Luận văn Nghiên cứu một số đặc điểm sinh học của đơn bào Histomonas meleagridis ký sinh trên gà

Kết luận - Nghiên cứu về hình thái học cho thấy: Đơn bào Histomonas meleagridis có kích thước từ 8 - 25 µm, hình tròn hoặc oval. - Về đặc điểm sinh học của Histomonas meleagridis: Trong môi trường nuôi cấy Dwyer, số lượng đơn bào đạt cực đại sau 24 giờ nuôi cấy, vòng đời của Histomonas meleagridis cần phát triển qua giun kim và thời gian cần thiết để hoàn thành vòng đời là 36 – 42 ngày. - Triệu chứng lâm sàng bệnh do Histomonas melagridis: Gà ủ rũ, lông xù, ỉa chảy; mào tái, thâm tím hoặc màu xanh đen; Bệnh tích đại thể của bệnh: Gan xuất huyết, hoại tử hình hoa cúc; Manh tràng trưng to, chất chứa vón thành cục dạng bã đậu. Bệnh tích vi thể của bệnh: Tại các vùng tổn thương thấy tập trung nhiều tế bào lympho, đại thực bào, hồng cầu và bạch cầu. - Chẩn đoán bệnh do Histomonas meleagridis bằng kỹ thuật PCR ở hai huyện Cam Ranh và Ninh Hòa cho thấy: Tỷ lệ nhiễm Histomonas meleagridis ở gà giao động từ 10 – 20%, tỷ lệ gà nhiễm đơn bào ở gà nuôi theo phương thức thả vườn cao hơn gà nuôi theo phương thức công nghiệp (23,08% so với 3,08%), không có sự sai khác nhau về tỷ lệ nhiễm đơn bào giữa các nhóm tuổi (10,77% so với 15,38%) và tỷ lệ nhiễm đơn bào ở mùa khô cao hơn mùa mưa (23,08% so với 3,08%).

pdf86 trang | Chia sẻ: builinh123 | Ngày: 02/08/2018 | Lượt xem: 721 | Lượt tải: 1download
Bạn đang xem trước 20 trang tài liệu Luận văn Nghiên cứu một số đặc điểm sinh học của đơn bào Histomonas meleagridis ký sinh trên gà, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
nát phân trong 50 ml dung dịch NaCl bão hoà. Sau đó lọc qua lƣới lọc để loại bỏ bã cặn, dung dịch lọc thu đƣợc để yên tĩnh trong cốc. + Sau khoảng 15 – 30 phút trứng sẽ nổi lên nếu có. Dùng vòng vớt thép đƣờng kính 5 mm vớt lớp váng ở phía trên, để lên lam kính, đậy lamen và quan sát tìm trứng giun dƣới kính hiển vi. - Bố trí thí nghiệm gây nhiễm Histomonas meleagridis trên gà: + Lô 1: Gây nhiễm 40 con gà bằng trứng giun kim Heterakis gallinarum (có chứa Histomonas meleagridis) chƣa hình thành ấu trùng với liều là 1000 trứng giun kim/gà qua đƣờng miệng. + Lô 2: 40 con gà đƣợc gây nhiễm trứng giun kim Heterakis gallinarum (có chứa Histomonas meleagridis) đã hình thành ấu trùng với liều 1000 trứng giun kim/gà bằng đƣờng miệng. + Lô 3: 20 con gà đối chứng, không gây nhiễm. - Xác định gà bị bệnh do Histomonas meleagridis qua theo dõi triệu chứng lâm sàng, bệnh tích. Sau 2 tuần gây nhiễm, lấy mẫu phân hàng ngày để xét nghiệm bằng phƣơng pháp phù nổi Fulleborn và phƣơng pháp PCR. 2.3.4. Nghiên cứu xác định triệu chứng lâm sàng và bệnh tích của bệnh do Histomonas meleagridis gây ra * Xác định triệu chứng lâm sàng - Tiến hành xác định triệu chứng lâm sàng trên gà thực địa và gà đƣợc gây nhiễm trong điều kiện thí nghiệm. Quan sát trực tiếp, ghi chép, thống kê các biểu hiện của gà khi xuất hiện những dấu hiệu bệnh lý đặc trƣng, triệu chứng lâm sàng (trạng thái, ăn uống, màu sắc mào, màu sắc phân, nhiệt độ cơ thể). 39 * Phƣơng pháp mổ khám và xác định bệnh tích Mục đích: Xác định các biến đổi bệnh tích đại thể và vi thể các cơ quan nội tạng nghi mắc bệnh do Histomonas meleagridis . Tiến hành mổ khám gia cầm theo Nguyễn Hữu Nam và cộng sự (Tài liệu tiêu chuẩn ngành – Cục thú y, 2006) nhƣ sau: Chuẩn bị mổ khám: Chuẩn bị đầy đủ các dụng cụ đã đƣợc vô trùng, hoá chất và trang thiết bị cần thiết cho quá trình mổ khám và cho ngƣời mổ khám. Tiến hành mổ khám: - Đối với gia cầm còn sống quan sát từ ngoài vào trong, kiểm tra từng cơ quan riêng biệt, ghi lại những biến đổi từ ngoài vào trong vào biên bản mổ khám. - Đối với gia cầm chết tiến hành mổ khám theo trình tự sau: + Đặt gia cầm nằm ngửa trên bàn mổ, cắt da giữa xoang vùng bụng và vùng bẹn hai bên chân, rồi lật chân sang hai bên. + Cắt da vùng giữa lỗ huyệt và xƣơng lƣỡi hái lên tận diều bộc lộ vùng cơ ngực. + Dùng kéo rọc da từ giữa lỗ huyệt và xƣơng lƣỡi hái, cắt tiếp lên phía trên hai bên sụn qua xƣơng đòn, xƣơng quạ, loại những tổ chức dính và nhấc bỏ xƣơng lƣỡi hái ra ngoài bộc lộ xoang ngực, xoang bụng. + Quan sát các túi khí và phía ngoài cơ quan nội tạng. + Lấy các cơ quan, bộ phận nội tạng (gan, manh tràng) dùng cho xét nghiệm. + Kiểm tra các cơ quan nội tạng khác nhƣ tim, gan, lách, thận , phổi.... + Dùng kéo rạch một đƣờng từ dạ dày tuyến xuống tận hậu môn kiểm tra các thƣơng tổn, xuất huyết hoại tử ở đƣờng tiêu hóa. - Đọc tiêu bản bệnh tích vi thể Từ những mẫu có biến đổi đại thể, bảo quản Formol 10% để làm tiêu bản vi thể. Làm tiêu bản vi thể theo quy định tẩm, đúc paraffin, cắt mẫu bằng máy Microtom, nhuộm Haematoxilin – Eosin (HE), gắn tiêu bản và soi tiêu bản trên kính hiển vi quang học. 2.3.5. Phƣơng pháp chẩn đoán Histomonas meleagridis bằng kỹ thuật PCR Sử dụng kỹ thuật PCR để phát hiện đơn bào Histomonas meleagridis. 40 2.3.5.1. Chiết tách DNA Tiến hành chiết tách DNA tổng số bằng bộ kit DNeasy Blood & Tissue Kit, quy trình chiết tách đƣợc tiến hành theo hƣớng dẫn của nhà sản xuất (Qiagen). Nguyên tắc: Kit sử dụng hệ thống buffer đƣợc tối ƣu để ly giải trực tiếp tế bào và dùng màng lọc có Silicagel gắn kết có chọn lọc với DNA. Đầu tiên, mẫu đƣợc ly giải trong điều kiện biến tính cao để ly giải tế bào và phân huỷ protein. Sau đó mẫu đƣợc chuyển qua cột lọc DNeasy Mini spin, qua quá trình ly tâm, DNA đƣợc gắn kết vào màng một cách chọn lọc. Các tạp chất còn lại đƣợc loại bỏ trong 2 bƣớc rửa với dung dịch đệm để rửa khác nhau. DNA đƣợc hoà tan lại bằng dung dịch đệm phù hợp (Hình 2.1). * Quy trình Hình 2.1. Quy trình tách chiết DNA tổng số Histomonas meleagridis từ mẫu nội tạng * Tiến hành tách chiết DNA tổng số từ mẫu nội tạng - Ly giải: + Cắt nhỏ 25 mg mẫu nội tạng (gan, manh tràng) của gà nghi nhiễm Histomonas meleagridis cho vào ống Eppendorf, cho thêm 180 µl buffer ATL vào huyễn dịch mẫu, thêm 20 µl proteinase K. Vortex nhẹ, sau đó ủ ở 56oC (1 – 3 giờ) trong bể điều nhiệt cách thuỷ đến khi mô đƣợc phân huỷ hoàn toàn. Gắn kết lên cột lọc Mẫu Ly giải Rửa Hoà tan DNA 41 + Vortex nhẹ trong 15 giây. Thêm 200 µl buffer AL vào mỗi mẫu, vortex nhẹ. Sau đó thêm 200 µl ethanol 96o và vortex. - Gắn kết lên cột lọc: + Chuyển toàn bộ hỗn dịch sang ống có màng lọc Dneasy (mini colum). Sau đó ly tâm 8000 vòng trong 1 phút. Bỏ dịch ly tâm bên dƣới, giữ lại phần cột có màng lọc. - Rửa: + Thêm 500 µl buffer AW1, ly tâm 8000 vòng trong 1 phút, bỏ dịch ly tâm. + Thêm 500 µl buffer AW2, ly tâm 12000 vòng trong 3 phút, bỏ dịch ly tâm. - Hoà tan: + Lấy cột đặt vào ống eppendorf 1,5 ml mới có ghi ký hiệu của mẫu. Thêm 200 µl buffer AE. Ủ ở nhiệt độ phòng trong 1 phút. Sau đó ly tâm 8000 vòng trong 1 phút. Thu dịch ly tâm trong ống eppendorf. + Dịch ly tâm chính là DNA tổng số, bảo quản ở -20oC. * Tách chiết DNA tổng số từ mẫu phân - Nhỏ 25 µl dung dịch phân lên tấm giấy FTA® Classic indicating Card, mỗi vòng tròn tấm giấy nhỏ một mẫu phân. Để khô khoảng 1 giờ đồng hồ ở nhiệt độ phòng. Ghi số mẫu lên mỗi tấm giấy. - Dùng bấm đục lỗ đƣờng kính 1,4 mm, lấy vòng trong giấy vừa đục xong cho vào tube PCR. - Rửa 3 lần bằng dung dịch rửa FTA Purification Reagent, mỗi lần rửa dùng 200 µl dung dịch FTA và để dung dịch tác động 5 phút sau mỗi lần rửa. - Rửa 2 lần bằng dung dịch TE 1x, mỗi lần rửa dùng 200 µl dung dịch FTA và để dung dịch tác động trong 5 phút sau mỗi lần rửa. Để khô trong không khí (60 phút) và tiến hành chạy PCR. 2.3.5.2. Quy trình PCR để phát hiện Histomonas meleagridis * Tiến hành phản ứng PCR - Cách pha mồi: + Cặp mồi chẩn đoán Histomonas meleagridis dựa theo thiết kế của Karine Huber và cộng sự (2005). HIS5F: 5‟ – CCTTTAGATGCTCTGGGCTG – 3‟ HIS5R: 5‟ – CAGGGACGTATTCAACGTG – 3‟ 42 Với cặp mồi này, DNA đƣợc nhân lên với độ dài khoảng 209 bp. + Trƣớc khi sử dụng phải pha loãng mồi thành dung dịch có nồng độ 10 µM bằng dung dịch TE 1x và nƣớc cất hai lần. Pha 600µl dung dịch buffer TE 20x xuống dung dịch buffer TE 1x: (Tức là: Dung dịch TE : H2O = 1 : 19). Vậy để pha 600 µl TE 1x thì hút theo tỷ lệ 30 µl TE 20x và 570 µl H2O, lắc đều thu đƣợc dung dịch buffer TE 1x. Pha 200µl mồi để sử dụng: Hút 180 µl dung dịch TE 1x vừa pha ở trên và thêm vào 20 µl dung dịch mồi đậm đặc. - Thành phần phản ứng PCR Thành phần dùng cho một mẫu khi tiến hành phản ứng PCR đƣợc cho trong bảng 2.1: Bảng 2.1. Thành phần phản ứng PCR Thứ tự Thành phần Thế tích (µl) 1 PCR Master Mix 12,5 2 Mồi xuôi 1,0 3 Mồi ngƣợc 1,0 4 Nƣớc 6,5 5 DNA mẫu 4,0 Tổng 25,0 - Chu trình nhân gen: Chu trình phản ứng đƣợc thực hiện trên máy luân nhiệt model Techne TC-512 theo chu trình sau: Bƣớc 1: 1 chu kỳ 96 o C trong 5 phút Bƣớc 2: 40 chu kỳ 95 o C trong 1 phút 56 o C trong 1 phút 72 o C trong 1 phút Bƣớc 3: 1 chu kỳ 43 72 o C trong 5 phút Giữ ở 4oC 2.3.5.3. Chạy điện di và đọc kết quả * Quy trình điện di Sản phẩm PCR đƣợc kiểm tra bằng cách chạy điện di trên bộ điện di ngang Apelex, metel MiniGel XL. - Pha 1 lít dung dịch TBE 10x xuống TBE 1x: Dùng ống đong 100 ml đong 100 ml dung dịch TBE 10x cho vào bình thuỷ tinh 1 lít, thêm 900 ml nƣớc cất vào thu đƣợc 1 lít dung dịch TBE 1x. - Chuẩn bị gel điện di agarose 1,2%: Cân 0,96 g agarose cho vào 80 ml dung dịch TBE 1x đun sôi trong lò vi sóng để hòa tan agarose, để nguội xuống khoảng 50 – 60oC cho thêm 5 µl ethidium bromide vào và lắc đều, đổ dung dịch ra khuôn đã chuẩn bị có cắm lƣợc sẵn. Để agarose đông lại ở nhiệt độ phòng trong khoảng 30 - 40 phút, khi gel đã đông cứng rút lƣợc ra. Đặt khay gel cho vào buồng điện di và đổ dung dịch đệm TBE 1x vào cho ngập mặt thạch. - Nạp mẫu DNA: Dùng micropipette hút 3 µl dung dịch Loading dye 6X lên tấm giấy parafilm đã dán sẵn trên mặt bàn và trộn đều cùng với 13 µl sản phẩm PCR mỗi mẫu. Dùng micropipette trộn đều và hút 16 µl hỗn dịch trên tra vào theo thứ tự các giếng trong thạch. Giếng đầu nạp marker vào, hai giếng tiếp theo là nạp mẫu dƣơng tính và âm tính, các giếng còn lại nạp hỗn dịch sản phẩm mẫu PCR. - Chạy điện di: Sau khi nạp mẫu xong, đậy nắp buồng điện di và nối buồng điện di với dòng điện dẫn 125 V, chạy trong khoảng 30 - 40 phút, quan sát sự dịch chuyển bằng màu bromophenol để biết lúc nào cần ngừng điện di, tiến hành tắt nguồn điện khi kết thúc quá trình điện di. * Đọc kết quả Sau khi lấy ra khỏi buồng điện di, chuyển gel lên bộ đọc điện di (Model Bioprint, Vilber Lourmat, France) có gắn hệ thống chụp ảnh điện di (Model Bioprint 1000/20) nối với máy tính. Kích thƣớc các band DNA đƣợc xác định bằng cách so sánh với thang DNA Ladder 100 bp chuẩn (Invitrogen, Mỹ). 44 - Mẫu dương tính: Xuất hiện band DNA có kích thƣớc khoảng 209 bp (cùng với mẫu đối chứng dƣơng). - Mẫu âm tính: Không có band DNA xuất hiện hoặc có band không nằm trong khoảng 209 bp. 45 Chƣơng 3. KẾT QUẢ VÀ THẢO LUẬN 3.1. Kết quả xác định một số đặc điểm hình thái cấu tạo, đặc điểm sinh học của Histomonas meleagridis 3.1.1. Đặc điểm hình thái cấu tạo của Histomonas meleagridis Hình dạng, kích thƣớc và cấu tạo của đơn bào Histomonas meleagridis đƣợc xác định thông qua việc xét nghiệm các tiêu bản bằng cách soi trực tiếp. Kết quả nghiên cứu đƣợc thể hiện ở bảng 3.1. Bảng 3.1. Đặc điểm hình thái cấu tạo của Histomonas meleagridis (n = 32) Nơi ký sinh Kích thƣớc (µm) Hình dạng và cấu tạo đơn bào Min - Max ̅ ± SE Ở mô bào (gan, manh tràng) 8 – 32 13,23 ± 4,25 Hình dạng tròn hoặc hình oval, vỏ mỏng, bên trong lớp vỏ là nhân hình tròn chứa các hạt nhiễm sắc, các cơ quan và túi chứa thức ăn (các không bào). Các không bào có kích thƣớc khác nhau, một số có chứa tế bào máu của vật chủ. Ở phân 15 – 25 20,3 ± 2,89 Dạng tròn, vỏ tế bào uốn lƣợn dạng sóng và có roi. Các không bào có kích thƣớc khác nhau, một số có chứa các tinh thể tinh bột hoặc tế bào máu của vật chủ. Môi trƣờng nuôi cấy 24 giờ 8 - 10 8,7 ± 0,63 Hình tròn hoặc oval, vỏ mỏng, nguyên sinh chất trong suốt; nhân hình chấm tròn; không bào dạng tròn hoặc oval, bên trong có chứa tinh thể glycogen Môi trƣờng nuôi cấy 48 giờ 12 – 15 13,63 ± 0,97 Môi trƣờng nuôi cấy 72 giờ 18 – 20 18,87 ± 0,85 Ghi chú: n là tổng số đơn bào Histomonas meleagridis kiểm tra. Kết quả ở bảng 3.1 cho thấy: Ở mô bào (niêm mạc manh tràng, gan), Histomonas meleagridis có dạng tròn, kích thƣớc giao động vào khoảng 8-32 µm, hình dạng tròn hoặc hình oval, vỏ mỏng; Bên trong lớp vỏ tế bào là nhân hình tròn chứa các hạt 46 nhiễm sắc, các cơ quan và các túi chứa thức ăn (các không bào). Các không bào có kích thƣớc khác nhau, một số có chứa tế bào máu của vật chủ. Ở trong phân gà, Histomonas meleagridis có dạng tròn, vỏ tế bào uốn lƣợn dạng sóng, uốn khúc và có roi. Các không bào có kích thƣớc khác nhau, một số có chứa các tinh thể tinh bột hoặc tế bào máu của vật chủ. Kích thƣớc của đơn bào ở dạng tự do trong phân gà giao động từ 15 - 25 µm, trung bình là 20,30 µm. Trong môi trƣờng nuôi cấy, sau 24 giờ Histomonas meleagridis có hình tròn, kích thƣớc giao động từ 8 - 10 µm; vỏ mỏng và nhẵn, nguyên sinh chất trong suốt, nhân hình chấm tròn, không bào dạng tròn hoặc oval. Vào thời điểm sau 48 giờ nuôi cấy, kích thƣớc của Histomonas meleagridis có thay đổi, giao động từ 12 µm - 15µm. Lúc này, Histomonas meleagridis có dạng hình tròn, vỏ mỏng, không bào có chứa các tinh thể Glycogen. Vào thời điểm 72 giờ, Histomonas meleagridis có kích thƣớc giao động 18 - 20 µm, trung bình là 18,87 µm. Histomonas meleagridis là loại đơn bào thuộc lớp Zoomastigophora, bộ Trichomonadida và họ Monocercomonadidae. Đây là loại đơn bào gây bệnh “Đầu đen“ cho nhiều loại gia cầm, trong đó có gà. Đơn bào Histomonas meleagridis gây nhiễm cho gà qua đƣờng miệng hoặc qua lỗ huyệt; sau khi xâm nhập vào cơ thể gà, chúng đi về manh tràng và nhân lên nhanh chóng ở niêm mạc bằng hình thức trực phân. Từ niêm mạc manh tràng, chúng theo máu đi về các cơ quan nội tạng, đặc biệt là gan gây ra các biểu hiện bệnh tích toàn thân và tổn thƣơng mô gan. Theo các tác giả McDougald (2002) và Lê Văn Năm (2011) thì Histomonas meleagridis là một loại đơn bào đa hình thái: Hình trùng roi (một roi), hình amip và hình lƣới hợp bào, tùy thuộc vào giai đoạn phát triển để có hình dạng tƣơng ứng phù hợp. Trong các dạng hình thái thì hình roi là phổ biến nhất và dễ nhận biết nhất bởi chúng có hai nhân (một nhân to và một nhân nhỏ), từ nhân to mọc ra một roi duy nhất, dạng này thƣờng tìm thấy trong phân gia cầm. 47 3.1.2. Đặc điểm sinh học của Histomonas meleagridis 3.1.2.1. Đặc điểm nuôi cấy Ngoài sự tồn tại và phát triển ở vật chủ, Histomonas meleagridis còn có thể nuôi cấy đƣợc ở môi trƣờng nhân tạo. Môi trƣờng đƣợc sử dụng là môi trƣờng Dwyer cải tiến theo Liu và cộng sự (2011); thành phần 1 ống môi trƣờng bao gồm: 9 ml dung dịch nuôi cấy tế bào M 199; 1,3 ml huyết thanh ngựa; 11 mg bột gạo; 2000 đơn vị Penicillin và 2000 µg Streptomycin. Chúng tôi đã tiến hành mổ khám gà tại bộ môn ký sinh trùng, phân viện thú y miền Trung để lấy mẫu nuôi cấy nhằm mục đích chẩn đoán bệnh và đồng thời xác định đặc điểm hình thái cấu tạo cũng nhƣ khả năng phát triển của Histomonas meleagridis ở môi trƣờng nhân tạo. Ngay sau khi mổ khám, lấy mỗi Hình 3.2. Histomonas meleagridis ở tiêu bản mô gan (40X) Hình 3.1. Histomonas meleagridis ở tiêu bản niêm mạc manh tràng (40X) Hình 3.3. Histomonas meleagridis ở tiêu bản phân (40X) Hình 3.4. Histomonas meleagridis ở môi trƣờng nuôi cấy (40X) 48 mẫu bệnh phẩm (gan, manh tràng) kích cỡ bằng hạt đỗ cho vào mỗi ống nghiệm có chứa môi trƣờng Dwyer, sau đó ủ môi trƣờng nuôi cấy ở nhiệt độ 400 C. Kết quả số lƣợng Histomonas meleagridis trong môi trƣờng nuôi cấy theo thời gian đƣợc thể hiện ở bảng 3.2 Bảng 3.2. Số lƣợng Histomonas meleagridis ở môi trƣờng nuôi cấy theo thời gian Thời gian nuôi cấy (giờ) Số lƣợng đơn bào/ml môi trƣờng (n = 9) Min – Max ̅ ± SE 24 6 x10 4 - 4 x10 5 (9,11 ± 2,52) x 104 48 2 x10 6 - 4 x10 7 (8,33 ± 4,18) x 106 72 3 x10 4 -7 x10 4 (4,67 ± 1,32) x 104 Ghi chú: n là số lần thí nghiệm. Hình 3.7. Histomonas meleagridis sau 2 ngày nuôi cấy (40X) Hình 3.6. Histomonas meleagridis sau 1 ngày nuôi cấy (40X) Hình 3.5. Môi trƣờng nuôi cấy Dwyer 49 Kết quả trình bày ở bảng 3.2 cho thấy, sau 24 giờ nuôi cấy (Hình 3.6), Histomonas meleagridis nhân lên nhanh chóng và đạt số lƣợng từ 6 x 104 đến 4 x 105 đơn bào/1ml môi trƣờng. Số lƣợng Histomonas meleagridis tăng lên đáng kể sau thời gian nuôi cấy 48 giờ (Hình 3.7), đạt mức 2 x 106 đến 4 x 107/ml môi trƣờng. Vào thời điểm 72 giờ sau nuôi cấy, số lƣợng Histomonas meleagridis giảm xuống còn 3 x 104 đến 7 x 104/ml. Nhƣ vậy, Histomonas meleagridis phát triển rất nhanh ở môi trƣờng nuôi cấy, sau đó số lƣợng đơn bào giảm dần theo thời gian. Điều này có thể do môi trƣờng nuôi cấy cạn kiệt dinh dƣỡng và do tạo thành nhiều độc tố. 3.1.2.2. Kết quả xác định vòng đời của Histomonas meleagridis * Quá trình phát triển của Histomonas meleagridis trong trứng giun kim ở môi trƣờng bên ngoài Để xác định quá trình phát triển của Histomonas meleagridis trong trứng giun kim ở môi trƣờng bên ngoài, chúng tôi đã thu thập trứng giun kim Heterakis gallinarum lấy từ gà bị bệnh do Histomonas meleagridis gây ra. Trứng giun kim nhiễm đơn bào Histomonas meleagridis đƣợc cho lên đĩa Petri có chứa dung dịch NaCl 0,9 %, để ở điều kiện phòng thí nghiệm và tiến tiến hành quan sát sự phát triển Histomonas meleagridis cùng với quá trình phát triển phôi bào dƣới kính hiển vi và bằng kỹ thuật PCR. 50 Hình 3.11. Trứng giun kim phân chia thành 2 phôi bào (40X) Hình 3.10. Trứng giun kim chƣa phân chia (40X) Hình 3.12. Trứng giun kim phân chia thành 4 phôi bào (40X) Hình 3.13. Trứng giun kim phân chia thành 16 phôi bào (40X) Hình 3.8 và 3.9. Gà thí nghiệm gây nhiễm Histomonas meleagridis 51 Quan sát dƣới kính hiển vi ở độ phóng đại 100 – 400 lần kết quả cho thấy: Trứng giun kim phân chia thành 2, 4, 8, 16, 32... phôi bào theo thời gian và trở thành ấu trùng gây nhiễm vào ngày thứ 12 – 14 (Hình 3.10, 3.11, 3.12, 3.13, 3.14 và 3.15). Cùng với quá trình phát triển phôi bào của trứng giun kim là sự nhân lên của Histomonas meleagridis. Nhƣ vậy, Histomonas meleagridis tồn tại và phát triển cùng với sự phát triển trong trứng giun kim ở môi trƣờng bên ngoài trong khoảng thời gian là 12 - 14 ngày cho đến khi ấu trùng gây nhiễm của giun kim hình thành. * Quá trình phát triển của Histomonas meleagridis trong cơ thể gà Để xác định quá trình phát triển của Histomonas meleagridis trong cơ thể gà, đề tài đã tiến hành gây nhiễm cho gà bằng trứng giun kim Heterakis gallinarum (trứng chƣa phát triển thành ấu trùng và trứng đã phát triển thành ấu trùng ở ngày thứ 12-14 ngày. Gà thí nghiệm đƣợc chọn là gà 1 tháng tuổi và 3 tháng tuổi, khỏe mạnh, sạch trứng giun kim Heterakis gallinarum và Histomonas meleagridis thông qua phƣơng pháp phù nổi Fulerborn và PCR. Tiến hành bố trí trên 3 lô thí nghiệm: - Lô I đƣợc gây nhiễm với trứng giun kim Heterakis gallinarum (trứng chƣa phát triển thành ấu trùng) với liều lƣợng là 1.000 trứng giun kim/gà bằng đƣờng miệng. - Lô II đƣợc gây nhiễm trứng giun kim (trứng đã phát triển thành ấu trùng ở ngày thứ 12-14 ngày) với liều lƣợng là 1.000 trứng/gà bằng đƣờng miệng. - Lô III là lô đối chứng không gây nhiễm. Kết quả gây nhiễm đƣợc thể hiện ở bảng 3. 3. Hình 3.15. Trứng giun kim bị chết (40X) Hình 3.14. Trứng giun kim có ấu trùng chứa Histomonas meleagridis (40X) 52 Bảng 3.3. Thí nghiệm xác định vòng đời của Histomonas meleagridis Lô thí nghiệm Số gà thí nghiệm Liều gây nhiễm trứng giun kim có Histomonas meleagridis/gà Đƣờng gây nhiễm Số gà nhiễm bệnh Số gà thải trứng giun kim vào ngày thứ... sau gây nhiễm 24 25 26 27 28 Lô thí nghiệm I 40 1000 Cho uống 0 0 0 0 0 0 Lô thí nghiệm II 40 1000 Cho uống 40 4 18 24 35 40 Lô đối chứng 20 Không gây nhiễm 0 0 0 0 0 0 Kết quả gây nhiễm đƣợc trình bày ở bảng 3.3 cho thấy: - Gà ở lô I (gây nhiễm với trứng giun kim chƣa phát triển thành ấu trùng) không thành công, gà không bị bệnh do Histomonas meleagridis; - Trong khi đó ở lô II (gây nhiễm với trứng giun kim đã có ấu trùng) cho kết quả là gà bị bệnh với các biểu hiện lâm sàng và bệnh tích đặc trƣng của bệnh do Histomonas meleagridis gây ra. Kết quả thí nghiệm cho thấy: Đơn bào Histomonas meleagridis có trong trứng giun kim chỉ có thể gây nhiễm đƣợc cho gà qua đƣờng miệng khi ấu trùng giun kim đã hình thành. Vào đến đƣờng tiêu hóa của gà, chúng giải phóng khỏi trứng giun kim, thâm nhập vào niêm mạc manh tràng và gây bệnh cho gà. Một số Histomonas meleagridis tiếp tục phát triển cùng với sự phát triển của giun kim từ giai đoạn ấu trùng, qua giai đoạn giun non cho đến giai đoạn trƣởng thành ở manh tràng gà và theo trứng thải ra ngoài môi trƣờng. Điều này đƣợc chứng minh qua việc xét nghiệm Histomonas meleagridis ở giun non, buồng trứng giun trƣởng thành và trứng của chúng bằng xét nghiệm tiêu bản và kỹ thuật PCR. Thời gian để Histomonas meleagridis phát triển trong cơ thể giun kim cho đến khi theo trứng thải ra ngoài là 24 - 28 ngày. Nhƣ vậy, vòng đời của Histomonas meleagridis bao gồm giai đoạn phát triển ở bên ngoài cơ thể gà (ở trứng giun kim trong môi trƣờng tự nhiên) và giai đoạn phát triển trong cơ thể gà. Ở môi trƣờng bên ngoài, Histomonas meleagridis cần thời gian phát triển trong trứng giun kim là 12 - 14 ngày trƣớc khi có thể gây nhiễm cho gà. Ở 53 Gà nuốt ấu trùng giun kim, ấu trùng phát triển thành giun kim trưởng thành manh tràng gà Trứng giun kim có Histomonas đƣợc thải ra môi trƣờng Trứng giun kim phát triển thành ấu trùng giun kim có Histomonas meleagridis trong cơ thể gà, chúng phát triển cùng với sự phát triển của giun kim cho đến khi giun trƣởng thành, đẻ trứng và thải trứng ra ngoài; thời gian này kéo dài từ 24 - 28 ngày. Tổng cộng cả hai giai đoạn phát triển, Histomonas meleagridis cần thời gian là 36 - 42 ngày để hoàn thành vòng đời của mình (Hình 3.16). Hình 3.16. Vòng đời của Histomonas meleagridis Một số nghiên cứu gần đây cho thấy, giun kim Heterakis gallinarum là vật chủ trung gian của Histomonas meleagridis, vật chủ cuối cùng của Histomonas meleagridis là gà và các loài gia cầm khác. Kết quả nghiên cứu của chúng tôi phù hợp với một số tác giả khi cho biết Histomonas meleagridis theo ấu trùng giun kim xâm nhập vào cơ thể gà. Ở cơ thể gà, Histomonas meleagridis xâm nhập vào buồng trứng giun kim và theo trứng giun kim thải ra ngoài môi trƣờng (Lund và cộng sự, 1974; Mc Dougald, 2005; Liu và cộng sự, 2011). 3.2. Kết quả xác định triệu chứng lâm sàng và bệnh tích của bệnh do Histomonas meleagridis 3.2.1. Kết quả xác định triệu chứng lâm sàng Để xác định triệu chứng lâm sàng và bệnh tích của bệnh do Histomonas meleagridis gây ra, chúng tôi đã theo dõi gà trong quá trình lấy mẫu ở địa phƣơng và gà gây nhiễm ở điều kiện thí nghiệm. Kết quả triệu chứng lâm sàng ở gà nhiễm Histomonas meagridis đƣợc thể hiện ở bảng 3.4. 54 Bảng 3.4. Triệu chứng lâm sàng ở gà nhiễm Histomonas meleagridis Ghi chú: n là tổng số mẫu nghiên cứu Kết quả khảo sát triệu chứng lâm sàng đƣợc trình bày ở bảng 3.4 cho thấy thấy gà bị bệnh do Histomonas meleagridis có các dấu hiệu chủ yếu sau: - Gà có biểu hiện kém vận động, ủ rũ (chiếm tỷ lệ 85,00 %) (Hình 3.17 và 3.18); - Ỉa chảy, phân màu vàng trắng, vàng nâu lẫn dịch nhầy, có trƣờng hợp lẫn máu, phân dính bết ở hậu môn (chiếm tỷ lệ 77,50%); - Gà giảm ăn hoặc bỏ ăn hoàn toàn, uống nƣớc nhiều (75,00%); - Gà bệnh có thể trạng gầy, da chân, mỏ khô, lông xù kém bóng mƣợt (75,00%); - Mào gà tái, thâm tím hoặc màu xanh đen (32,50%) và bại liệt chân hoặc cánh (30,00%) (Hình 3.19 và 3.20). T T Triệu chứng lâm sàng Số gà bị bệnh (n=40) Số gà có triệu chứng Tỷ lệ % 1 Gà kém vận động, ủ rũ 34 85,00 2 Ỉa chảy, phân màu vàng trắng, vàng nâu lẫn dịch nhầy, có trƣờng hợp lẫn máu 31 77,50 3 Giảm ăn 30 75,00 4 Gầy, xù lông 30 75,00 5 Mào tái, thâm tím hoặc màu xanh đen 13 32,50 6 Bại liệt chân hoặc cánh 12 30,00 55 Hình 3.17 và 3.18. Gà kém vận động ủ rũ, xù lông và xệ cánh Hình 3.19 và 3.20. Gà chết mào tái, thâm tím Nhƣ vậy, kết quả theo dõi các biểu hiện lâm sàng nhƣ mô tả ở trên giống với mô tả của một số tác giả trong và ngoài nƣớc (Mc Dougald 2005; Lê Văn Năm, 2011). 3.2.2. Kết quả xác định bệnh tích 3.2.2.1. Kết quả xác định bệnh tích đại thể Bên cạnh các dấu hiệu lâm sàng, kết quả mổ khám cũng ghi nhận một số biểu hiện bệnh tích đại thể ở gà bị bệnh do Histomonas meleagridis. Kết quả mổ khám đƣợc thể hiện ở bảng 3.5. 56 Bảng 3.5. Bệnh tích đại thể ở các cơ quan gà bị bệnh Histomonas meleagridis Bệnh tích ở các cơ quan Số gà bị bệnh bị bệnh (n=40) Số gà có bệnh tích Tỷ lệ (%) Gan sƣng to, xung huyết, mềm nhũn, hoại tử 32 80,00 Manh tràng sƣng to, thành niêm mạc dày, chất chứa không tiêu 35 87,50 Ruột non xung huyết 14 35,00 Lách sƣng, xuất huyết 6 16,67 Thận sƣng 5 12,50 Phổi tụ máu 8 20,00 Bao tim tích nƣớc 12 13,30 Ghi chú: n là tổng số mẫu nghiên cứu Qua số liệu bảng 3.5 cho thấy, các dấu hiệu bệnh tích tập trung chủ yếu ở manh tràng và gan. Một số cơ quan nội tạng khác nhƣ ruột non, lách, phổi, tim cũng có những biến đổi bệnh lý nhƣng với tần suất ít hơn. * Bệnh tích ở gan: - Gan sƣng to, xung huyết và mềm nhũn (Hình 3.21). - Xuất hiện các mảng xuất huyết, các nốt màu đỏ thẫm nhƣ đá hoa cƣơng hoặc các u cục nổi lên bề mặt gan. - Xuất hiện các ổ hoại tử từng mảng màu trắng hoặc màu xám ở bề mặt gan. Các mảng hoại tử thƣờng lõm ở giữa, đa số mảng hoại tử có hình tròn, hình hoa cúc, rìa mép có hình răng cƣa, bên trong có chứa chất nhầy đặc (Hình 3.22). 57 * Bệnh tích ở manh tràng: - Manh tràng phồng to, tích hơi hoặc chứa thức ăn không tiêu, phần cuối của manh tràng cong lên. Nhìn bên ngoài có thể thấy các mảng màu vàng xám hoặc trắng xám của chất chứa bên trong manh tràng. - Thành manh tràng bị dày lên, xuất hiện các điểm viêm xuất huyết và các ổ loét. - Chất chứa trong manh tràng có dạng sệt hoặc vón thành cục dạng bã đậu. Màu sắc của chất chứa biến đổi theo giai đoạn phát triển của bệnh: Màu vàng xám hoặc màu trắng xám (Hình 3.23 và 3.24) Hình 3.23 và 3.24. Manh tràng sƣng to, chất chứa đóng kén dạng bã đậu Nhƣ vậy, kết quả quan sát của chúng tôi phù hợp với một số kết quả nghiên cứu trong và ngoài nƣớc. Theo McDougald (2005) khi nghiên cứu trên gà tây bị bệnh do Histomonas meleagridis thì manh tràng bị tổn thƣơng nghiêm trọng, đặc biệt thành Hình 3.21. Gan sƣng to và mềm nhũn Hình 3.22. Gan xuất hiện các u cục và các mảng hoại tử ở bề mặt 58 manh tràng dày lên, chất chứa manh tràng dạng bã đậu. Tuy nhiên, kết quả theo dõi của chúng tôi có một số bộ phận cao hơn hoặc thấp hơn so với kết quả nghiên cứu của một số tác giả nhƣ: + Mc Dougald (2005) khi nghiên cứu trên gà có 67,00% nhiễm bệnh có biểu hiện ở manh tràng và 17,00% có biểu hiện ở gan với những dấu hiệu chính của gà bị nhiễm đơn bào Histomonas meleagridis. + Nguyễn Hữu Nam và cộng sự (2013) khi nghiên cứu trên gà thả vƣờn có 86,50% gà nhiễm bệnh có biểu hiện ở gan và 96,20% có biểu hiện ở manh tràng: Manh tràng gà bị loét xuất huyết, thành manh tràng dày, chất chứa bên trong màng cứng, bã đậu; ở gan khi gà bị bệnh có những biến đổi nhƣ gan sƣng to hơn bình thƣờng, mềm nhũn, vết loét trên mặt gan hình hoa cúc, rìa mép hình răng cƣa. * Bệnh tích ở các cơ quan khác: Ngoài gan và manh tràng ra, khi mổ khám chúng tôi còn nhận thấy bệnh tích ở một số cơ quan khác nhƣ: Ruột non xung huyết với tỷ lệ 35,00%; Lách sƣng to, xuất huyết chiếm tỷ lệ 16,67%; Thận sƣng, phổi tụ máu, bao tim tích nƣớc cũng ghi nhận trong một số ca bệnh với tỷ lệ tƣơng ứng lần lƣợt là 12,50%; 20,00% và 13,30%. 3.2.2.2. Kết quả xác định bệnh tích vi thể Bên cạnh việc quan sát bệnh tích đại thể, chúng tôi cũng tiến hành quan sát bệnh tích vi thể ở gan và manh tràng. Nghiên cứu bệnh tích vi thể là một trong những nội dung quan trọng giúp cho việc đánh giá các tổn thƣơng bệnh lý ở cấp độ mô bào. Tuy nhiên bệnh trên gà nhiễm Histomonas meleagridis biến đổi tập trung chủ yếu ở gan và manh tràng, do vậy chúng tôi chỉ tập trung làm rõ những biến đổi vi thể của gan và manh tràng. Kết quả bệnh tích vi thể cho thấy: - Xuất hiện nhiều ổ viêm, hoại tử ở gan và manh tràng; tại các vùng tổn thƣơng thấy nhiều tế bào Lympho và đại thực bào xâm nhập, chúng tạo thành các u hạt trong các mô manh tràng và gan. - Hồng cầu và bạch cầu tập trung nhiều ở vùng tổn thƣơng do mạch máu bị tắc nghen hoặc bị vỡ. - Xuất hiện nhiều Histomonas meleagridis ở dạng hình trứng xen lẫn tế bào viêm ở mô bào vùng bị tổn thƣơng (Hình 3.25, 3.26, 3.27 và 3.28). 59 Hình 3.25 và 3.26. Bệnh tích vi thể gan hoại tử có nhiều tế bào viêm và Histomonas meleagridis (100X) Hình 3.27 và 3.28. Bệnh tích vi thể manh tràng gà bị hoại tử với vô số noãn nang (100X) 3.2.3. Chẩn đoán phân biệt bệnh do Histomonas meleagridis với một số bệnh truyền nhiễm (Newcastle và Salmonella) Trong nghiên cứu, chúng tôi thấy triệu chứng lâm sàng, bệnh tích bệnh do Histomonas meleagridis có một số đặc điểm giống với bệnh Newcastle và Salmonella ở gà. Vì vậy để chẩn đoán phân biệt đƣợc những bệnh này, chúng tôi nghiên cứu và đƣa ra một số yếu tố khác nhau chính ở bảng 3.6. 60 Bảng 3.6. Đặc điểm khác biệt giữa bệnh do Histomonas meleagridis với bệnh Newcastle và Salmonella ở gà Đặc điểm so sánh Histomonosis Bệnh Newcastle Salmonellosis Căn nguyên Đơn bào Virus Vi khuẩn Phần đầu Mào thâm tím, da mép và da cùng đầu xanh xám thậm chí xanh đen Ít biến đổi Ít biến đổi Trạng thái phân Tiêu chảy, phân màu hồng lẫn máu Tiêu chảy, phân xanh, xanh trắng và có mùi tanh Tiêu chảy lúc đầu loãng thối vàng, xanh lục (gà lớn), sau tiêu chảy trắng bạch Gan Sƣng to, mềm nhũn và rất nhiều ổ viêm hoại tử trên bề mặt gan làm cho gan có hình hoa cúc Ít biến đổi Sƣng to có nhiều điểm hoại tử trắng lấm tấm Manh tràng Viêm sƣng to, thành manh tràng dày, trong ruột chứa chất cứng dạng bã đậu Ít biến đổi Viêm sƣng nhẹ 3.3. Kết quả chẩn đoán Histomonas meleagridis bằng kỹ thuật PCR 3.3.1. Tỷ lệ nhiễm Histomonas meleagridis ở gà tại huyện Cam Ranh và Ninh Hòa Để chẩn đoán bằng phƣơng pháp PCR, chúng tôi đã tiến hành thu thập mẫu gan, manh tràng và phân của 130 mẫu bệnh phẩm gà nuôi tại các cơ sở chăn nuôi của huyện Cam Ranh và huyện Ninh Hòa (Khánh Hòa). Mẫu bệnh phẩm đƣợc thu thập theo các chỉ tiêu về dịch tễ nhƣ: Địa phƣơng, tuổi, mùa vụ tại các địa phƣơng và bảo quản ở - 20ºC. Các mẫu bệnh phẩm đƣợc tiến hành phân loại, xử lý, chiết tách DNA và thực hiện phản ứng PCR với cặp mồi HIS5F và HIS5R của Huber và cộng sự (2005). Kết quả tỷ lệ nhiễm Histomonas meleagridis ở gà theo địa phƣơng bằng phƣơng pháp PCR đƣợc thể hiện ở bảng 3.7. 61 Bảng 3.7. Tỷ lệ nhiễm Histomonas meleagridis ở gà tại huyện Cam Ranh và Ninh Hòa TT Địa điểm Tỷ lệ gà nhiễm Histomonas meleagridis n + % 1 Cam Ranh 70 8 11,43 2 Ninh Hòa 60 9 15,00 Cộng 130 17 13,08 Ghi chú: n là tổng số mẫu nghiên cứu Kết quả ở bảng 3.7 cho thấy trong tổng số 130 mẫu gà nuôi tại 2 điểm là huyện Cam Ranh và huyện Ninh Hòa tỉnh Khánh Hòa đƣợc lấy mẫu xét nghiệm có 17 con nhiễm đơn bào Histomonas meleagridis, chiếm tỷ lệ là 13,08%. Trong đó, tỷ lệ nhiễm ở gà nuôi tại huyện Cam Ranh là 11,43% và huyện Ninh Hòa là 15,00%. Sự khác biệt về tỷ lệ nhiễm giữa các huyện đã đề cập ở trên là không lớn và không có ý nghĩa về mặt thống kê (p > 0,05). Nhƣ vậy, tỷ lệ gà nhiễm đơn bào Histomonas meleagridis ở huyện Cam Ranh và Ninh Hòa nằm trong khoảng giao động là 10 - 20%. Kết quả của chúng tôi phù hợp với nghiên cứu của các tác giả Mc Dougald (1998) khi cho biết tỷ lệ gà bị bệnh ở Mỹ giao động 10 – 20%. 62 Hình 3.29. Ảnh đại diện kết quả điện di sản phẩm PCR Ghi chú: M: Marker Giếng số 11: Đối chứng âm Giếng 3, 5 và 7: Dƣơng tính với Histomonas meleagridis có band kích thƣớc khoảng 209 bp. Giếng số 1, 2 4, 6, 8, 9 và 10: Âm tính Hình ảnh kết quả chạy PCR với cặp mồi HIS5F và HIS5R cho thấy mẫu bệnh phẩm thu thập cho kết quả dƣơng tính với đơn bào Histomonas meleagridis. Đây là cặp mồi đặc hiệu khuếch đại một đoạn của gen 18S rRNA của Histomonas meleagridis và cho sản phẩm PCR có kích thƣớc khoảng 209 bp (Hình 3.29). 3.3.2. Tỷ lệ nhiễm Histomonas meleagridis ở gà theo phƣơng thức chăn nuôi Ở Khánh Hòa chăn nuôi gà chủ yếu là theo hộ gia đình nhƣng quy mô cũng khá lớn từ vài trăm con đến vài ngàn con trên một trại. Ngoài việc chăn nuôi gà theo phƣơng thức chăn nuôi truyền thống (nuôi theo phƣơng thức thả vƣờn) thì phƣơng thức chăn nuôi công nghiệp cũng đang trên đà phát triển. Vấn đề đặt ra ở đây là liệu yếu tố dịch tễ (phƣơng thức chăn nuôi) có ảnh hƣởng gì đến tình hình nhiễm đơn bào Histomonas meleagridis hay không? Để trả lời câu hỏi này, đề tài đã tiến hành lấy mẫu điều tra tình hình nhiễm đơn bào Histomonas meleagridis ở gà nuôi theo 2 phƣơng thức trên tại tỉnh Khánh Hòa. Kết quả đƣợc thể hiện ở bảng 3.8 209 bp 100 bp 300 bp 600 bp 1 2 3 4 5 6 7 8 9 10 11 M 63 Bảng 3.8. Tỷ lệ nhiễm Histomonas meleagridis theo phƣơng thức chăn nuôi TT Địa điểm Gà nuôi thả vƣờn Gà nuôi công nghiệp Giá trị p n + % n + % 1 Cam Ranh 35 7 20,00 35 1 2,86 0,04 2 Ninh Hòa 30 8 26,67 30 1 3,33 0,03 Cộng 65 15 23,08 65 2 3,08 0,03 Theo kết quả trình bày ở bảng 3.8, gà thả vƣờn ở Cam Ranh nhiễm đơn bào Histomonas meleagridis là 20,00% và gà nuôi công nghiệp là 2,86%. Tƣơng tự, tỷ lệ nhiễm tƣơng ứng ở gà thả vƣờn so với gà nuôi công nghiệp ở Ninh Hòa là 26,67% và 3,33%. Tính chung cho cả 2 huyện điều tra thì gà thả vƣờn nhiễm đơn bào Histomonas meleagridis cao hơn rất nhiều so với gà nuôi công nghiệp theo tỷ lệ tƣơng ứng là 23,08% và 3,08%. Sự khác biệt về tỷ lệ nhiễm đơn bào ở gà thả vƣờn và gà nuôi công nghiệp của hai huyện Cam Ranh và Ninh Hòa có ý nghĩa về mặt thống kê (p < 0,05). Kết quả này có thể lý giải là do đơn bào Histomonas meleagridis phát triển cùng với trứng giun kim Heterakis gallinarum sau 12 – 14 ngày mới gây nhiễm cho gà. Đối với gà nuôi theo phƣơng thức công nghiệp, chuồng đƣợc dọn dẹp sạch sẽ hàng ngày làm hạn chế sự phát triển của trứng giun kim. Nhƣ vậy, gà nuôi theo phƣơng thức thả vƣờn có cơ hội tiếp xúc với mầm bệnh cao hơn nhiều so với gà nuôi công nghiệp nên gà nuôi thả vƣờn có tỷ lệ nhiễm đơn bào Histomonas meleagridis cao hơn nhiều so với gà nuôi công nghiệp. Kết quả của chúng tôi phù hợp với nghiên cứu của một số tác giả khi cho biết gà thả vƣờn có tỷ lệ nhiễm Histomonas meleagridis cao hơn so với gà nuôi công nghiệp (Esquenet và cộng sự, 2003; Grafl và cộng sự, 2011). 3.3.3. Tỷ lệ nhiễm Histomonas meleagridis theo nhóm tuổi của gà Trong chăn nuôi gia cầm nói chung và chăn nuôi gà nói riêng, một số bệnh thƣờng xảy ra ở lứa tuổi này mà ít gặp ở lứa tuổi khác. Chính vì vậy, để có thêm thông tin cho ngƣời dân biết cách phòng chống bệnh, chúng tôi đã lấy mẫu bệnh phẩm ở các độ tuổi khác nhau. Kết quả đƣợc trình bày ở bảng 3.9. 64 Bảng 3.9. Tình hình nhiễm Histomonas meleagridis theo nhóm tuổi của gà TT Tuổi Địa điểm < 3 tháng 3 tháng n + % n + % 1 Cam Ranh 35 3 8,57 35 5 14,29 2 Ninh Hòa 30 4 13,33 30 5 16,67 Cộng 65 7 10,77 65 10 15,38 Kết quả bảng 3.9 cho thấy, ở Cam Ranh tỷ lệ nhiễm Histomonas meleagridis trên gà ở nhóm < 3 tháng tuổi chiếm 8,57% và ở nhóm 3 tháng tuổi chiếm 14,29%. Tƣơng tự, ở Ninh Hòa tỷ lệ nhiễm Histomonas meleagridis ở nhóm < 3 tháng tuổi chiếm 13,33% và ở nhóm 3 tháng tuổi chiếm 16,67%. Tính chung cho cả hai huyện thì tỷ lệ nhiễm Histomonas meleagridis ở nhóm tuổi < 3 tháng và 3 tháng lần lƣợt là 10,77% và 15,3%. Nhƣ vậy, kết quả điều tra của chúng tôi cho thấy gà ở các nhóm tuổi khác nhau ở cả 2 điểm của tỉnh Khánh Hòa đều nhiễm đơn bào Histomonas meleagridis và sự sai khác về tỷ lệ nhiễm giữa các nhóm tuổi không có ý nghĩa thống kê (p > 0,05). 3.5.4. Tỷ lệ nhiễm Histomonas meleagiridis theo mùa vụ Khánh Hòa là tỉnh ở vùng Duyên hải cực Nam Trung bộ; nằm trong vùng khí hậu nhiệt đới gió mùa, nóng ẩm và chịu ảnh hƣởng của khí hậu đại dƣơng. Thời tiết ở đây đƣợc chia thành 2 mùa rõ rệt: Mùa mƣa ngắn, từ tháng 9 đến tháng 12 và mùa khô từ tháng 1 đến tháng 8 dƣơng lịch. Mùa vụ là một trong các yếu tố quan trọng đối với bệnh nói chung, trong đó có bệnh do đơn bào Histomonas meleagridis gây ra. Trên cơ sở nắm bắt đƣợc quy luật phát sinh bệnh trong năm mà từ đó đề ra kế hoạch và các biện pháp phòng chống bệnh thích hợp. Chính vì vậy chúng tôi đã tiến hành đánh giá tình hình nhiễm Histomonas meleagridis ở mùa khô và mùa mƣa của tỉnh Khánh Hòa. Kết quả điều tra tình hình nhiễm đơn bào Histomonas meleagridis theo mùa đƣợc trình bày ở bảng 3.10. 65 Bảng 3.10. Kết quả chẩn đoán Histomonas meleagridis theo mùa vụ TT Mùa Địa điểm Mùa khô Mùa mƣa Giá trị p n + % n + % 1 Cam Ranh 35 7 20,00 35 1 2,86 0,04 2 Ninh Hòa 30 8 26,67 30 1 3,33 0,03 Cộng 65 15 23,08 65 2 3,08 0,03 Kết quả bảng 3.10 cho thấy, trong 35 con gà đƣợc điều tra ở huyện Cam Ranh vào mùa khô có 7 con nhiễm Histomonas meleagridis, chiếm tỷ lệ 20,00%; vào mùa mƣa, tỷ lệ gà nhiễm Histomonas meleagridis là 2,86%. Tƣơng tự, ở huyện Ninh Hòa tỷ lệ gà nhiễm Histomonas meleagridis vào mùa khô và mùa mƣa lần lƣợt chiếm tỷ lệ là 23,08% và 3,08%. Trong tổng số 65 con gà đƣợc điều tra ở cả hai huyện Cam Ranh và Ninh Hòa vào mùa khô có 15 con bị nhiễm Histomonas meleagridis, chiếm tỷ lệ 23,08%. Vào mùa mƣa, trong số 65 con gà đƣợc điều tra chỉ có 2 con bị nhiễm Histomonas meleagridis, chiếm tỷ lệ 3,08%. Nhƣ vậy, tỷ lệ nhiễm Histomonas meleagridis ở gà vào mùa khô cao hơn so với mùa mƣa và sự sai khác này có ý nghĩa về mặt thống kê (p < 0,05). Sở dĩ tỷ lệ nhiễm Histomonas meleagridis ở gà vào mùa khô cao hơn so với mùa mƣa là vì vào mùa khô gà thƣờng nhiễm giun kim cao hơn so với mùa mƣa cả về tỷ lệ nhiễm và cƣờng độ nhiễm, chúng thải một số lƣợng lớn trứng ra bên ngoài. Hơn nữa, điều kiện khí hậu mùa khô ấm áp rất thuận lợi để trứng giun kim phát triển từ đó truyền mầm bệnh Histomonas meleagridis cho gà (Phan Thế Việt, 1977). Ngƣợc lại, vào mùa mƣa đất đai ẩm ƣớt, nhiệt độ thấp ảnh hƣởng đến sự tồn tại và phát triển trứng giun kim, do đó khả năng gây nhiễm cho gà thấp hơn mùa khô. Kết quả của chúng tôi phù hợp với kết quả nghiên cứu của một số tác giả Everette Lund (1974), Hauck và cộng sự (2010) khi cho biết bệnh thƣờng xảy ra vào khoảng thời gian từ cuối mùa xuân đến đầu mùa thu, lúc mà thời tiết thƣờng nóng ẩm. 66 Chƣơng 4. KẾT LUẬN VÀ KHUYẾN NGHỊ Kết luận - Nghiên cứu về hình thái học cho thấy: Đơn bào Histomonas meleagridis có kích thƣớc từ 8 - 25 µm, hình tròn hoặc oval. - Về đặc điểm sinh học của Histomonas meleagridis: Trong môi trƣờng nuôi cấy Dwyer, số lƣợng đơn bào đạt cực đại sau 24 giờ nuôi cấy, vòng đời của Histomonas meleagridis cần phát triển qua giun kim và thời gian cần thiết để hoàn thành vòng đời là 36 – 42 ngày. - Triệu chứng lâm sàng bệnh do Histomonas melagridis: Gà ủ rũ, lông xù, ỉa chảy; mào tái, thâm tím hoặc màu xanh đen; Bệnh tích đại thể của bệnh: Gan xuất huyết, hoại tử hình hoa cúc; Manh tràng trƣng to, chất chứa vón thành cục dạng bã đậu. Bệnh tích vi thể của bệnh: Tại các vùng tổn thƣơng thấy tập trung nhiều tế bào lympho, đại thực bào, hồng cầu và bạch cầu. - Chẩn đoán bệnh do Histomonas meleagridis bằng kỹ thuật PCR ở hai huyện Cam Ranh và Ninh Hòa cho thấy: Tỷ lệ nhiễm Histomonas meleagridis ở gà giao động từ 10 – 20%, tỷ lệ gà nhiễm đơn bào ở gà nuôi theo phƣơng thức thả vƣờn cao hơn gà nuôi theo phƣơng thức công nghiệp (23,08% so với 3,08%), không có sự sai khác nhau về tỷ lệ nhiễm đơn bào giữa các nhóm tuổi (10,77% so với 15,38%) và tỷ lệ nhiễm đơn bào ở mùa khô cao hơn mùa mƣa (23,08% so với 3,08%). Khuyến nghị - Phải tăng cƣờng thƣờng xuyên công tác quản lý, giám sát chặt chẽ việc chăn thả gà cũng nhƣ gia cầm của các hộ chăn nuôi, khử trùng tiêu độc định kỳ, tuyên truyền cho ngƣời chăn nuôi thấy sự nguy hiểm của bệnh do đơn bào Histomonas meleagridis. - Củng cố nâng cao trình độ chuyên môn của các thú y các cấp, đặc biệt mạng lƣới thú y cơ sở trong việc chẩn đoán đoán lâm sàng, lấy mẫu, vận chuyển mẫu đúng quy định về phòng thí nghiệm. 67 DANH MỤC TÀI LIỆU THAM KHẢO Tài liệu Tiếng Việt 1. Nguyễn Xuân Bình, Trần Xuân Hạnh, Tô Thị Phấn, 2002, 109 Bệnh gia cầm và cách phòng trị, Nhà xuất bản Nông nghiệp Hà Nội, p. 219-223. 2. Lê Thị Thúy Dung, 2013, Các kỹ thuật PCR và ứng dụng. Luận văn kỹ sƣ công nghệ sinh học, Đại học Nông lâm thành phố Hồ Chí Minh. 3. Hồ Quỳnh Thùy Dƣơng, 2003, Sinh học phân tử, Nhà xuất bản giáo dục Hà Nội, p. 196-204. 4. Lại Hà Tố Hoa, 2006, Định danh nấm Trichoderma dựa vào trình tự cùng ITS- rDNA và vùng TEF, Luận văn kỹ sƣ công nghệ sinh học, Đại học nông lâm thành phố Hồ Chí Minh. 5. Phạm Văn Khuê, Phan Lục, 1996, Ký sinh trùng thú y, Nhà xuất bản nông nghiệp Hà Nội, p. 138-139. 6. Phạm Sỹ Lăng, 2011, Bệnh Đầu đen ở gia cầm. 7. Nguyễn Hoàng Lộc, Lê Việt Dũng, Trần Quốc Dung, 2010, Giáo trình Công nghệ DNA tái tổ hợp, Nhà xuất bản Đại học Quốc gia thành phố Hồ Chí Minh, p. 64-71. 8. Nguyễn Hữu Nam, Lê Văn Năm, Nguyễn Vũ Sơn, 2013, Một số đặc điểm bệnh lý chủ yếu của bệnh do Histomonas meleagridis gây ra ở gà thả vƣờn, Tạp chí khoa học kỹ thuật thú y, 20(3), p. 43-47. 9. Lê Văn Năm, 2011, Bệnh đầu đen ở gà và gà tây, Tạp chí khoa học Công nghệ Chăn nuôi 2011, 9(4), p. 88-90. 10. Trịnh Văn Thịnh, 1963, Ký sinh trùng thú y, Nhà xuất bản Nông thôn, p. 173-175. 11. Triệu Nguyên Trung, Huỳnh Hồng Quang, 2010, Một số ứng dụng kỹ thuật sinh học phân tử trong bệnh lý vi sinh vật và ký sinh trùng. < D=3669>. 12. Phan Thế Việt, Nguyễn Thị Kỳ, Nguyễn Thị Lê, 1977, Giun sán ký sinh ở động vật Việt Nam. Nhà xuất bản Khoa học và Kỹ thuật Nông nghiệp. p. 121-122. 68 13. Hoàng Thị Tĩnh, 2009, Tình trạng nhiễm giun, sán đƣờng tiêu hóa của gà, một số đặc điểm sinh học, bệnh lý học của giun Ascaridia galli và biện pháp phòng trừ, Luận văn thạc sĩ nông nghiệp, Đại học nông nghiệp Hà Nội. 14. Trần Quốc Thuyết, 2011, Tình hình nhiễm giun tròn đƣờng tiêu hóa của gà thuộc ngoại thành Hà Nội, đặc điểm phát triển của giun kim (Heterakis gallinarum) và hiệu lực của thuốc tây, Luận văn thạc sĩ nông nghiệp, Đại học nông nghiệp Hà Nội. Tài liệu Tiếng Anh 15. Adl, SM, Simpson, AG, Farmer, MA, Andersen, RA, Anderson, OR, Barta, JR, Bowser, SS, Brugerolle, G, Fensome, RA & Fredericq, S, 2005, The new higher level classification of eukaryotes with emphasis on the taxonomy of protists, Journal of Eukaryotic Microbiology, 52, p. 399–451. 16. Aka, J, Hauck, R, Blankenstein, P, Balczulat, S & Hafez, HM, Reoccurrence of Histomonas in turkey beeder farm, Berl Munch Tierarztl Wochenschr, 2011, 124, p. 2-7. 17. Alkhalaf, AN & Mahmoud, OM, An Outbreak of Concurrent Histomonas meleagridis and Enteroccocus fecalis infection in Ducks, Asian Journal of Poultry Science, 2009, 3, p. 15-18. 18. Bart, A, van der Heijden, HM, Greve, S, Speijer, D, Landman, WJ & van Gool, T, Intragenomic variation in the internal transcribed spacer 1 region of Dientamoeba fragilis as a molecular epidemiological marker, J Clin Microbiol, 2008, 46, p. 3270- 3275. 19. Bleyen, N, Ons, E, De Gussem, M & Goddeeris, BM, Passive immunization against Histomonas meleagridis does not protect turkeys from an experimental infection. Avian Pathol, 2009, 38, p. 71-76. 20. Bowen, TE, Sullivan, TW & Grace, OD, Effect of cupric sulfate on prophylactic efficacy of 3 arsenic acid compounds against histomoniasis in young turkeys, Poultry Sci, 1971, 50, p. 861-866. 21. Brown, DM, Upcroft, JA, Edwards, MR & Upcroft, P, Anaerobic bacterial metabolism in the ancient eukaryote Giardia duodenalis, Int J Parasitol 1998, 28, p. 149-164. 22. Cepicka, I, Hampl, V & Kulda, J, Critical taxonomic revision of parabasalids with description of one new genus and three new species, Protist, 2010, 161, p. 400-433. 69 23. Clarkson, MJ, Immunological responses to Histomonas meleagridis in the turkeys and fowl, Immunity, 1963, 6, p. 156-168. 24. Desowitz, RS, Age as a factor influencing fatal infections of histomoniasis in chickens, J Com Path and Therap, 1951, 61, p. 231-236. 25. Dwyer, DM, An improved method for cultivating Histomonas meleagridis, J Parasitol, 1970, 56, p. 191-192. 26. Esquenet, C, De Herdt, P, De Bosschere, H, Ronsmans, S, Ducatelle, R & Van Erun, J, An outbreak of Histomonas in free-range layer hens, Avian Pathol, 2003, 32, p. 305-308. 27. Farr, M, Further observations on survival of the protozoan parasite Histomonas melelagridis and eggs of poultry nematodes in feces of infected birds, Cornell Vet, 1961, 51, p. 3-13. 28. Flowers, AI, Hall, CF & Grumbles, LC, Chemotherapy of histomoniasis of turkeys, I. Value of 1-2-dimethyl-5-nitroimidazole intreatment, Avian Dis, 1965, 9, p. 394- 406. 29. Grafl, B, Liebhart, D, Windisch, M, Ibesich, & Hess, C, Seroprevalence of Histomonas meleagridis in pullets and laying hens determined by ELISA, Vet Rec 2011, 6, p. 160-168. 30. Graybill, HW, Smith, T, Production of fatal blackhead in turkeys by feeding embryonated eggs of Heterakis papillosa, J Exp Med, 1920, 31, p. 647-655. 31. Graybill, HW, Blackhead and other causes of loss of turkeys in California, U Cal Agri Exper Sta Circ, 1925, 291, p. 1-14. 32. Griffiths, HJ, A Handbook of Veterinary Parasitology: Domestic Animals of North America, USA: University of Minnesota Press, Minneapolis, USA, 1978, p. 23-25. 33. Grumbles, LC, Boney, WA & Turk, RD, Chemotherapy of enterohepatitis of turkeys, I. The value of 2-amino-5-nitrothiazole inprevention and treatment, Am J Vet Res, 1952, 13, p. 383-385. 34. Hafec, HM, Hauck, R, Luschow, D & Mc Dougald, LR, Comparision of the sppecificity and sensitivity of PCR, nested PCR and realtime PCR for diagnosis of Histomonas meleagridis, Avian Dis, 2005, 49, p. 366-370. 35. Hauck, R, Fuller AL, Greif G & McDougald, LR, Evaluation of nifurtimox for potential use in control of histomoniasis in turkeys, Avian Dis, 2010, 54, p. 28-32. 70 36. Hauck R, Lotfi A & Hafez, HM, Factors influencing the activity of tiamulin against Histomonas meleagridis in vitro, Avian Dis, 2010, 54, p. 936-938. 37. Hess M, Grabensteiner, E & Liebhart, D, Rapid transmission of the protozoan parasite Histomonas meleagridis in turkeys and specific pathogen free chickens following cloacal infection with a mono-eukaryotic culture, Avian pathol 2006, 35, p. 280-285. 38. Huber, K, Chauve, C & Zenner, L, Detection of Histomonas meleagridis in turkeys cecal droppings by PCR amplification of the small subunit ribosomal DNA sequence, Vet Parasitol, 2005, 131, p. 311-316. 39. Dinev, I, Histomonosis, 2005. Available from: < sis> 40. Martinez Guerrero Jose, H, Pereda Solis Martin, E, Rosales Alferez Federico & Herrera Casio Hector, M, First Report of Heterakis gallinarum in Gould‟s Wild Turkey (Meleagris gallopavo mexicana) in Mexico, 2010, Available from: 41. McDougald, LR, Hansen, MF, Histomonas meleagridis: Effect on plasma enzymes in chickens and turkeys, Exp Parasitol, 1970, 27, p. 235-239. 42. McDougald, LR, Studies on Histomonas meleagridis and histomoiasis in chickens and turkeys, USA: The University of Georgia, 2002. 43. McDougald, LR, Fuller, L, Blackhead disease in turkeys: direct transmission of Histomonas meleagridis from bird to bird in a laboratory model, Avian Dis, 2005, 49, p. 328-331. 44. Mc Dougald, LR, Molecular characterization of Histomonas meleagridis and other parabasalids in the united states using the 5.8S, ITS-1, and ITS-2 rRNA regions, USA: The University of Georgia, 2010. 45. Milks, HJ, A preliminary report on some diseases of chickens, La Agr Exp Sta Bull, 1908, 108, p. 1-17. 46. Muller, M, Review article: the hydrogenosome, J Gen Microbiol, 1993, 139, p. 2879-2889. 71 47. Lui, W, Peng, J, Li, F, Sun, H, Ding, Y & He, J, Identification of Histomonas meleagridis by in vitro microculture and polymerase chain reaction, R Parasitol 2011, 1, p. 1-6. 48. Lund, EE & Chute, AM, Reciprocal transfer of Heterakis gallinarum Larvae between Ring-necked pheasants and Japanese quail: Effects on H. gallinarum, Histomonas meleagridis, and Parahistomonas wenrichi, Proceedings of the Helm Soc Wash, 1974, 41, p. 73-76. 49. Ohara, T & Reid, WM, Histomoniasis in chickens. Age of greatest susceptibility and pathogenicity studies, Avian Dis, 1961, 5, p. 355-361. 50. Permin, A & Hansen, JW, The Epidemiology, Diagnosis and Control of Poultry Parasites, Food and Agriculture Organization of the United Nations, Rome, Italy, 1998. 51. Smith, T, An infectious disease among turkeys caused by Protozoa (infectious entero-hepatitis), USDA Bur Anim Ind Bull 1895, 8, p. 3-27. 52. Smith, T & Graybill, HW, Blackhead in chickens and its experimental production by feeding embryonated eggs of Heterakis papillosa, J Exp Med, 1920, 32, p. 143- 152. 53. Tachezy, J, Sánchez, LB & Muller, Mitochondrial type iron-sulfur cluster assembly in the amitochondriate eukaryotes Trichomonas vaginalis and Giardia intestinalis, as indicated by the phylogeny of IscS, Mol Biol Evol, 2001, 18, p. 1919-1928. 54. Tyzzer, EE, The flagellate character and reclassification of the parasite producing “Blackhead” in turkeys – Histomonas meleagridis, J Parasitol, 1920, 6, p. 31-124. 55. Tyzzer, EE, Observations on the transimission of “blackhead” in turkeys, The common fowl as a source of infection, J. Med. Res, 1920, 41, p. 219-237. 56. Wilson, SG & Perie, NM, A study of the blood changes caused by Histomonas meleagridis in chickens, Tijdshr, Diergeneesk, 1967, 91, p. 509-522. 57. Windisch, M & Hess, M, Establishing an indirect sandwich enzyme-linked- immunosorbent-assay (ELISA) for the detection of antibodies against Histomonas meleagridis from experimentally infected specific pathogen-free chickens and turkeys, Vet Parasitol, 2009, 161, p. 25-30. 72 58. Whitmore, JH, Sullivan, TW & Grace, D, Prophylactic efficacy of vitamin A and certain compounds against histomoniasis in turkeys, Poult Sci, 1968, 47, p. 159- 164. 59. Van der Heijden, HM, Stegeman, A & Landman, WJ, Development of a blocking – ELISA for the detection of antibodies against Histomonas meleagridis in chickens and turkeys, Vet Parasitol, 2010, 171, p. 3-4. 60. Venkataratnam, A & Clarkson, MJ, The effect of histomoniasis on the blood cells of the fowl, Res Vet Sci, 1963, 4, p. 603-607. 61. Zaragatzki, E, Hess, M, Grabensteiner, E, Abdel-Ghaffar, F, Al-Rasheid, KA & Mehlhorn, H, Light and transmission electron microscopic studies on the encystation of Histomonas meleagridis, Res. Parasitol, 2010, 106, p. 977-983.

Các file đính kèm theo tài liệu này:

  • pdfnghien_cuu_mot_so_dac_diem_sinh_hoc_cua_don_bao_histomonas_meleagridis_ky_sinh_tren_ga_636.pdf
Luận văn liên quan