Metarhizium anisopliae trên genbank đươc dung đê ̉ ̣ ̀ so sanh trinh tư vung rDNA-ITS .30́ ̀ ̣ ̀ Bảng 4.2 Ma trân khoang cach giưa cac dong nấ m Metarhizium anisopliae trong̣ ̉ ́ ̃ ́ ̀ nươc khi dưa vao trinh tư vung rDNA-ITS .31́ ̣ ̀ ̀ ̣ ̀ Bảng 4.3 Ma trân khoang cach giưa cac dong nấ m Metarhizium anisopliae trong̣ ̉ ́ ̃ ́ ̀ nươc va trên thế giơi dưa vao trinh tư vung rDNA-ITS .33́ ̀ ́ ̣ ̀ ̀ ̣ ̀ Bảng 4.4 Ćc ngùn nấm Metarhizium anisopliae trên genbank đươc dung đê so ̉ ̣ ̀ śnh trình tự gen Pr1 .37 Bảng 4.5 Ma trân khoang cach giưa cac dong nấ m Metarhizium anisopliae trong̣ ̉ ́ ̃ ́ ̀ nươc khi dưa vao trinh tư gen Pr1 38́ ̣ ̀ ̀ ̣ Bảng 4.6 Ma trân khoang cach giưa cac dong nấ m Metarhizium anisopliae trong̣ ̉ ́ ̃ ́ ̀ nươc va trên thế giơi dưa vao trinh tư gen Pr1 40́ ̀ ́ ̣ ̀ ̀ ̣ DANH SÁCH CÁC HÌNH HÌNH TRANG Hình 2.1 Nấm Metarrhizium anisopliae ký sinh trên những côn trùng kh́c nhau 5 Hình 2.2 Sơ đồ cua cac vung trên rDNA . 12̉ ́ ̀ Hình 3.1 Sơ đồ primer đươc sư dung đê khuế ch đai gen Pr1 18̉ ̣ ̣ ̣ ̉ Hình 3.2 Sơ đồ primer đươc sư dung đê khuế ch đai vung ITS .21̉ ̣ ̣ ̣ ̉ ̀ Hình 3.3 Nhưng phương phap đươc sư dung trong phân tich trình tự 24̃ ́ ̣ ̉ ̣ ́ Hình 3.4 Sơ đồ phân tich trinh tư co đô tương đồ ng cao .25́ ̀ ̣ ́ ̣ Hình 4.1 DNA tổng số của nấm Metarrhizium anisopliae 26 Hình 4.2 Sơ đồ tinh sach DNA tông số cua cac mâu nấ m Metarhizium̉ ̃ ̣ ̉ ́ anisopliae đươc sư dung trong nghiên cưu .27̣ ̉ ̣ ́ Hình 4.3 DNA tông số cua nấ m Metarhizium anisopliae đươc tinh sach .28̉ ̣ ̣ ̉ Hình 4.4 Hình khuếch đại vùng rDNA-ITS 28 Hình 4.5 Cây ph́t sinh lòi giữa ćc dòng Metarhizium anisopliae trong nước dựa v̀o trình tự vùng rDNA-ITS 32 Hình 4.6 So sanh quan hê giữa ćc dòng Metarhizium anisopliae trong nước v̀ ́ ̣ trên thế giới dưa vao trinh tư vung rDNA-ITS 34̣ ̀ ̀ ̣ ̀ Hình 4.7 Hình khuếch đại gen Pr1 .36 Hình 4.8 Cây ph́t sinh lòi giữa ćc dòng Metarhizium anisopliae trong nước dựa v̀o trình tự gen Pr1 39 Hình 4.9 So sanh quan hê giữa ćc dòng Metarhizium anisopliae trong nước v̀ ́ ̣ trên thế giới dưa vao trinh tư gen Pr1 .41̣ ̀ ̀ ̣

pdf76 trang | Chia sẻ: lvcdongnoi | Ngày: 25/01/2013 | Lượt xem: 1222 | Lượt tải: 2download
Tóm tắt tài liệu Khóa luận Nghiên cứu sự đa dạng di truyền của nấm Metarhizium anisopliae dựa vào trình tự gen PR1 và vùng RDNA- ITS, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NÔNG LÂM TP. HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC ************* KHÓA LUẬN TỐT NGHIỆP NGHIÊN CƢ́U SỰ ĐA DAṆG DI TRUYỀN CỦA NẤM Metarhizium anisopliae DƢẠ VÀO TRÌNH TƢ ̣ GEN Pr1 VÀ VÙNG rDNA-ITS Ngành học: CÔNG NGHỆ SINH HỌC Niên khóa : 2003 - 2007 Sinh viên thƣc̣ hiêṇ: TRẦN NHÂṬ NAM Thành phố Hồ Chí Minh Tháng 9/2007 BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NÔNG LÂM TP. HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC ************* KHOÁ LUẬN TỐT NGHIỆP NGHIÊN CƢ́U SƢ ̣ĐA DAṆG DI TRUYỀN CỦA NẤM Metarhizium anisopliae DƢẠ VÀO TRÌNH TƢ ̣ GEN Pr1 VÀ VÙNG rDNA-ITS Giáo viên hƣớng dẫn: Sinh viên thƣc̣ hiêṇ: ThS. VÕ THỊ THU OANH TRẦN NHÂṬ NAM TS. LÊ ĐÌNH ĐÔN Thành phố Hồ Chí Minh Tháng 9/2007 iii LỜI CẢM ƠN  Con xin cảm ơn Ba Mẹ cùng gia đình đã nuôi con đến ngày khôn lớn và cho con ăn học thành tài. Em xin chân thành cảm ơn:  Các Thầy Cô trong trƣờng Đại học Nông Lâm TP. Hồ Chí Minh đã tận tình truyền đạt kiến thức cho em trong suốt 4 năm học.  Ban chủ nhiệm cùng các Thầy Cô trong Bộ Môn Công Nghệ Sinh Học đã động viên, giúp đỡ em trong thời gian thực hiện khóa luận.  TS. Lê Đình Đôn, ThS. Võ Thị Thu Oanh , CN. Lƣu Phúc Lợi đã tận tình chỉ dẫn em trong suốt quá trình thực hiện khóa luận.  Anh Nguyêñ Văn Lâm̃ đã hết lòng hƣớng dẫn em trong quá trình thực hiện khóa luận.  Các anh chị trong Trung tâm Phân tích và Thí nghiệm Hóa sinh đã động viên, chia sẻ kinh nghiêṃ và giúp đỡ em trong quá trình thực hiện khóa luận.  Xin cám ơn cuôc̣ sống đa ̃đem laị cho tôi nhƣ̃ng ngƣời baṇ , nhƣ̃ng ngƣời đa ̃cùng tôi chia sẻ và động viên tôi trong suốt quá trình thƣc̣ hiêṇ khóa luâṇ. Xin chân thành cảm ơn! TRẦN NHÂṬ NAM iv TÓM TẮT Đề tài nghiên cứu: “Nghiên cứu sƣ ̣tính đa dạng di truyền của nấm Metarhizium anisopliae dựa vào trình tự gen Pr1 và vùng rDNA-ITS “ đƣợc thực hiện từ ngày 26 tháng 3 năm 2007 đến ngày 31 tháng 8 năm 2007 tại trƣờng Đại Học Nông Lâm thành phố Hồ Chí Minh. Đề tài do Trần Nhâṭ Nam thực hiện dƣới sự hƣớng dẫn của ThS . Võ Thị Thu Oanh và TS. Lê Đình Đôn. Đối tƣợng nghiên cứu là nấm Metarhizium anisopliae ký sinh trên côn trùng gây hại. Đây là giống nấm có hoaṭ tính tiêu diêṭ côn trùng maṇh . Mục đích đề tài nhằm nghiên cƣ́u sƣ ̣đa daṇg về măṭ di truyền giƣ̃a các dòng nấm dƣạ trên cơ sở trình tƣ ̣ nucleotide của gen Pr1 và vùng rDNA-ITS Kết quả thu đƣợc nhƣ sau: - Xác định đƣợc những dòng nấm Metarhizium anisopliae sƣ̉ duṇg trong nghiên cƣ́u thuôc̣ dòng Metarhizium anisopliae var. anisopliae. - Phát hiện gen Pr1 ở trên 10 dòng nấm Metarhizium anisopliae. Tiến hành giải trình tự gen Pr1 của10 mâũ nấm. Kích thƣớc của gen Pr1 ở 7 mâũ nấm là 1091bp. - Có sự khác biêṭ về măṭ di truyền giƣ̃a các dòng Metarhizium anisopliae trong nƣớc và giƣ̃a các dòng trong nƣớc với các dòng trên genbank .Tỉ lệ tƣơng đồng giữa các dòng trong nƣớc khoảng 95-100%, và giữa các dòng trong nƣớc so với các dòn g trên thế giới là 94-99% khi so sánh trình tƣ ̣gen Pr1 - Phát hiện đƣợc 4 vị trí đột biến ở 2 dòng BXDTG và RBCQ 9 so với nhƣ̃ng dòng còn lại. Nhƣ̃ng đôṭ biến này đều xảy ra ở vùng ITS1. - Có sự bảo tồn cao trong vùng 5.8S và vùng ITS2 giƣ̃a nhƣ̃ng dòng nấm Metarhizium anisopliae đƣơc̣ sƣ̉ duṇg trong đề tài . Tỉ lệ tƣơng đồng giữa những dòng trong nƣớc là 99- 100% và giữa các dòng trong nƣớc với các dòng trên genbank là 92-100% khi so sánh trình tƣ ̣ vùng rDNA-ITS. v MỤC LỤC CHƢƠNG TRANG Trang tựa Lời cảm tạ .............................................................................................................iii Tóm tắt .................................................................................................................. iv Mục lục .................................................................................................................. v Danh sách các chữ viết tắt ...................................................................................viii Danh sách các bảng ............................................................................................... ix Danh sách các hình ................................................................................................ x 1. MỞ ĐẦU ................................................................................................................ 1 1.1. Đặt vấn đề ............................................................................................................. 1 1.2. Mục tiêu và yêu cầu đề tài .................................................................................... 2 1.2.1. Mục tiêu ...................................................................................................... 2 1.2.2. Yêu cầu đề tài .............................................................................................. 2 1.3.Đối tƣợng nghiên cứu ........................................................................................... 2 2. TỔNG QUAN TÀI LIỆU ...................................................................................... 3 2.1. Giới thiêụ nấm Metarhizium anisopliae ............................................................... 3 2.2. Sơ lƣợc về phƣơng thức xâm nhiễm của nấm ký sinh trên côn trùng. ................. 6 2.3. Hoạt tính sinh học ................................................................................................. 7 2.4. Hiệu quả phòng trừ sâu hại bằng chế phẩm nấm .................................................... 2.5. Một số nghiên cứu trong nƣớc và ngoài nƣớc về nấm Metarhizium anisopliae và những nấm ký sinh côn trùng khác ứng dụng để phòng trừ sâu hại. ............... 8 2.5.1. Nghiên cứu trong nƣớc ............................................................................... 8 2.5.2. Nghiên cứu ngoài nƣớc ............................................................................... 9 2.6. Giới thiêụ gen Pr1 .............................................................................................. 10 2.7. Vai trò của Protease Pr1 ..................................................................................... 10 vi 2.8.Tổng quan về ITS-rDNA ..................................................................................... 10 2.8.1. Giới thiêụ về vùng rDNA và vùng ITS ...................................................... 10 2.9. Môṭ số nghiên cƣ́u trong nƣớc và nƣớc ngoài về sƣ ̣đa daṇg của nấm Metarhizium anisopliae dƣạ vào gen Pr1 và vùng rDNA-ITS ................................. 12 2.9.1. Nghiên cƣ́u nƣớc ngoài ............................................................................. 12 2.9.2. Nghiên cƣ́u trong nƣớc .............................................................................. 14 2.10. Phƣơng pháp phát hiêṇ gen Pr1 và vùng rDNA-ITS ....................................... 14 3. VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU ............................................. 16 3.1. Thời gian và địa điểm ......................................................................................... 16 3.1.1. Thời gian ................................................................................................... 16 3.1.2. Địa điểm .................................................................................................... 16 3.2. Vật liệu và hoá chất ............................................................................................. 16 3.2.1. Vật liệu ...................................................................................................... 16 3.2.2. Hoá chất .................................................................................................... 17 3.2.3. Các thiết bị chính ...................................................................................... 17 3.3. Nội dung nghiên cứu ........................................................................................... 18 3.4. Phƣơng pháp nghiên cứu .................................................................................... 18 3.4.1.Kiểm tra DNA tổng số đƣơc̣ ly trích tƣ̀ các dòng nấm Metarhizium anisopliae ............................................................................................................. 18 3.4.2. Khuếch đại gen Pr1 ................................................................................. 18 3.4.3. Khuếch đaị vùng rDNA-ITS ..................................................................... 21 3.5. Tiến hành giải trình tƣ ̣gen gây đôc̣ Pr1 và vùng ITS .................................... 22 3.6. Tinh sac̣h sản phẩm PCR ................................................................................ 22 3.7. Tinh sạch sản phẩm đọc trình tự..................................................................... 24 3.8. Phƣơng pháp phân tích trình tƣ ̣...................................................................... 24 4. KẾT QUẢ VÀ THẢO LUẬN ............................................................................... 26 4.4. DNA của các mâũ nấm Metarhizium anisopliae đƣơc̣ dùng trong nghiên vii cƣ́u ............................................................................................................................. 26 4.5. Kết quả tinh sac̣h DNA tổng số ...................................................................... 28 4.6. Kết quả khuếch đaị vùng ITS1-5.8S-ITS2. .................................................... 28 4.7. Kết quả giải trình tƣ ̣vùng ITS1-5.8S-ITS2 .................................................... 29 4.8. Kết quả khuếch đại gen Pr1………………………………………………...36 4.9. Kết quả đoc̣ trình tƣ ̣gen Pr1………………………………………………………36 5. KẾT LUẬN VÀ ĐỀ NGHỊ .................................................................................... 42 5.4. Kết luận .......................................................................................................... 42 5.4.2. Phát hiện và đọc trình tự gen Pr1 ............................................................. 42 5.4.3. Phát hiện và đọc trình tự vùng rDNA-ITS ................................................ 42 5.5. Đề nghị ........................................................................................................... 43 5.6. Hạn chế của đề tài ........................................................................................... 43 6. TÀI LIỆU THAM KHẢO ...................................................................................... 44 7. PHỤ LỤC ............................................................................................................... 47 viii DANH SÁCH CÁC CHỮ VIẾT TẮT BXĐTG : Bọ xít đen Tiền Giang BXĐTV : Bọ xít đen Trà Vinh RBCQ9 : Rầy bông cúc Quận 9 BDQ96 : Bọ dừa Quận 9 6 BDTV5 : Bọ dừa Trà Vinh 5 BDTN : Bọ dừa Tây Ninh BDBD7 : Bọ dừa Bình Định 7 SCLLLA : Sâu cuốn lá lúa Long An RNBT : Rầy nâu Bến Tre RNLA : Rầy nâu Long An ng : nano gram nm : nano mol g : micro gram m : micro mol M : micro mol/lít l : micro lít TE : tris EDTA dNTP : deoxyribonucleotide – 5 – trphosphate TAE : tris acetic EDTA UI : unit international bp : base pair Kb : kilo base ctv : cộng tác viên PCR : Polymerase Chains Reaction Rpm : Revolutions per minute ix DANH SÁCH CÁC BẢNG BẢNG TRANG Bảng 2.1 Giới thiêụ nấm Metarhizium anisopliae ............................................... 3 Bảng 3.1 Nguồn nấm Metarhizium anisopiae đƣơc̣ thu thâp̣ ở môṭ số điạ phƣơng dùng trong thí nghiêṃ ........................................................................................ 16 Bảng 3.2 Thành phần của phản ứng PCR khuếch đại gen Pr1 với căp̣ primer METPR1/METPR4 ......................................................................................................... 19 Bảng 3.3 Thành phần của phản ứng PCR khuếch đại gen Pr1 với căp̣ primer METPR2/METPR5 ......................................................................................................... 20 Bảng 3.4 Thành phần của phản ứng PCR khuếch đại gen vùng rDNA -ITS .... .21 Bảng 3.5 Thành phần của phản ứng đọc trình tự ................................................ 23 Bảng 4.1 Các nguồn nấm Metarhizium anisopliae trên genbank đƣơc̣ dùng để so sánh trình tƣ ̣vùng rDNA-ITS. .................................................................................... 30 Bảng 4.2 Ma trâṇ khoảng cách giƣ̃a các dòng nấm Metarhizium anisopliae trong nƣớc khi dƣạ vào trình tƣ ̣vùng rDNA-ITS ..................................................................... 31 Bảng 4.3 Ma trâṇ khoảng cách giƣ̃a các dòng nấm Metarhizium anisopliae trong nƣớc và trên thế giới dƣạ vào trình tƣ ̣vùng rDNA-ITS.................................................33 Bảng 4.4 Các nguồn nấm Metarhizium anisopliae trên genbank đƣơc̣ dùng để so sánh trình tự gen Pr1 ....................................................................................................... 37 Bảng 4.5 Ma trâṇ khoảng cách giƣ̃a các dòng nấm Metarhizium anisopliae trong nƣớc khi dƣạ vào trình tƣ ̣gen Pr1 .................................................................................. 38 Bảng 4.6 Ma trâṇ khoảng cách giƣ̃a các dòng nấm Metarhizium anisopliae trong nƣớc và trên thế giới dƣạ vào trình tƣ ̣gen Pr1..............................................................40 x DANH SÁCH CÁC HÌNH HÌNH TRANG Hình 2.1 Nấm Metarrhizium anisopliae ký sinh trên những côn trùng khác nhau ........................................................................................................ 5 Hình 2.2 Sơ đồ của các vùng trên rDNA ............................................................. 12 Hình 3.1 Sơ đồ primer đƣơc̣ sƣ̉ duṇg để khuếch đaị gen Pr1 .............................. 18 Hình 3.2 Sơ đồ primer đƣơc̣ sƣ̉ duṇg để khuếch đaị vùng ITS ........................... 21 Hình 3.3 Nhƣ̃ng phƣơng pháp đƣơc̣ sƣ̉ duṇg trong phân tích trình tự ................ 24 Hình 3.4 Sơ đồ phân tích trình tƣ ̣có đô ̣tƣơng đồng cao ..................................... 25 Hình 4.1 DNA tổng số của nấm Metarrhizium anisopliae ...................................... 26 Hình 4.2 Sơ đồ tinh sac̣h DNA tổng số của các mâũ nấm Metarhizium anisopliae đƣơc̣ sƣ̉ duṇg trong nghiên cƣ́u ......................................... 27 Hình 4.3 DNA tổng số của nấm Metarhizium anisopliae đƣơc̣ tinh sac̣h ........... 28 Hình 4.4 Hình khuếch đại vùng rDNA-ITS ........................................................ 28 Hình 4.5 Cây phát sinh loài giữa các dòng Metarhizium anisopliae trong nƣớc dựa vào trình tự vùng rDNA-ITS ........................................................ 32 Hình 4.6 So sánh quan hê ̣giữa các dòng Metarhizium anisopliae trong nƣớc và trên thế giới dƣạ vào trình tƣ ̣vùng rDNA-ITS.................................... 34 Hình 4.7 Hình khuếch đại gen Pr1 ..................................................................... 36 Hình 4.8 Cây phát sinh loài giữa các dòng Metarhizium anisopliae trong nƣớc dựa vào trình tự gen Pr1 ...................................................................... 39 Hình 4.9 So sánh quan hê ̣giữa các dòng Metarhizium anisopliae trong nƣớc và trên thế giới dƣạ vào trình tƣ ̣gen Pr1 ................................................. 41 1 Chƣơng 1. MỞ ĐẦU 1.1. Đặt vấn đề. Nông nghiệp đóng vai trò quan trọng trong nền kinh tế nƣớc ta. Trong sản xuất nông nghiệp ngƣời nông dân gặp rất nhiều khó khăn, trong đó khó khăn lớn nhất là việc phòng trừ và tiêu diệt các loại côn trùng gây hại cho cây trồng. Hiện nay trên thị trƣờng xuất hiện rất nhiều loại thuốc hóa học dùng trong nông nghiệp.Tuy nhiên việc sử dụng những sản phẩm này trong một thời gian dài cộng với liều lƣợng ngày càng tăng đã và đang ảnh hƣởng nặng nề đến môi trƣờng, làm xuất hiện nhiều loại sâu bệnh và côn trùng kháng thuốc, làm giảm chất lƣợng đất.Và nguy hiểm hơn cả là việc thuốc trừ sâu xuất hiện trong sản phẩm sau khi thu hoạch đã ảnh hƣởng trực tiếp tới sức khỏe ngƣời tiêu dùng. Trƣớc thực trạng này các nhà khoc học đã nghiên cứu và đƣa ra phƣơng pháp mới trong việc phòng trừ và tiêu diệt các loài gây hại cho côn trùng. Một trong những phƣơng pháp đó là kiểm soát sinh học thông qua việc sử dụng các chế phẩm có nguồn gốc từ nấm, virus, vi khuẩn hoặc sử dụng ký sinh thiên địch, các hợp chất thứ cấp có nguồn gốc thảo mộc để phòng trừ và tiêu diệt các loài côn trùng gây hại một cách hiệu quả và an toàn hơn. Trong các loại vi sinh vật gây hại cho côn trùng đáng chú ý nhất là ngành phụ nấm bất toàn mà đại diện tiêu biểu là nấm Metarhizium anisopliae-một trong những loài có đặc tính diệt côn trùng mạnh nhất. Trên thế giới nấm Metarhizium anisopliae là đối tƣợng nghiên cứu của rất nhiều công trình khoa và đã đƣợc thƣơng mại hóa từ lâu – nhƣ là một loại thuốc trừ sâu sinh học trong công tác phòng chống một số loại côn trùng gây hại trên nhiều loại cây trồng khác nhau. 2 Trƣớc đây việc nghiên cứu về đa dạng sinh học chỉ dừng lại ở mức độ đánh giá hình thái nên còn nhiều hạn chế. Ngày nay với sự ra đời của nhiều kĩ thuật mới nhƣ kĩ thuật PCR và những ứng dụng từ PCR nhƣ RAPD, RFLP, AFLP, Southern blot, Sequence v.v.. đã giúp cho quá trình nghiên cứu nhanh và chính xác hơn.Tuy nhiên những nghiên cứu nhƣ vậy ở nƣớc ta còn rất ít. Xuất phát từ những đặc điểm trên, đƣợc sự cho phép và phân công của Bộ môn Công Nghệ Sinh Học chúng tôi đã tiến hành thực hiện đề tài “Nghiên cứu sự đa dạng di truyền của nấm Metarhizium anisopliae dựa vào trình tự gen Pr1 và vùng rDNA- ITS “. 1.2. Mục tiêu và yêu cầu đề tài. 1.2.1.Mục tiêu Nghiên cƣ́u sƣ ̣đa daṇg di truyền của nhƣ̃ng dòng nấm Metarhizium anisopliae đƣơc̣ phân lâp̣ trên nhiều đối tƣơṇg cây trồng khác nhau ở các tỉnh th ành trên cả nƣớc dƣạ vào trình tƣ ̣của gen gây đôc̣ Pr1 và vùng rDNA-ITS. 1.2.2. Yêu cầu đề tài. - Kiểm tra DNA đƣơc̣ ly trích tƣ̀ nhƣ̃ng dòng nấm Metarhizium anisopliae đƣơc̣ sƣ̉ duṇg trong nghiên cƣ́u. - Xác định gen gây độc Pr1 và vùng rDNA-ITS bằng kỹ thuâṭ PCR. - Xác định trình tự gen Pr1 và vùng rDNA -ITS và tìm sƣ ̣khác biêṭ về trình tƣ ̣ giƣ̃a các dòng nấm Metarhizium anisopliae. 1.3. Đối tƣợng nghiên cứu. Nấm Metarhizium anisopliae thu thập ở các tỉnh thành khác nhau nhƣ: Long An, Trà Vinh, Tây Ninh, Bến Tre, Bình Điṇh, Quận 9 thành phố Hồ Chí Minh gây hại cho côn trùng trên các đối tƣợng cây trồng khác nhau. 3 Chƣơng 2. TỔNG QUAN TÀI LIỆU 2.1. Giới thiệu nấm Metarhizium anisopliae. Bảng 2.1: Giới thiệu nấm Metarhizium anisopliae. Kingdom (Giới) Fungi Phylum (Ngành) Ascomycota Class (Lớp) Sordariomycetes Order (Bộ) Hypocreles Family (Họ) Clavicipitaceae Genus (Giống) Metarhizium Species (Loài) Metarhizium anisopliae Nấm này đƣợc Metschinikov phát hiện đầu tiên vào năm 1878 trên bọ hung hại lúa mì. Nấm thƣờng gây bệnh cho côn trùng sống trong đất, thuộc vi sinh vật đất trong tự nhiên. Bào tử của nấm sau 24 giờ tiếp xúc với bề mặt cơ thể côn trùng thì bắt đầu mọc mầm và xâm nhập vào bên trong. Trong cơ thể côn trùng sợi nấm phát triển xâm nhập vào các bộ phận nội quan. Sau khi vật chủ chết, sợi nấm mọc ra ngoài cơ thể côn trùng tạo thành lớp nấm màu trắng hơi hồng nhạt. Trên đó tạo thành các khuẩn lạc màu xanh xám. Quá trình phát triển của bệnh trong cơ thể côn trùng là 4 – 6 ngày tùy thuộc vào loài và tuổi vật chủ cũng nhƣ nguồn bệnh ban đầu. Vào giai đoạn cuối cùng của quá trình phát triển bệnh lý thì côn trùng chết. 4 Nấm Metarhizium anisopliae có 2 dạng chính: M. anisopliae var. major có bào tử dài với kích thƣớc bào tử túi 10,0 – 14,0 (18,0) m và M. anisopliae var. anisopliae có bào tử ngắn với kích thƣớc bào tử túi là 3,5 – 9,0 (thƣờng 5,0 – 8,0) m. Nấm xanh (nấm Metarrhizium anisopliae) sinh ra các độc tố destruxin A và B (Bùi Xuân Đồng, Nguyễn Huy Văn, 2000). Nấm Metarhizium anisopliae ký sinh trên 200 loài côn trùng thuộc các bộ: Orthoptera (11 loài), Dermaptera (1 loài), Hemiptera (21 loài), Lepidoptera (27 loài), Diptera (4 loài), Hymenoptera (6 loài) và Coloptera (134 loài). Nấm xanh có thể nuôi cấy trên môi trƣờng thức ăn nhân tạo. Metarhizium anisopliae là chủng gây bệnh mạnh nhất cho côn trùng thuộc bộ Coleoptera. Hơn 204 loài côn trùng thuộc họ Elaleridae và Curculionidae bị nhiễm bệnh bởi Metarhizium anisopliae (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hƣơng Giang, 1997). Ngoài ra Metarhizium anisopliae còn gây bệnh trên ấu trùng muỗi Aedes aegypti, Anopheles stephensi và Clex pipiens thuộc Diptera, côn trùng hại lúa Scotinophara coarctata thuộc họ Heminoptera, châu chấu Schistocera gragaria thuộc họ Testigolidae, loài mối Nasutitermes exitiosus thuộc họ Termitidae. Nấm này phân bố rộng trong tự nhiên. M. anisopliae với bào tử dạng trụ và khuẩn lạc xanh đen hoặc đôi khi màu tối hoặc hồng vỏ quế. Khuẩn lạc mọc chậm, trên môi trƣờng OA sau 10 ngày nuôi cấy ở 20 oC có đƣờng kính 2 cm. Đã có nhiều nghiên cứu về sự phân bố của chúng: Nepal, New Zealand, New Caledonia, Bahamas, Mỹ, Canada, Bắc Ireland, Italia, Turkey, Liên Xô (cũ). Ở những nơi không có côn trùng cũng phân lập đƣợc Metarhizium anisopliae: nang của Nematod (Heterodenas chachatii và Globodera rostochensis), các hạt ngoài đồng và trong đất trồng ở Canada, đất trồng chuối ở Honduras, đất trồng dâu ở Braril, đất trồng cỏ ở New Zealand. Ngay ở những nơi có thời tiết khắc nghiệt của nƣớc Đức, ở đất 5 rừng sau khi đốt cháy, trong chất thải hữu cơ (chuẩn bị ô nhiễm), trầm tích cửa sông, đất đầm lầy trồng cây đƣớc, tổ của một số loài chim và rễ của dâu tây cũng đều phân lập đƣợc Metarhizium anisopliae. Đặc điểm sinh lý, sinh hóa của nấm Metarhizium anisopliae: - Không thể sinh trƣởng tốt trên nền cơ chất không có chitin. - Sống đƣợc ở nhiệt độ thấp (8oC), biên độ của độ ẩm rộng, ở nơi tích lũy nhiều CO2 và O2 chúng có thể sống sót tới 445 ngày. Khi hoại sinh trong đất, bào tử dính bị ức chế nảy mầm bởi khu hệ nấm đất, trong đó có chủng Aeromonas (thí nghiệm in vitro). - Ở dƣới 10oC và trên 35oC thì sự hình thành bào tử không thể xảy ra. - Nhiệt độ tốt nhất cho sự nảy mầm bào tử là 25 – 30oC và chết ở 49oC trong 10 phút. - Nhiệt độ tốt nhất cho sự sinh trƣởng là 25oC và pH 3,3 – 8,5. - Metarhizium anisopliae có khả năng phân giải tinh bột, cellulose và kitin (lông và da côn trùng). (Trần Văn Mão, 2004). Hình 2.1: Nấm Metarhizium anisopliae ký sinh trên những côn trùng khác nhau 6 2.2. Sơ lƣợc về phƣơng thức xâm nhiễm của nấm ký sinh trên côn trùng. Hầu hết những loài nấm gây bệnh cho côn trùng đều xâm nhập vào cơ thể vật chủ không qua đƣờng miệng, mà qua lớp vỏ cơ thể, nghĩa là phải có sự tiếp xúc của nguồn nấm với bề mặt cơ thể vật chủ. Bào tử nấm bám vào bề mặt cơ thể vật chủ, trong điều kiện đủ độ ẩm bào tử mọc mầm và xâm nhiễm vào bên trong cơ thể côn trùng qua lớp vỏ chitin nhờ áp lực cơ giới hoặc hoạt động men của nấm. Nấm tiết ra loại men làm mềm lớp vỏ chitin và tạo thành một lỗ thủng tại nơi bào tử mọc mầm, qua lỗ thủng dó bào tử xâm nhập vào bên trong cơ thể côn trùng. Do khả năng xâm nhập vào bên trong cơ thể côn trùng qua lớp vỏ cơ thể nên nấm có thể ký sinh đƣợc côn trùng chích hút và cả những pha phát triển của côn trùng nhƣ trứng, nhộng mà các vi sinh vật khác không ký sinh đƣợc. Nấm cũng có thể xâm nhập vào bên trong cơ thể côn trùng qua đƣờng miệng. Từ miệng, bào tử đi tới ruột và qua thành ruột xâm nhiễm vào các tế bào nội quan để gây bệnh. Xâm nhiễm kiểu này chủ yếu là bào tử của các loài nấm ở nƣớc. Dƣới tác động của độc tố do bào tử nấm tiết ra có thể dẫn tới hiện tƣợng ngừng nhu động ruột của vật chủ. Thí dụ, trƣờng hợp bào tử nấm Aspergillus trong ruột ong mật. Bào tử nấm còn có thể xâm nhập qua lỗ thở hoặc cơ quan sinh dục để vào bên trong cơ thể côn trùng nhƣng rất ít. Sự xâm nhiễm và phát triển của nấm trong cơ thể côn trùng là một quá trình phức tạp, gồm 3 giai đoạn chính sau đây Sự xâm nhập Nấm ký sinh côn trùng có thể xâm nhập vào cơ thể côn trùng bằng sự xâm nhập trực tiếp qua lớp cutin, theo cách này thì nấm tiết ra enzyme phân hủy lớp cutin để có thể xâm nhập vào bên trong cơ thể côn trùng. Ngoài ra nấm ký sinh côn trùng còn có thể xâm nhập gián tiếp vào cơ thể vật chủ qua thành ống tiêu hoá, qua lổ thở, qua vết thƣơng trên cơ thể côn trùng. 7 Sự phát triển của nấm tới khi côn trùng chết Sau khi xâm nhập vào cơ thể côn trùng thì chúng bắt đầu sinh sôi nảy nở bên trong cơ thể côn trùng và côn trùng chết trong khoảng 3 tuần. Sự sinh trƣởng và phát triển của nấm sau khi côn trùng vật chủ chết Sau khi côn trùng chết, nấm tiếp tục phát triển hình thành lớp bào tử bao phủ toàn bộ bề mặt ngoài của vật chủ. Lớp bào tử này ban đầu có màu trắng sau chuyển qua màu xanh lục Các nấm gây bệnh cho côn trùng chỉ sinh trƣởng phát triển để hoàn thành một chu kỳ sống của chúng: từ mọc mầm bào tử đến hình thành bào tử mới. Nấm gây bệnh côn trùng có tính chuyên tính hẹp, chỉ ký sinh một vật chủ hoặc một giai đoạn nhất định của vật chủ. Nhiều trƣờng hợp chúng là ký sinh có tính chuyên hóa thức ăn rộng, có thể ký sinh nhiều loài côn trùng thuộc các giống, họ, bộ khác nhau. Để có thể gây đƣợc những dịch bệnh nấm lớn cho sâu hại, các đặc điểm của nấm đóng một vai trò quan trọng là: độc tính của nấm, khả năng di chuyển bào tử trong những điều kiện không thuận lợi và khả năng phát tán trong thiên nhiên. Đặc điểm đặc biệt đối với các nấm họ Entomophthoraceae đó là hoạt động bắn bào tử xa một khoảng cách gấp hàng nghìn lần kích thƣớc của nó. Điều đó tạo khả năng phát tán rộng lớn hơn trong quần thể côn trùng. Sự phát tán có hiệu quả cao hay không ở mức độ nhất định cũng phụ thuộc vào độ nhất định cũng phụ thuộc vào. 2.3. Hoạt tính sinh học. Theo nhiều tài liệu của nhiều tác giả cho biết các nấm Muscardine (ví dụ nấm Muscardine trắng: Beauveria bassiana, nấm Muscardine xanh : Metarhizium anisopliae có khả năng tổng hợp một lƣợng lớn các enzyme.Trong đó có ý nghĩa lớn nhất có khả năng gây bệnh cho côn trùng có chitinase, proteinase, lipase và amylase. 2.4. Hiệu quả phòng trừ sâu hại bằng chế phẩm nấm Nấm Metarhizium anisopliae và Beauveria đƣợc nghiên cứu sản xuất để trừ một số sâu hại quan trọng trong nông nghiệp. Hiệu quả của chế phẩm đã thử đối với 8 rầy nâu, sâu đo đay, châu chấu xanh, châu chấu ở điều kiện trong phòng thí nghiệm và ở nhà lƣới. Chế phẩm có tác dụng giảm tỷ lệ rầy nâu 55,2 – 58,8%, rầy lƣng trắng 64 – 92%, rầy xanh 75 – 96% và sâu đo xanh hại đay 43,9 – 64,2%. Hiệu lực diệt các loài rầy hại lúa trên đồng ruộng của nấm Beauveria bassiana biến động từ 33 – 75% tùy theo vụ và năm khác nhau. Hiệu lực của nấm kéo dài 3- 4 tuần sau khi phun nấm, vì vậy chỉ cần phun nấm một lần trong một vụ là đủ để quản lý các loài rầy hại lúa trong vụ. Dùng nấm B. bassiana để quản lý các loài rầy hại lúa đã làm tăng năng suất từ 19 – 95% so với đối chứng (tùy theo từng vụ và từng năm). Nấm B. bassiana không gây ảnh hƣởng gì cho lúa và cũng không gây hại đối với các thiên địch sâu, gầy hại lúa (Trần Văn Mão, 2004). Nấm M. anisopliae có khả năng gây bệnh làm chết 84,6% châu chấu Nomadacris succincta sau 10 ngày xử lý và nấm M. flavoviride gây chết 100% châu chấu thí nghiệm sau 7 ngày. Chế phẩm nấm diệt châu chấu đƣợc tiến hành ở Bà Rịa – Vũng Tàu, Đồng Nai cho kết quả tƣơng đối tốt nhƣng không đều. (Trần Văn Mão, 2004). 2.5. Một số nghiên cứu trong nƣớc và ngoài nƣớc về nấm Metarrhizium anisopliae và những nấm ký sinh côn trùng khác ứng dụng để phòng trừ sâu hại. 2.5.1. Nghiên cứu trong nƣớc Lần đầu tiên tại Bến Tre, Phạm Thị Thuỳ (2000) đã sử dụng nấm Metarhizium để trừ bọ dừa, kết quả ban đầu cho thấy nấm Metarhizium sau khi đã thử nghiệm trong phòng, trong nhà lƣới và ngoài đồng có hiệu quả đối với bọ dừa ở Bến Tre. Tạ Kim Chỉnh và ctv (2001), đã chọn đƣợc môi trƣờng nhân giống cho các chủng Metarhizium anisopliae là môi trƣờng Saubouraund có bổ sung vỏ trấu Bùi Xuân Đồng và Nguyễn Huy Văn (2000) đã thử nghiệm chế phẩm B.75 từ Beauveria bassiana dạng bột để phòng trừ sâu róm hại cây thông và cho biết sâu chết 80% sau một năm xử lý. Nguyễn Thị Lộc và ctv (2004) đã thử nghiệm , sản xuất và 9 ứng dụng chế phẩm nấm ký sinh để phòng trừ sâu hại lúa ở Đồng Bằng Sông Cửu Long. Ngoài ra, ở nƣớc ta cũng tiến hành nghiên cứu nấm gây bệnh trên các loài sâu hại đậu nành. Theo Tống Kim Thuần, Vũ Quang Côn (2001), các vi nấm có khả năng gây bệnh sâu hại trên đậu tƣơng chủ yếu là các loài sau: Beauveria bassiana, Metarhizium anisopliae và Normurea rileyi. Chúng gây bệnh hầu hết các loài sâu hại thuộc bộ cánh vảy – Lepidoptera, Entomophthora sp gặp ở bộ cánh nửa cứng – Hemiptera. 2.5.2. Nghiên cứu ngoài nƣớc Trên thế giới, việc sử dụng nấm trong đấu tranh chống sâu hại có lịch sử khá lâu đời, Meschnikoff (1884) là ngƣời đầu tiên trình bày vấn đề sử dụng nấm trong đấu tranh sinh học với sâu hại (Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hƣơng Giang, 1997). Theo Juntin L. Hatting, Richard A. Humber, Tadeusz J. Poprawsski và Ray M.Miller (1999), các nghiên cứu về các nấm gây bệnh rầy mềm ở Nam Phi đƣợc định hƣớng từ 1995-1998, và cho biết trong 8 loài nấm đƣợc tìm thấy đều lan truyền và giết chết rầy mềm, gồm 6 loài thuộc Entomophthorales (Pandora neoaphidis, connidiobolus thromboides, C.coronatus, Entomophthora planchoniana và neozygites fresenii) và hai loài thuộc Hyphomycetes (Beauveria basssiana, Verticillium lecanii). Theo A.M. Kammp và M. J. Bidochka (1994), tiến hành đánh giá sự sản xuất bào tử của 3 loại nấm gây bệnh côn trùng Metarrhizium anisopliae, Beauveria bassiana và Verticillium lecanii đƣợc đánh giá ở các độ sâu khác nhau (2mm, 3mm, 4mm tƣơng ứng với 10ml, 15ml, 20ml) và các loại môi trƣờng khác nhau (SDA, MEA, NA, CMA, YPDA, PDA) và cho biết sự sản xuất bào tử sau 14 ngày của nấm Metarhizium anisopliae và Beauveria bassiana tốt nhất trong môi trƣờng PDA ở độ sâu 2mm, trong khi Verticillium lecanii sản xuất bào tử tốt nhất trên môi trƣờng YPDA và độ sâu của môi trƣờng thì không đáng kể. 10 Theo Nguyễn Ngọc Tú và Nguyễn Cửu Thị Hƣơng Giang (1997), thì Codaira Y. (1961) đã tách đƣợc hai độc tố ở nấm Metarhizium anisopliae là destruxin A, liều gây chết với tầm là 0,28kg/g trọng lƣợng cơ thể và destruxin B, liều gây chết là 0,34kg/g trọng lƣợng cơ thể. 2.6. Giới thiệu gen Pr1 Những nấm gây bệnh trên côn trùng xâm nhập vào côn trùng bằng cách xâm nhập trực tiếp qua lớp cutin. Chúng sản xuất những enzyme ngoại bào ảnh hƣởng trực tiếp lên lên lớp vỏ bọc của côn trùng. Nấm Metarhizium sản xuất một protease subtilisinlike ngoại bào đƣợc gọi là Pr1. Pr1 gây thoái hoá protein của lớp cutin. Pr1 đƣợc tổng hợp nhƣ là một tiền chất lớn (40.3 kDa) chứa một peptide tín hiệu, một tiền peptide và một protein hoàn thiện . Cấu trúc sơ cấp của Pr1 có độ tƣơng đồng lớn (30- 60%) với những enzyme của phân lớp subtilisin của serine endopeptidase và serine, histidine và aspartyl. 2.7. Vai trò của protease Pr1 Những enzyme tác nhân gây bệnh hội tụ ngoài tế bào có thể làm suy thoái cấu trúc polymer của biểu bì (protein, chitin và lipid) trong suốt giai đoạn phát sinh bệnh, giúp cho quá trình thâm nhập của nấm đƣợc dễ dàng và cung cấp những dinh dƣỡng cho nấm phát triển nhanh hơn. Sản phẩm của những enzyme làm phân hủy biểu bì này thì thƣờng đƣợc phân lập bởi sự nuôi cấy trên môi trƣờng chứa biểu bì hoặc chitin (Raymond và ctv, 1995). 2.8. Tổng quan về ITS-rDNA 2.8.1. Giới thiệu về vùng rDNA và vùng ITS rDNA là nhóm gene mã hoá rRNA của ribosome và đóng vai trò quan trọng trong các nghiên cứu quan hệ phát sinh loài. rDNA đƣợc nghiên cứu vì nó là gen có nhiều bản sao và đặt biệt không mã hoá cho bất kỳ protein nào. Các bản sao của gen nằm liên tiếp trên một locus và liên quan mật thiết tới quá trình tiến hoá. Ribosome hầu nhƣ tồn tại trong mọi sinh vật và có cùng nguồn gốc. Phần lớn phân tử rDNA tƣơng 11 đối bảo tồn nên đƣợc xem là cơ sở để tìm ra sự tƣơng đồng và các khác biệt khi so sánh các sinh vật khác nhau. Các primer thiết kế dựa trên những Oligonucleotide có tính bảo tồn cao đƣợc sử dụng cho tất cả sinh vật nhằm khuếch đại các vùng tƣơng đƣơng dùng trong so sánh. Ngoài ra, nhiều primer và probe cũng đƣợc thiết kế dựa trên các vùng không bảo tồn dùng trong phát hiện và định danh vi sinh vật (Van de peer và cộng sự, 1996). rDNA chứa vùng 18S, ITS1, 5,8S (một tiểu đơn vị ribosome nhỏ hơn trở thành một phần của LSU), ITS2, 28S và vùng IGS (intergenic spacer). Vùng phiên mã 18S kết thúc tiểu đơn vị nhỏ (SSU), trong khi 28S cộng với 5,8S và một gen 5S thêm vào từ những phần khác của genome hình thành tiểu đơn vị lớn (LSU) của ribosome RNA. Những vùng ITS đƣợc phiên mã (tổng hợp từ RNA), nhƣng bị cắt trƣớc khi rRNA hoàn thiện đƣợc hình thành, tuy nhiên ITS lại có chức năng trong sự hình thành ribosome (Albert và cộng sự 1994). Ở đầu kết thúc 5’ của 18S và đầu kết thúc 3’ của 28S, cũng có một vùng đƣợc biết đến là ETS (external transcribel spacer). IGS (intergenic spacer) là vùng kém bảo tồn nhất của rDNA. Tuy nhiên vùng không gian không phiên mã của những rDNA chứa trình tự kết thúc phiên mã của những gene rRNA . Các rDNA 5,8S; 18S; 28S phiên mã thành các tiền rRNA riêng rẽ, nằm xen kẽ với các vùng phiên mã bên trong (ITS) và các vùng phiên mã bên ngoài (ETS). Giữa các nhóm gen gồm nhiều bản sao lập lại là vùng không phiên mã . Có một rDNA 5S thƣờng không có vị trí cố định và có chiều sao mã ngƣợc với các gen còn lại, rDNA 5S thƣờng chỉ có ở nhân, không có ở ty thể của một số loài nấm (Guarro, 1999). rDNA 18 S thƣờng đƣợc quan tâm nghiên cứu, rDNA 5,8 S có kích thƣớc rất nhỏ và ít có sự biến đối song rRNA 5 S là thành phần không thể thiếu của nu-LSU- rRNA, có vai trò ổn định cấu trúc ribosome và thúc đẩy quá trình tổng hợp protein (Szymanski và cộng sự, 2001). 12 Vùng ITS là vùng có rất nhiều biến đổi, mặc dù vùng ITS thƣờng đƣợc sử dụng trong nghiên cứu tiến hoá của sinh vật tuy nhiên phần lớn các so sánh trên vùng này chỉ thƣờng sử dụng ở mức độ xác định các biệt hoá trong cùng loài (Guarro, 1999). Những gene rRNA ở sinh vật có nhân điển hình (ribosome DNA hay rDNA) đƣợc tìm thấy nhƣ những phần đơn vị lặp lại đƣợc sắp xếp thành từng cặp. Mỗi đơn vị lặp lại chứa một vùng phiên mã (ETS1, ETS2, 18S, 25S và 5,8S) và một vùng không phiên mã (NTS). Trong vùng phiên mã, ITS đƣợc tìm thấy trên gen 5,8S rRNA bao gồm ITS1 và ITS2. Hình 2.2: Sơ đồ của các vùng trên rDNA 2.9. Môṭ số nghiên cƣ́u trong và ngoài nƣớc về sƣ ̣đa daṇg của nấm Metarhizium anisopliae dƣạ vào gen Pr1 và vùng rDNA-ITS 2.9.1. Nghiên cƣ́u nƣớc ngoài Savita Bagga, Gang Hu, Steven E. Screen, Raymond J. St.Leger đa ̃phân tích sƣ ̣ giống nhau về măṭ trình tƣ ̣và cấu trúc exon -intron các subtilisin của nấm M.anisopliae và đã chia thành 4 nhóm: Nhóm I gồm có Pr1C Nhóm II đƣợc chia thành hai nhóm phụ có hoạt tính extracellular 13 Nhóm phụ I: gồm có Pr1A, Pr1B, Pr1G, Pr1I, Pr1K. Nhóm phụ II gồm có Pr1D, Pr1E, Pr1F, Pr1J. Nhóm III gồm có Pr1H có hoạt tính endocellular. Cheng Wang, Milton A. Typas, Tariq M. Butt (2002) đa ̃sƣ̉ duṇg kỹ thâṭ Nested-PCR để xác đi ̣nh nhƣ̃ng đôṭ biến ở hai gen Pr1A và Pr1B bằng cách sƣ̉ duṇg nhƣ̃ng căp̣ pr imer chuyên biêṭ cho tƣ̀ng gen và kiểm tra bằng kỹ thuật Southern Blot . Kết quả: phát hiện đƣợc gen Pr1 ở dòng cha mẹ , không phát hiêṇ đƣơc̣ ở nhƣ̃ng dòng đột biến .Tuy nhiên hoaṭ tính của enzyme giƣ̃a dòng cha me ̣và dòng đôṭ biến không thay đổi. Nhƣ vâỵ dòng đôṭ biến nếu bi ̣ mất gen quan troṇg nhấ t là gen Pr1 vâñ có thể gây bêṇh trên côn trùng. Sorayac C . M.. Leal và ctv (1997) đa ̃ mô tả môṭ phƣơng pháp để xác điṇh nhƣ̃ng dòng nấm Metarhizium bằng cách sƣ̉ duṇg kỹ thuâṭ RFLP để phân cắt sản phẩm PCR của gen Pr1 và phân tích những phân đoạn b ằng kỹ thuâṭ điêṇ di . Bằng kỹ thuâṭ này 40 dòng nấm Metarhizium thu đƣơc̣ tƣ̀ 15 loại ký chủ khác nhau đã đƣợc xác định và chia làm 4 nhóm. Chikako và Susumu Shimizu (2002) đa ̃tiến hành khuếch đaị vùng rDNA tƣ̀ đầu 3’ của 18S rDNA tới đầu 5’ của 28S rDNA bằng cách sƣ̉ duṇg căp̣ mồi đăc̣ hiê ̣u là TW 81 và AB28 và giải trình tự vùng 5.8S và vùng Flanking để nghiên cứu mối quan hệ di truyền giƣ̃a nấm Metarhizium anisopliae đƣơc̣ phân lâp̣ tƣ̀ Nhâṭ Bản và Hàn Quốc với các loài có mối quan hệ. Malena P. Panton, Annoula Mavridou, Milton A.Typas (2003) so sánh sƣ ̣khác biê ̣trong trình tƣ ̣của vùng IGS và vùng rDNA -ITS để nghiên cƣ́u sƣ ̣khác biêṭ về măṭ di truyền của 40 dòng nấm Metarhizium. N.D.Pipe, D.Chandler, B. W. Bainbridge và J .B.Heale (1995) sƣ̉ duṇg kỹ thuâṭ RFLP-PCR để phân tích gen ma ̃hóa cho ribosome RNA (rDNA) tƣ̀ nhƣ̃ng dòng nấm Metarhizium khác nhau nhƣ M.anisopliae var. anisopliae, M.anisopliae var. majus, M.album và M.flavoviride có nguồn gốc từ nhiều quốc gia khác nhau. 14 Marilena Aquino de Muro, Samina Mehta, David Moore (2003) sƣ̉ duṇg kỹ thuâṭ RFLP, giải trình tự và AFLP để phân tích vùng ITS của 50 dòng nấm Beauveria bassiana. Trình tự vùng ITS đã chỉ ra sự khác biệt về trình tự của các dòng B.bassiana thấp hơn 2%. Mavridou và ctv (1998) đa ̃phân tích sƣ ̣đa hình trong loài Metarhizium anisopliae var. anisopliae bằng cách sƣ̉ duṇg phân tích RFLP đối với phƣ́c hơp̣ gen rDNA và mtDNA . Dƣạ vào viêc̣ phân tích sƣ ̣lai của DNA , 25 dòng đƣợc chia làm 20 nhóm khác biệt về di truyền . Driver và ctv (2000) đa ̃sƣ̉ duṇg kỹ thuâṭ RAPD và trình tƣ ̣của toàn bô ̣vùng ITS của rDNA để xác điṇh sƣ ̣phân loài . Nhƣ̃ng dòng nấm đƣơc̣ chia thành 10 nhánh riêng biêṭ. Curran và ctv (1994) đa ̃nghiên cƣ́u mối quan hê ̣phát sinh loài của nấm Metarhizium bằng viêc̣ sƣ̉ duṇg trình tƣ ̣rDNA. Rakotonirainy và ctv (1994) đa ̃phân tích sƣ ̣khác biêṭ về isoenzyme và trình tƣ ̣ của ribosomal RNA trong giống nấm Metarhizium. 2.9.2. Nghiên cƣ́u trong nƣớc Nhƣ̃ng nghiên cƣ́u về sƣ ̣đa daṇg di truyền trong quần thể nấm Metarhizium anisopliae dƣạ vào gen Pr1 và vùng rDNA -ITS ở Việt Nam có rất ít . Phần lớn nhƣ̃ng nghiên cƣ́u về sƣ ̣đa daṇg di truyền của quần thể nấm Metarhizium anisopliae chỉ dừng lại ở mức độ đánh giá hình thái của bào tử hoặc khuẩn lạc . 2.10. Phƣơng pháp phát hiện gen Pr1 và vùng rDNA-ITS Có nhiều phƣơng pháp khác nhau (nhƣ ELISA, allozyme electrophoresis hoặc RFLPs) có những ƣu và khuyết điểm khác nhau, chỉ phân biệt giữa mỗi loài hoặc đòi hỏi số lƣợng lớn của DNA tinh khiết (Hegedus và ctv, 1993). Sự phân lập DNA thì tốn nhiều thời gian và giới hạn số lƣợng mẫu có thể phân tích đƣợc trong thời gian thích hợp. RAPD – PCR thì cũng đƣợc sử dụng để mô tả đặc điểm những giống Metarhizium anisopliae. Tuy nhiên, RAPD – PCR rất dễ bị nhiễm tạp và thƣờng 15 không ổn định, chỉ có thể thực hiện một cách chắc chắn trên DNA từ nuôi cấy ở ký chủ. Sử dụng phƣơng pháp mà cho phép sự khám phá về những đặc điểm của những giống Metarhizium anisopliae lây nhiễm trên côn trùng. Đó là phƣơng pháp kết hợp kỹ thuật PCR và phân tích RFLP (RFLP – PCR), dựa trên sự khuếch đại của phần gen mã hóa chủ yếu là protease subtilisin Pr1 (St Leger và ctv, 1992) đƣợc tiết ra bởi nấm Metarhizium anisopliae và vùng ITS1- 5.8S – ITS2. 16 CHƢƠNG 3. VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 3.1. Thời gian và địa điểm 3.1.1. Thời gian Đề tài đƣợc tiến hành từ ngày 26 tháng 3 năm 2007 đến ngày 31 tháng 8 năm 2007. 3.1.2. Địa điểm Phòng thí nghiệm Công nghệ sinh học thực vật - Trung tâm phân tích thí nghiệm Hóa Sinh trƣờng Đaị hoc̣ Nông Lâm Thành phố Hồ Chí Minh . 3.2. Vật liệu và hoá chất 3.2.1. Vật liệu DNA đƣợc ly trích từ những dòng nấm Metarhizium anisopliae ký sinh trên côn trùng gây hại cây trồng theo quy trình của Leal, 1994 do anh Nguyễn Văn Lẫm cung cấp và đƣợc trữ ở -20oC . Các mẫu nấm Metarhizium anisopliae đƣợc thu thập và phân lập trên một số côn trùng gây hại ở một số tỉnh thành trong nƣớc. Bảng 3.1: Nguồn nấm Metarhizium anisopliae đƣợc thu thập ở một số địa phƣơng dùng trong thí nghiệm 17 3.2.2. Hoá chất Các hoá chất đƣợc sử dụng trong đề tài này đƣợc sản xuất bởi Công ty Sigma, Promega, Bio-Rad). Hoá chất cho phản ứng PCR (do công ty Promega cung cấp) - Taq DNA polymerase nồng độ 5UI/µl - Dung dịch đệm 5X: đi kèm với Taq - dNTP (25 mM) - MgCl2 (25 mM) - Primer 1 (METPR1), primer 2 (METPR4), primer 3 (METPR2), primer 4 (METPR5), primer 5 (ITS 4), primer 6 (ITS 5) Các hoá chất dùng trong điện di: Gel agarose, thƣờng sử dụng gel có nồng độ 1% agarose. Đệm TAE 0,5X dùng để pha gel agarose và làm dung dịch đệm trong chạy điện di với thành phần nhƣ sau:  Tris HCl 4,48 g  Na2EDTA 0,5M (pH8,0) 2ml  Glacial acetic acid 1,14 ml  Nƣớc cất vừa đủ 1 lít Dung dịch nhuộm gel : Ethidium bromide 1%. Ladder 3kb. 3.2.3. Các thiết bị chính Các dụng cụ và thiết bị cần thiết cho một phòng thí nghiệm sinh học phân tử: máy đo pH, máy lắc, máy ly tâm lạnh, máy khuấy từ, bộ điện di ngang HorizonR 558 (Life Technologies), máy PCR (BIO-RAD), máy vortex, máy chụp hình gel Bio –Rad, máy đọc trình tự ABI PRISM 3100, các loại pipette 0,5 μl – 10 μl và 10 μl – 100 μl, các loại đầu tip 0,5 μl – 10 μl và 10 μl – 100 μl. 3.3. Nội dung nghiên cứu 18 1. Sử dụng kỹ thuật PCR phát hiện gen liên quan tới tính độc (gen Pr1 )và vùng rDNA-ITS của nấm Metarhizium anisopliae. 2. Nghiên cứu sự đa dạng di truyền của nấm Metarhizium anisopliae dựa vào trình tự vùng rDNA-ITS và gen Pr1. 3.4. Phƣơng pháp nghiên cứu 3.4.1. Kiểm tra DNA tổng số đƣơc̣ ly trích tƣ̀ các dòng nấm Metarhizium anisopliae. DNA tổng số đƣơc̣ kiểm tra bằng kỹ thuâṭ điêṇ di trên gel agarose 1% với hiêụ điêṇ thế 100V trong 20 phút. 3.4.2. Khuếch đại gen Pr1 Hình 3.1: Sơ đồ primer đƣơc̣ sƣ̉ duṇg khuếch đaị gen Pr1 19 Tiến hành hai phản ứng PCR riêng biêṭ với 2 cặp mồi khác nhau. Đầu tiên đoạn DNA đƣợc khuếch đại với cặp primer có trình tự cụ thể nhƣ sau: - METPR1: 5’CAC TCT TCT CCC AGC CGT TC 3’ - METPR4 : 5’GTA GCT CAA CTT CCG CAC TC 3’ (Nguồn : Leger St., 1992) Thành phần hóa chất đƣợc trình bày ở bảng 3.2. Bảng 3.2: Thành phần hóa chất của phản ứng PCR khuếch đại gen Pr1 với căp̣ primer METPR1/METPR4 Hóa chất Nồng độ đầu Thể tích sử dụng Nồng độ cuối PCR buffer 5X 5 l 1X MgCl2 25 mM 2.5 l 2.5 mM dNTP 25 mM 0,2 l 0.2 M METPR1 10 pM 1 l 10 pM METPR4 10 pM 1 l 10 pM Taq DNA polymerase 5 U 0,2 l 1 U DNA mẫu 20 ng/ l 1 l 20 ng H2O 14.1 l Tổng thể tích 25 l Quy trình PCR khuếch đại gen Pr1 Các bƣớc Nhiệt độ Thời gian Tách đoạn DNA 940C 4 phút Số chu kỳ lặp lại (37 chu kỳ) -Tách đoạn DNA 940C 1 phút -Ủ bắt cặp 560C 1 phút - Kéo dài 720C 2 phút Kéo dài 720C 6 phút Ủ 40C 10 phút 20 Sau khi có đƣợc sản phẩm của phản ứng PCR lần một, chúng tôi tiến hành thực hiện phản ứng PCR lần hai với cặp primer METPR2/METPR5. Trình tự cặp primer METPR2/METPR5. - METPR2: 5’AGG TAG GCA GCC AGA CCG GC 3’ - METPR5 : 5’TGC CAC TAT TGG CCG GCG CG 3’ (Nguồn : Leger St., 1992) Bảng 3.3: Thành phần hóa chất của phản ứng PCR khuếch đại gen Pr1 với căp̣ primer METPR2/METPR5 Hóa chất Nồng độ đầu Thể tích sử dụng Nồng độ cuối PCR buffer 5X 5 l 1X MgCl2 25 mM 2.5 l 2.5 mM dNTP 25 mM 0,2 l 0.2 M METPR 2 10 pM 1 l 10 pM METPR 5 10 pM 1 l 10 pM Taq DNA polymerase 5 U 0,2 l 1 U DNA mẫu 20 ng/ l 1 l 20 ng Nƣớc 14.1 l Tổng thể tích 25 l Quy trình PCR Các bƣớc Nhiệt độ Thời gian Tách đoạn DNA 940C 4 phút Số chu kỳ lặp lại (37 chu kỳ) -Tách đoạn DNA 940C 1 phút -Ủ bắt cặp 560C 1 phút - Kéo dài 720C 2 phút Kéo dài 720C 6 phút Ủ 40C 10 phút 21 3.4.3. Khuếch đại vùng ITS Primer đƣợc sử dụng để khuếch đại vùng ITS có trình tự nhƣ sau: - ITS 4: 5’ TCCTCCGCTTATTGATATGC 3’ - ITS 5 : 5’ GGAAGTAAAAGTCGTAACAAGG 3’ Hình 3.2: Sơ đồ primer đƣơc̣ sƣ̉ duṇg khuếch đaị vùng ITS Bảng 3.4: Thành phần của phản ứng PCR khuếch đaị vùng rDNA-ITS Hóa chất Nồng độ đầu Thể tích sử dụng Nồng độ cuối PCR buffer 5X 10 l 1X MgCl2 25 mM 3 l 1.5 mM dNTP 25 mM 0.4 l 0.2 M ITS 4 10 pM 1 l 10 pM ITS 5 10 pM 1 l 10 pM Taq DNA polymerase 5 U 0,2 l 1 U DNA mẫu 20 ng/ l 1 l 20 ng H2O 33.4 l Tổng thể tích 50 l 22 Quy trình PCR Các bƣớc Nhiệt độ Thời gian Tách đoạn DNA 950C 3 phút Số chu kỳ lặp lại (37 chu kỳ) - Tách đoạn DNA 950C 1 phút - Ủ bắt cặp 580C 45 giây - Kéo dài 720C 1 phút Kéo dài 720C 5 phút Ủ 40C 10 phút 3.5. Tiến hành giải trình tự gen gây độc Pr1 và vùng ITS trên nấm Metarhizium anisopliae Sau khi chạy PCR chúng tôi tiến hành đọc trình tự sản phẩm PCR vừa khuếch đại để xác định chính xác đây là đoạn gen gây độc Pr1 và vùng ITS1 – 5.8S – ITS2 nhằm xác định trình tự nucleotide của đoạn gen độc này, từ đó so sánh với nhƣ̃ng trình tƣ ̣trên Genbank . Đầu tiên để đạt đƣợc kết quả cao nên phải tiến hành tinh sạch sản phẩm PCR để việc đọc trình tự đạt kết quả cao. 3.6. Tinh sạch sản phẩm PCR 1.Lấy GFX cho vào ống thu dịch lọc đã khử trùng sạch (số lƣợng GFX tƣơng ứng với số mẫu cần tinh sạch). Cho vào GFX 500µl capture buffer. 2.Cho 100 µl sản phẩm PCR vào GFX. 3.Trộn đều lên xuống bằng pipette khoảng 4-6 lần. 4.Ly tâm với tốc độ khoảng 12000 vòng trong 30 giây ở 40C. 5.Loại bỏ dung dịch trong ống thu dịch lọc, sau đó đặt lại GFX vào ống thu dịch lọc. 6.Thêm 500 µl wash buffer vào cột GFX. Ly tâm ở tốc độ 12000 vòng khoảng 30 giây ở 40C. 7.Loại bỏ ống thu dịch lọc và chuyển GFX sang effpendorf mới. 23 8.Thêm 50 µl elution buffer trực tiếp vào giữa cột GFX. 9.Giữ ở nhiệt độ phòng khoảng 1 phút. 10.Ly tâm 10000 vòng trong 1 phút ở 40C. Sản phẩm tinh sạch đƣợc bảo quản ở- 40C Thành phần của phản ứng đọc trình tự Buffer đƣợc sử dụng ở nồng độ 5X nhƣng nồng độ cuối cùng phải đạt là 1X. Bảng 3.5: Thành phần phản ứng đọc trình tự Thành phần Nồng độ Thể tích(µl) - BDT mix 2,5 X 4 µl - Buffer 5 X 2 µl - Primer 3.2 pmol 1 µl - DNA khuôn 10-40 ng 1 µl - Nƣớc cho đến 10 µl  Quy trình nhiệt của phản ứng PCR trong đọc trình tự. Đối với gene Pr1 1. Đặt tube vào máy PCR và chỉnh đúng các thông số. 2. Biến tính hoàn toàn: 960C trong 1 phút. 3. Lặp lại 25 chu kỳ: 960C trong 10 giây. 50 0C trong 5 giây. 60 0 C trong 4 phút. 4. Giữ ở 40C. Đối với vùng ITS 1. Đặt tube vào máy và chỉnh đúng các thông số. 2. Biến tính hoàn toàn: 950C trong 5 phút. 3 .Lặp lại 25 chu kỳ: 950C trong 30 giây. 50 0C trong 10 giây. 60 0C trong 4 phút. 4. Giữ ở 40C. 24 3.7. Tinh sạch sản phẩm đọc trình tự Sản phẩm đọc trình tự đƣợc tinh sạch bằng phƣơng pháp EDTA . - Cho 5 µl EDTA vào mỗi eppendorf. - Thêm vào 60 µl ethanol 100% mỗi eppendorf. - Trộn đều lên xuống hỗn hợp vài lần. - Đem ủ mẩu ở nhiệt độ phòng khoảng 15 phút. - Ly tâm tốc độ 12000 vòng trong 30 phút. - Loại bỏ phần dịch bên trên, thêm vào 60µl ethanol 70%. - Ly tâm 12000 vòng trong 15 phút ở 40C. - Lọai bỏ dịch, thu DNA, làm khô ở nhiệt độ phòng. - Làm tan DNA bằng cách cho vào 2 µl hidiformamide, biến tính 950C trong 3 phút. Chạy điện di và ghi nhận tính hiệu trên máy sequencer ABI PRISM 3100. 3.8. Phƣơng pháp phân tích trình tự Hình 3.3: Sơ đồ những phƣơng pháp đƣợc sử dụng trong phân tích trình tự 25 Trình tự Sắp gióng cột bằng chƣơng trình ClustalX Gói phần mềm Phylip Seqboot DNApars Consense Chọn ra cây phân loài tốt nhất Hình 3.4: Sơ đồ phân tích trình tƣ ̣có đô ̣tƣơng đồng cao 26 CHƢƠNG 4. KẾT QUẢ VÀ THẢO LUẬN 4.1. Kiểm tra DNA tổng số của các mẫu nấm Metarhizium anisopliae đƣợc sử dụng trong nghiên cứu DNA tổng số 1 2 3 4 5 6 7 8 9 10 tạp nhiễm Tạt Hình 4.1: DNA tổng số của nấm Metarhizium anisopliae Ghi chú: 1.BDTN 6.BDBD7 2.SCLLLA 7.BXDTV 3.RNBT 8.BDTV5 4.RNLA 9.BDQ96 5.BXDTG 10.RBC96 Kết quả điêṇ di cho thấy DNA tổng số của tất cả các dòng nấm dùng trong nghiên cƣ́u đ ƣợc ly trích khá tốt , không xuất hiêṇ hiêṇ tƣơṇg DNA bi ̣ gaỹ hoăc̣ bi ̣ smear. Tuy nhiên vâñ còn xuất hiêṇ tap̣ trong quá trình ly trích . Tạp nhiễm sẽ ảnh hƣởng không tốt tới kết quả của phản ƣ́ng PCR vì se ̃ƣ́c chế phản ứng. Chính vì lý do 27 đ

Các file đính kèm theo tài liệu này:

  • pdfTRAN NHAT NAM.pdf