Nghiên cứu một số virus trên khoai tây (pvx, pvy, plrv) tại đà lạt bằng kỹ thuật elisa, rt-Pcr và giải trình tự

[COLOR="green"][B] MỤC LỤC PHẦN TRANG Trang tựa Lời cảm tạ .iii Tóm tắt iv Mục lục v Danh sách các chữ viết tắt vii Danh sách các bảng .viii Danh sách các hình và biểu đồ ix 1. MỞ ĐẦU . 1 1.1 Đặt vấn đề . 1 1.2 Mục đích .2 1.3 Yêu cầu .2 2. TỔNG QUAN TÀI LIỆU 3 2.1 Sơ lược về khoai tây và bệnh trên khoai tây .3 2.2 Giới thiệu về virus PVX, PVY và PLRV gây bệnh trên khoai tây .4 2.2.1 Sơ lược về virus PVX (Potato virus X) 4 2.2.2 Sơ lược về virus PVY (Potato virus Y) 5 2.2.3 Sơ lược về virus PLRV (Potato leafroll virus) .6 2.3 Các phương pháp chẩn đoán bệnh cây .8 2.3.1 Phương pháp chẩn đoán bên ngoài 8 2.3.2 Phương pháp sinh học 8 2.3.3 Phương pháp quang phổ .8 2.3.4 Phương pháp so sánh độ đục của dịch cây .8 2.3.5 Phương pháp chiết quang kép 9 2.3.6 Phương pháp chẩn đoán bằng kính hiển vi điện tử 9 2.3.7 Phương pháp ELISA (Enzyme Linked Immuno Sorbent Assay) .9 2.3.7.1 Phương pháp ELISA trực tiếp kiểu Sandwich . 10 2.3.7.2 Phương pháp ELISA gián tiếp (Indirect ELISA) 10 2.3.8 Phương pháp RT-PCR . 10 2.3.9 Phương pháp giải trình tự gen 11 2.4 Nghiên cứu trong và ngoài nước về PVX, PVY và PLRV trên khoai tây . 12 2.4.1 Nghiên cứu trong nước về virus PVX, PVY và PLRV 12 2.4.2 Nghiên cứu nước ngoài về virus PVX, PVY, PLRV . 13 3. VẬT LIỆU VÀ PHưƠNG PHÁP NGHIÊN CỨU 14 3.1 Thời gian và địa điểm nghiên cứu . 14 3.2 Vật liệu nghiên cứu 14 3.2.1 Vật liệu dùng trong kỹ thuật ELISA phát hiện PVX, PVY và PLRV 14 3.2.2 Vật liệu dùng trong kỹ thuật RT-PCR để phát hiện PLRV . 15 3.2.2.1 Vật liệu dùng trong ly trích RNA . 15 3.2.2.2 Vật liệu dùng trong phản ứng RT-PCR 15 3.3 Phương pháp nghiên cứu . 16 3.3.1 Nội dung nghiên cứu . 16 3.3.2 Phương pháp điều tra và lấy mẫu 16 3.3.3 Phương pháp phát hiện PVX, PVY và PLRV . 17 3.3.3.1 Phát hiện virus PVX, PVY và PLRV bằng kĩ thuật ELISA . 17 3.3.3.2 Phát hiện virus PLRV bằng phương pháp RT-PCR 20 3.3.3.3 Giải trình tự trực tiếp đoạn gen của virus PLRV 25 4. KẾT QUẢ VÀ THẢO LUẬN .27 4.1 Tình hình canh tác khoai tây tại Thành phố Đà Lạt 27 4.2 Kết quả phát hiện virus PVX, PVY và PLRV bằng kỹ thuật ELISA 27 4.2.1 Kết quả kiểm tra ELISA tại các phường .27 4.2.2 Kết quả ELISA theo từng giống 29 4.2.3 Kết quả ELISA theo từng thế hệ .30 4.2.4 Kết quả ELISA theo tháng tuổi .30 4.3 Kết quả RT-PCR 31 4.4 Kết quả giải trình tự .34 5. KẾT LUẬN VÀ ĐỀ NGHỊ .37 6. TÀI LIỆU THAM KHẢO 38 PHỤ LỤC .40 NGHIÊN CỨU MỘT SỐ VIRUS TRÊN KHOAI TÂY (PVX, PVY, PLRV) TẠI ĐÀ LẠT BẰNG KỸ THUẬT ELISA, RT-PCR VÀ GIẢI TRÌNH TỰ

pdf49 trang | Chia sẻ: lvcdongnoi | Ngày: 04/06/2013 | Lượt xem: 2531 | Lượt tải: 7download
Bạn đang xem nội dung tài liệu Nghiên cứu một số virus trên khoai tây (pvx, pvy, plrv) tại đà lạt bằng kỹ thuật elisa, rt-Pcr và giải trình tự, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
m ở vụ đầu trên lá nhƣ lá bị cuốn lại ở đỉnh lá đặc biệt những lá ở gốc có xu hƣớng ở thế thẳng đứng và chuyển màu vàng nhạt, với các giống khác lá có màu hồng, đỏ hoặc tía. Sự lây nhiễm muộn có thể không rõ triệu chứng, những giống có độ nhạy cao củ bị thối ở hệ thống mạch. Triệu chứng thứ cấp ở cây trồng từ củ bị nhiễm bệnh làm lá gốc cuốn tròn, thẳng đứng, cây không phát triển và lá cuốn tròn trở nên cứng. Ngoài ra các biểu hiện nhƣ xoắn lá, còi cọc, hoại tử mạch libe và ảnh hƣởng đến sự tích lũy carbonhydrate trong lá cũng hiện diện trên khoai tây bị nhiễm virus PLRV. Virus PLRV có thể ảnh hƣởng đến chất lƣợng thực phẩm (khẩu vị), đây là một trƣờng hợp ngoại lệ vì rất ít virus ảnh hƣởng đến chất lƣợng thức ăn. - Để hạn chế những thiệt hại do nhiễm virus PLRV cần chọn cây khỏe, giống không bị nhiễm virus PLRV, nhổ bỏ cây nhiễm bệnh, phun thuốc trừ rệp, dùng giống kháng với virus PLRV. Hình 2.6 Khoai tây bị bệnh cuốn lá Hình 2.5 Hình thái virus PLRV 8 2.3 Các phƣơng pháp chẩn đoán bệnh cây Với đặc điểm phức tạp của bệnh virus nên việc chẩn đoán gặp nhiều khó khăn và đòi hỏi những dụng cụ máy móc hiện đại mới thực hiện đƣợc. Những phƣơng pháp chẩn đoán bệnh virus hiện nay thƣờng dùng là: 2.3.1 Phƣơng pháp chẩn đoán bên ngoài * Dựa vào trạng thái dấu vết bệnh Phƣơng pháp này đơn giản và nhanh chóng nhƣng không phải lúc nào cũng chính xác, vì vết bệnh dễ biến đổi, nhiều khi cây bị bệnh mà vết bệnh không phát ra ngoài, hoặc thời kỳ tiềm phục của bệnh quá dài nên khó phát hiện ngay đƣợc. Một số trƣờng hợp vết bệnh không rõ ràng. *Ngoài ra cũng có thể xem tế bào bị bệnh dƣới kính hiển vi để chẩn đoán một số bệnh virus nhƣ hoa lá thuốc lá có thể nhìn dƣới kính hiển vi thấy trong tế bào lông tơ lá có những tinh thể virus kết tinh hình lục giác. 2.3.2 Phƣơng pháp sinh học * Gieo hạt để chờ khi cây mọc có phát bệnh hay không. Phƣơng pháp này thƣờng dùng trong kiểm dịch thực vật và để kiểm tra bệnh ở hạt giống. Là một phƣơng pháp tuy đơn giản, dễ làm nhƣng mất thời gian. * Dùng cây chỉ thị và lây bệnh nhân tạo Những cây chỉ thị là những cây cùng loại hay khác loại với cây ký chủ nhƣng rất nhạy cảm đối với bệnh virus và khi lây bệnh nhân tạo virus, trên cây chỉ thị tạo ra vết bệnh điển hình nhất. Có thể lây bệnh nhân tạo bằng dịch cây muốn chẩn đoán lên cây chỉ thị, hoặc ghép cành, ghép mắt cây chỉ thị lên cây bệnh. Để chẩn đoán bệnh virus X và virus Y hại khoai tây ngƣời ta dùng cây chỉ thị Nicotiana glutinosa, Nicotiana tabacum, Datura tatula, Gomphrena globosa hoặc dùng cà độc dƣợc (Datura stramomium) làm cây chỉ thị để chẩn đoán bệnh virus hoa lá thuốc lá. 2.3.3 Phƣơng pháp quang phổ Chủ yếu dựa vào đặc điểm của virus có khả năng hấp thụ tia cực tím do virus có chứa acid nucleic. 2.3.4 Phƣơng pháp so sánh độ đục của dịch cây So sánh độ đục của dịch cây bằng máy đo độ đục, hoặc so sánh độ nhớt của dịch cây bằng bình đo độ nhớt. Phƣơng pháp này chỉ chẩn đoán bệnh virus nói chung, và chẩn đoán tƣơng đối đúng khi nồng độ virus trong dịch cây khá cao. 9 2.3.5 Phƣơng pháp chiết quang kép Dùng kính hiển vi phân quang khảo sát dịch cây đang chảy. Phƣơng pháp này chỉ dùng đối với các virus có hình gậy, còn virus hình cầu không dùng đƣợc. 2.3.6 Phƣơng pháp chẩn đoán bằng kính hiển vi điện tử Trong nghiên cứu virus, kính hiển vi điện tử tia xuyên đƣợc sử dụng nhƣ một công cụ rất tích cực để tìm hiểu hình thái và cấu trúc của virus thực vật cũng nhƣ mô thực vật bị nhiễm bệnh. Ngƣời ta dùng kính hiển vi điện tử với độ phóng đại 2 - 3 chục ngàn lần trở lên. Phƣơng pháp đơn giản là sử dụng dung dịch chứa virus chiết từ lá cây bệnh hay thông qua làm tinh khiết và cố định bằng hóa chất trên lƣới đồng để quan sát trên kính hiển vi điện tử. Đây là phƣơng pháp trực tiếp và đơn giản nhất. Có thể dùng kháng huyết thanh khi dùng phƣơng pháp xem trực tiếp để phân biệt trong trƣờng hợp nghi là mẫu bị lẫn virus khác. Phƣơng pháp này giúp ta xác định đƣợc hai virus khác nhau trong một mẫu. Ngƣời ta còn dùng lát cắt cực mỏng bằng máy cắt tiêu bản hiển vi và nhuộm mẫu đƣợc cắt, sau đó quan sát sự hiện diện của virus trong các tế bào thực vật bị nhiễm bệnh. 2.3.7 Phƣơng pháp ELISA (Enzyme Linked Immuno Sorbent Assay) Đây là kỹ thuật khá nhạy và đơn giản, cho phép xác định kháng nguyên hoặc kháng thể ở nồng độ rất thấp (0,1 ng / ml). So với với các kỹ thuật miễn dịch khác thì kỹ thuật này rẻ tiền và an toàn hơn mà vẫn đảm bảo độ chính xác. ELISA đƣợc dùng để xác định nhiều tác nhân gây bệnh nhƣ virus, vi khuẩn, nấm, kí sinh. Nguyên tắc của kỹ thuật này dựa trên sự gắn kết đặc hiệu giữa kháng nguyên và kháng thể, trong đó kháng thể đƣợc gắn với một enzyme. Khi cho thêm cơ chất thích hợp (thƣờng là nitrophenol phosphate) vào phản ứng, enzyme sẽ thủy phân cơ chất thành một chất có màu. Sự xuất hiện màu chứng tỏ đã xảy ra phản ứng đặc hiệu giữa kháng thể với kháng nguyên và thông qua cƣờng độ màu mà biết đƣợc nồng độ kháng nguyên hay kháng thể cần phát hiện. Hai kỹ thuật ELISA đƣợc dùng nhiều là kỹ thuật ELISA trực tiếp (direct Double Antibody Sandwich - ELISA) và ELISA gián tiếp (Indirect ELISA). Các enzyme thƣờng dùng là β-galactosidaze, glucosidaze, peroxidaze và phosphataze kiềm (Vũ Triệu Mân, 2003). 10 2.3.7.1 Phƣơng pháp ELISA trực tiếp kiểu Sandwich Gồm các bƣớc sau Bƣớc 1: Cố định kháng thể đặc hiệu của virus vào đĩa ELISA. Bƣớc 2: Cố định dịch cây (có chứa virus cần xác định) vào đĩa ELISA. Bƣớc 3: Cố định kháng thể có gắn enzyme. Bƣớc 4: Cho cơ chất nền là cơ chất của enzyme vào đĩa ELISA Kết quả đƣợc đọc trên máy đọc ELISA (ELISA reader) ở bƣớc sóng 405 nm. Để cố định màu sắc của đĩa ELISA, bảo quản trong tủ lạnh 4oC và cần xem vào khi khác có thể dùng dung dịch NaOH 3M nhỏ vào mỗi giếng 25 – 30 µl. 2.3.7.2 Phƣơng pháp ELISA gián tiếp (Indirect ELISA) Kỹ thuật này thƣờng đƣợc dùng để định tính và định lƣợng kháng thể hiện diện trong mẫu cần xác định. Gồm các bƣớc: Bƣớc 1: Cố định kháng nguyên lên thành giếng. Bƣớc 2: Cho tiếp kháng huyết thanh (chứa kháng thể cần kiểm tra) vào. Bƣớc 3: Thêm cộng hợp kháng kháng thể có gắn enzyme vào. Bƣớc 4: Thêm cơ chất của enzyme vào để đọc kết quả (Vũ Triệu Mân, 2003). 2.3.8 Phƣơng pháp RT-PCR (reverse transcriptase - polymerase chain reaction) RT-PCR là một ứng dụng của PCR (Polymerase Chain Reaction) dùng để khuếch đại các phân tử RNA. Do Taq polymerase không hoạt động trên RNA nên ngƣời ta sử dụng kỹ thuật phối hợp RT-PCR (Reverse Transcriptase - PCR). Trƣớc hết RNA đƣợc chuyển thành cDNA (Complement Deoxyribonucleotic Acid) nhờ enzyme phiên mã ngƣợc từ Mo-MLV (murine leukemia virus) hoặc AMV (avian myeloblastosis virus). Primer sử dụng trong giai đoạn này có thể là primer ngƣợc của PCR giai đoạn sau (Antisense primer), có thể là Oligonucleotic dT (để bắt cặp với đuôi poly A của các phân tử RNA), mà cũng có thể là các hexanucleotide (trình tự gồm 6 nucleotide) bắt cặp ngẫu nhiên với một trình tự ngắn trên RNA. Sau đó cDNA đƣợc khuếch đại nhờ Taq polymerase. Ngƣời ta cũng có thể sử dụng Tth DNA polymerase cho cả hai giai đoạn. Kỹ thuật RT-PCR cho phép nghiên cứu các mRNA tồn tại với hàm lƣợng thấp, RNA của virus, không thể phát hiện bằng các phƣơng pháp khác nhƣ Northern blot. Một kỹ thuật mới phát triển - kỹ thuật in situ RT-PCR cho phép khuếch đại các RNA ngay trên mô và tế bào. Kỹ thuật này có nguyên tắc nhƣ trên, đƣợc tiến hành trên lát cắt mô, tế bào cố định trên lame, trong thiết bị PCR có bộ phận tạo nhiệt chuyên cho lame. 11 2.3.9 Phƣơng pháp giải trình tự gen Phƣơng pháp RT-PCR chỉ cho biết kích thƣớc của đoạn gene ta có đƣợc, cho phép xác định đoạn gene đó có tồn tại trong virus hay không nhƣng chƣa thể kết luận về bản chất của nó, cụ thể là đoạn gen đó tƣơng ứng với gene gì, có chức năng điều hòa hay mã hóa cho protein nào, cá thể mang gene này có phải là biến thể mới không . Thông tin này chỉ có thể rút ra từ việc xác định trình tự nucleotide của gen đó. Hai phƣơng pháp chính trong xác định trình tự là phƣơng pháp hóa học của Maxam và Gilbert (1977) và phƣơng pháp enzyme học của Sanger và cộng sự (1977). - Nguyên tắc của phƣơng pháp hóa học dựa vào các phản ứng hóa học thủy giải đặc hiệu phân tử DNA, tạo thành một tập hợp nhiều phân đoạn có kích thƣớc khác nhau. - Nguyên tắc enzyme học của Sanger dựa vào sự tổng hợp mạch bổ sung cho trình tự cần xác định nhờ DNA polymerase. Với việc sử dụng thêm các dideoxynucleotide cùng với các deoxynucleotide thông thƣờng, kết quả tổng hợp cũng là sự hình thành một tập hợp nhiều đoạn DNA có kích thƣớc khác nhau. Hình 2.7 Sơ đồ tổng quát của kỹ thuật RT-PCR 12 Ở cả hai trƣờng hợp, các phân đoạn DNA sẽ đƣợc phân tách thông qua điện di trên gel polyacrylamide hay polymer trong các mao quản có khả năng phân tách hai đoạn DNA chỉ chênh lệch nhau một nucleotide. Với việc sử dụng một loại nucleotide có đánh dấu, kết quả trình tự cần xác định đƣợc đọc từ bản điện di. (Hồ Huỳnh Thùy Dƣơng, 2002). 2.4 Những nghiên cứu trong và ngoài nƣớc về virus PVX, PVY và PLRV trên khoai tây 2.4.1 Nghiên cứu trong nƣớc về virus PVX, PVY và PLRV Những nghiên cứu về bệnh virus thực vật nói chung và trên khoai tây nói riêng ở Việt Nam ngày càng phong phú và đa dạng, tuy nhiên phần lớn các nghiên cứu này chỉ tập trung vào việc chẩn đoán và xác định bệnh. - Năm1967 Nguyễn Hữu Thụy (Ban điều tra cơ bản côn trùng bệnh cây) đã xác định sự có mặt của virus X khoai tây. - Từ năm 1973 – 1985, Vũ Triệu Mân đã xác định 7 virus chính gây hại trên khoai tây ở Việt Nam là PVY, PVX, PVA, PVS, PVM, PAMV, PLRV bằng phƣơng pháp cây chỉ thị, phƣơng pháp ELISA, phƣơng pháp hiển vi điện tử. - Các tác giả Nguyễn Viết Tùng, Nguyễn Văn Viết, Nguyễn Kim Oanh đã nghiên cứu các môi giới truyền bệnh ở vùng Gia Lâm (Hà Nội) – vùng Xuân Mai (Hòa Bình) truyền bệnh virus khoai tây. - Từ năm 1980 – 1985, đề tài cấp nhà nƣớc chống bệnh virus, đã tổ chức phòng trừ bằng chọn lọc vệ sinh cho nhiều vùng sản xuất khoai tây ở miền bắc (Hà Nam, Nam Định, Hà Bắc, Hải Dƣơng, Hƣng Yên). - 1985 – 1992, Trƣờng Đại học Nông Nghiệp 1 đã đề xuất việc sản xuất khoai tây giống trên vùng cách li địa hình ngay ở đồng bằng sông Hồng chống bệnh virus có hiệu quả ở vùng Hà Tây. - Các virus PVX, PVY, PMV và một số virus khác đã đƣợc nghiên cứu và sản xuất thử kháng huyết thanh tại trƣờng Đại học Nông Nghiệp 1 Hà Nội. Kỹ thuật ELISA đƣợc sử dụng từ năm 1990, kỹ thuật PCR bắt đầu áp dụng từ năm 1995 để chẩn đóan bệnh. - Tại Trung tâm Nghiên cứu khoai tây Đà Lạt chỉ mới dừng lại ở kiểm tra ELISA trên các giống do Trung tâm sản xuất. 13 - Các kỹ thuật RT-PCR, giải trình tự chƣa đƣợc áp dụng phổ biến trong công tác chẩn đoán virus PLRV. 2.4.2 Nghiên cứu nƣớc ngoài về virus PVX, PVY, PLRV - Nie và Singh (2002) đã dùng kỹ thuật RT-PCR trong việc xác định trình tự nucleotide của PVY ở Châu Âu và Bắc Mỹ (PVYNTN gây đốm hoại tử ở củ ). Thông qua nghiên cứu này, họ muốn xác định khoảng cách di truyền và phƣơng pháp phân biệt các chủng PVY, đồng thời cũng giúp xác định những trình tự mới xuất hiện ở những vùng địa lí khác nhau do biến chủng từ PVYNTN. Nghiên cứu này dựa trên sự khác biệt ở đoạn gen P1 và 5’ - UTR. - Nie, Xianzhou, Singh và Rudra (2003) đã dùng kỹ thuật multiplex RT-PCR để phân biệt các chủng PVYN, PVYO và PVYNTN. - Nie và Singh (2000) đã sử dụng các primer ngẫu nhiên cho multiplex RT-PCR nhằm mục đích xác định sự hiện diện của virus và viroid trong rệp, lá và củ - Singh, Kurz, Boiteau và Moore (1997) đã dùng kỹ thuật PT-PCR để xác định sự hiện diện của PLRV trong rệp bắt từ ruộng khoai tây. Trong nghiên cứu này 3 loại rệp là Myzus persicae: green peach aphid; buckthorn aphid và potatoaphid Macrosiphum euphorbiae đƣợc lấy từ ruộng cây khoai tây thƣơng mại New Brunswick (1988-1994) đều cho kết quả dƣơng tính với PLRV. - Singh, Nie, Sing, Coffin và Duplessis (2002) cho rằng phản ứng RT-PCR bị ức chế bởi hợp chất phenolic từ mô cây. Nghiên cứu này xác định việc bổ sung Na2SO3 trong bƣớc cho dung dịch đệm li trích RNA có thể nâng cao hiệu quả của RT-PCR. Bởi vì Na2SO3 (Sodium sulphite) có khả năng ức chế hợp chất phenolic hiện diện trong quá trình ly trích RNA. - Công ty Monsanto Canada Inc đã thành công trong việc tạo ra giống khoai tây “Newleaf-plusTM Russet Burbank” với các dòng RBMT 21-129, RBMT21-350 và RBMT22-082 có khả năng kháng lại PLRV. Bằng cách chuyển gen CryIIIA từ Bacillus thuringensis và hai trình tự ORF1, ORF2 từ PLRV , quá trình chuyển gen đƣợc thực hiện nhờ Agrobacterium. 14 PHẦN 3. VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 3.1 Thời gian và địa điểm nghiên cứu Đề tài đƣợc thực hiện từ ngày 21 tháng 03 đến ngày 15 tháng 07 năm 2005 tại Trung tâm Phân tích Thí nghiệm Trƣờng Đại Học Nông Lâm Thành phố Hồ Chí Minh. 3.2 Vật liệu nghiên cứu 3.2.1 Vật liệu dùng trong kỹ thuật ELISA để phát hiện PVX, PVY và PLRV a. Nguồn mẫu thí nghiệm Tất cả các mẫu thí nghiệm đƣợc lấy từ năm phƣờng (5, 8, 9, 11 và 12) tại Đà Lạt, đƣợc bảo quản trong điều kiện -20oC. b. Hóa chất: Các loại hóa chất cần cho quá trình chẩn đoán đƣợc cung cấp đầy đủ trong các bộ kit Potato virus X - PVX test kit 480 test, potato virus Y - PVY test kit 480 test và potato leafroll virus - PLRV test kit 480 test (do Bio – Rad cung cấp) gồm có: - Dịch trích mẫu (Tampon De Broyage Extraction buffer 1X) - Dung dịch đệm để pha kháng thể (Coating buffer) - Kháng thể + Đối với PVX và PVY dùng kháng thể đa dòng (Polyclonal antibody) + Đối với PLRV dùng kháng thể đơn dòng (Monoclonal antibody) - Dịch rửa (PBS - Tween) - Đối chứng dƣơng (Positive control) - Đối chứng âm (Negative control) - Dung dịch đệm để pha kháng thể có gắn enzyme (Conjugate buffer) - Kháng thể gắn enzyme alkaline-phosphatase (Conjugate antibodies) - Dung dịch đệm để pha chất chỉ thị màu - Chất chỉ thị màu p-NPP Ngoài ra cần phải chuẩn bị - Cồn 70o - Nƣớc cất hai lần khử ion và hấp khử trùng 15 3.2.2 Vật liệu dùng trong kỹ thuật RT-PCR để phát hiện PLRV 3.2.2.1 Vật liệu dùng trong ly trích RNA RNA đƣợc ly trích theo quy trình của kit ly trích (The Aurum total RNA mini kit ) do Bio-Rad sản xuất Những loại hóa chất có sẵn trong kit: - Dịch trích mẫu (Lysis solution) 50 ml - Dịch rửa nhẹ 5X (Low stringency wash solution) 20 ml - Dịch rửa mạnh (High stringency wash solution) 40 ml - DNase I dạng bột 1 hủ - Dịch pha loãng DNase I 10 ml - Dịch hòa tan RNA (Elution solution) 10 ml Bên cạnh đó ta phải chuẩn bị một số hóa chất sau : - Polyvinylpyrolidone - 40 (PVP) 2% - Tris-base - β-mercaptoethanol 14,2 M - Ethanol 95 - 100% - NaOH 0,1 M - EDTA 1M 3.2.2.2 Vật liệu dùng trong phản ứng RT-PCR *Giai đoạn tổng hợp cDNA Dùng kit tổng hợp cDNA (iScript cDNA kit) do Bio - Rad cung cấp với thành phần nhƣ sau: - Hỗn hợp phản ứng đã pha sẵn (5X iScript Reaction Mix)100 µl. Hỗn hợp này đã đƣợc trộn với primer poly T (oligo dT) và các hexamer ngẫu nhiên, chúng có khả năng bắt cặp với những RNA mục tiêu khác nhau. Hỗn hợp này sẽ cho kết quả tối ƣu với những sản phẩm < 1 kb. - Nƣớc không nhiễm enzyme thủy phân nucleotide (Nuclease free water) 1,5 ml. - Enzyme phiên mã ngƣợc (iScript Reverse Transcriptase) 25 µl, là enzyme MMLV với hoạt tính RNAse H+ có độ nhạy cao hơn những enzyme có hoạt tính RNAse H-. Enzyme này đƣợc bổ sung thêm chất ức chế enzyme phân hủy RNA (RNAse). Ta chỉ cần bổ sung thêm RNA và chạy theo chu trình nhiệt của kit. + Giai đoạn thực hiện phản ứng PCR khuếch đại các phân tử cDNA 16 - cDNA đƣợc lấy từ quá trình tổng hợp ở trên. - Nƣớc không chứa nuclease (Nuclease free water) - Dung dịch đệm PCR (10X PCR buffer) - MgCl2 50 mM - Hỗn hợp dNTP 10 mM - iTaq polymerase 5 U / µl - Primer với trình tự nhƣ sau : Sense primer: 5’CGC GCT AAC AGA GTT CAG CC 3’ Antisense primer: 5’GCA ATG GGG GTC CAA CTC AT 3’ Bên cạnh đó cần phải chuẩn bị một số hóa chất khác nhƣ: - Agarose (Promega - Mỹ) - Loading dye 6X - Thang chuẩn (ladder) 100bp (Bio – Rad) - TAE 0,5X 3.3 Phƣơng pháp nghiên cứu 3.3.1 Nội dung nghiên cứu - Điều tra tình hình nhiễm các loại virus PVX, PVY và PLRV trên khoai tây tại thành phố Đà Lạt thông qua việc thực hiện phản ứng ELISA trên các mẫu thu thập tại các phƣờng. - Kiểm tra các mẫu có phản ứng ELISA dƣơng tính với virus PLRV bằng kỹ thuật RT-PCR. - Giải trình tự đoạn DNA có đƣợc từ sản phẩm RT-PCR để khẳng định nguồn gốc của đoạn gen đó, đánh giá mức độ tƣơng đồng với gen của virus PLRV có trên ngân hàng gen. 3.3.2 Phƣơng pháp điều tra và lấy mẫu Công tác điều tra tình hình bệnh virus trên khoai tây ở thành phố Đà Lạt đƣợc tiến hành nhƣ sau - Liên hệ Phòng Nông nghiệp, Chi cục Bảo vệ Thực vật và Trạm Khuyến nông thành phố để điều tra tình hình phân bố diện tích, chủng loại giống, vùng tập trung và các yếu tố liên quan đến bệnh virus trên khoai tây từ đó xác định địa bàn tiêu biểu cần điều tra. 17 - Điều tra tại các hộ nông dân có trồng khoai tây theo mẫu điều tra đã chuẩn bị sẵn gồm các chỉ tiêu nhƣ: Đặc điểm vƣờn trồng, chủng loại giống, kỹ thuật canh tác, tình hình sâu bệnh. Khâu lấy mẫu đƣợc thực hiện nhƣ sau: - Tùy theo diện tích có thể lấy từ 5 - 10 mẫu /vƣờn theo đƣờng chéo. Mẫu là toàn bộ thân cây, đƣợc cho vào bao nylon có ghi nhãn cẩn thận về thời gian, địa điểm, chủ vƣờn, loại cây, tuổi cây, triệu chứng, điều kiện canh tác. Mẫu đƣợc cho vào thùng xốp và đƣợc giữ lạnh cho đến khi kết thúc đợt lấy mẫu. - Mẫu đƣợc đem về phòng thí nghiệm trong điều kiện đƣợc giữ lạnh và bảo quản trong tủ lạnh ở nhiệt độ -20oC cho đến khi phân tích. Bảng 3.1 Số mẫu thu thập từ 5 phƣờng thuộc tp.Đà Lạt STT Địa điểm Lấy mẫu Tổng số mẫu Giống Tuổi cây Thế hệ 06 07 1T 1.5T 2T 2.5T 3T F1 F2 F3 1 2 3 4 5 Phƣờng 5 Phƣờng 8 Phƣờng 9 Phƣờng 11 Phƣờng 12 32 24 54 18 23 22 0 0 0 0 10 24 54 18 23 5 0 15 0 0 6 0 10 8 0 6 0 12 0 13 10 0 0 0 0 5 24 17 10 10 16 11 32 0 11 0 13 22 10 12 16 0 0 8 0 Tổng cộng 150 22 128 20 24 31 10 66 70 57 24 T: tháng 3.3.3 Phƣơng pháp phát hiện PVX, PVY và PLRV 3.3.3.1 Phát hiện PVX, PVY và PLRV bằng kĩ thuật ELISA Sử dụng phƣơng pháp dDAS-ELISA (direct Double Antibody Sandwich Enzyme Linked Immuno Sorbent Assay) theo sự hƣớng dẫn thực hiện của bộ kit và đƣợc tiến hành qua 2 giai đoạn. Giai đoạn 1: Thực hiện 1 lần ly trích virus để kiểm tra cả virus PVX, PVY và PLRV. Giai đoạn 2: Thực hiện phản ứng ELISA. Giai đoạn 1: Ly trích mẫu Trƣớc tiên ta phải dùng nƣớc cất vô trùng (chuẩn bị trƣớc) để pha dịch ly trích mẫu từ 20X xuống còn 1X. Dịch trích đƣợc pha loãng để dùng ly trích cả PVX, PVY và PLRV. Tổng số mẫu cần nghiền là 135 mẫu Các mẫu đƣợc lấy ra từ tủ lạnh -20oC, cắt lấy phần thân, chồi non hoặc gân chính của lá (có cả phiến lá) và cân khoảng 0,5 gam cho vào cối. 18 Hút 2,5 ml dung dịch trích mẫu, dùng chày nghiền mẫu cho đến khi các thành phần đều nát vụn. Đổ dịch mẫu vừa nghiền xong vào eppendoff 1,5 ml. Sau đó ta đem li tâm với tốc độ 5000 vòng / phút trong 5 phút ở 4oC. Đem mẫu cất vào tủ mát (2 - 8oC) để dùng sau. Giai đoạn 2: Thực hiện phản ứng ELISA Bƣớc 1 Chuẩn bị đĩa và sơ đồ bố trí mẫu. Theo chỉ dẫn của kit, ta bỏ hàng A và H; bỏ cột 12. Do đó đĩa ELISA 96 giếng chỉ kiểm tra đƣợc 27 mẫu, mỗi mẫu đƣợc cho vào 2 giếng. Mỗi đĩa đều đƣợc ghi số thứ tự từ 1 đến 5 và tên của virus đang thực hiện chẩn đoán. Sơ đồ bố trí trên đĩa ELISA 1 2 3 4 5 6 7 8 9 10 11 12 A B Substrate BF 1 4 7 10 13 16 19 22 25 C Substrate BF 1 4 7 10 13 16 19 22 25 D Substrate PC 2 5 8 11 14 17 20 23 26 E Substrate PC 2 5 8 11 14 17 20 23 26 F Substrate NC 3 6 9 12 15 18 21 24 27 G Substrate NC 3 6 9 12 15 18 21 24 27 H BF: Buffer 1; 2…; 27: Số thứ tự của mẫu PC (Positive control) : Đối chứng dƣơng NC (Negative control): Đối chứng âm Substrate: Cơ chất Bƣớc 2 Pha loãng kháng thể (kháng thể 1) bằng dung dịch đệm (tỷ lệ pha theo bảng dƣới đây). Bảng 3.2 Tỷ lệ pha loãng kháng thể Hóa chất PVX PVY PLRV Dung dịch đệm Kháng thể 10ml 100µl 10ml 100µl 10ml 20µl 19 Dùng pipet 8 đầu hút nƣớc cất vào cột số 1. Cũng với pipet trên ta hút kháng thể cho vào các giếng từ cột số 2 đến số 11 (100 µl / giếng). Dùng băng keo trong dán kín mặt đĩa và đem ủ ở 37oC trong 2 giờ. Sau đó rửa 3 lần với PBS-Tween bằng máy rửa đĩa ELISA. Bƣớc 3 - Trƣớc tiên ta phải hòa tan đối chứng dƣơng và đối chứng âm với cùng một thể tích nƣớc là 1ml - Dùng pipet 8 đầu hút nƣớc cất (100 µl / giếng) cho vào cột số 1 (substrate). - Cho 100 µl đối chứng dƣơng vào 2 ô PC (Positive control). - Cho 100 µl đối chứng âm vào 2 ô NC (Negative control). - Cho dịch trích mẫu vào (100 µl / giếng). Tổng cộng 135 mẫu sẽ đƣợc cho vào 5 đĩa, mỗi đĩa 27 mẫu, mỗi mẫu 2 giếng theo bố trí ở bảng 3.1. - Dùng keo trong dán kín mặt đĩa, đem ủ qua đêm trong tủ mát 2 - 8oC. Sau đó đem rửa 3 lần với PBS - Tween. Trong bƣớc này cần chú ý các điểm sau đây. - Cần ghi lại chính xác kí hiệu của mẫu tƣơng ứng với số thứ tự của mẫu trên đĩa. - Thao tác cẩn thận tránh hiện tƣợng nhiễm chéo. Bƣớc 4 - Pha loãng kháng thể gắn enzyme (Conjugate antibodies) (kháng thể 2) trong dung dịch đệm theo tỉ lệ cho trong bảng dƣới đây. Kháng thể này đƣợc pha trong đĩa petri. Bảng 3.3 Tỷ lệ pha loãng kháng thể gắn enzyme Hóa chất PVX PVY PLRV Dung dịch đệm 1X Kháng thể gắn enzyme 10ml 100µl 10ml 100µl 10ml 20µl - Dùng pipet 8 đầu hút nƣớc cất (100 µl / giếng) cho vào cột số 1 (Substrate). - Dùng pipet 8 đầu hút kháng thể đã pha loãng vào mỗi giếng từ cột số 2 đến số 11 (100 µl / giếng). Dùng keo trong dán kín mặt đĩa và đem ủ 37oC trong 2 giờ. Sau đó rữa 3 lần với PBS - Tween. 20 Bƣớc 5 Chuẩn bị cơ chất tạo màu: p-NPP (p - nitrophenyl phosphate) có trong kit ở dạng viên rắn. Ta phải xác định lƣợng cơ chất cần thiết cho sự hiển thị màu. Sau đó đem những viên này đi nghiền nát ra và cho vào dung dịch đệm với tỷ lệ cho dƣới đây. Dùng một hủ nhựa nhỏ để hòa tan chất tạo màu và sau đó đổ ra đĩa petri. Dùng pipet 8 đầu, hút 100 µl p-NPP vào mỗi giếng từ cột số 1 đến số 11. Dùng băng keo trong dán kín mặt đĩa và đem ủ 37oC và đọc kết quả. Bảng 3.4. Tỷ lệ pha loãng cơ chất tạo màu Hóa chất PVX PVY PLRV Dung dịch đệm 1X p - NPP (2 viên 5 mg) 10 ml 5 mg 10 ml 5 mg 10 ml 5 mg Bƣớc 6 Đọc kết quả bằng máy đọc của hãng Bio - Rad với bƣớc sóng 405 nm tại các thời điểm 30 phút, 1giờ sau khi ủ với chất tạo màu. OD mẫu = OD đọc (thô) – OD trung bình của các giếng có cơ chất (Substrate). OD mẫu so với ngƣỡng (ngƣỡng = hai lần trung bình OD của đối chứng âm). POS: Kết quả dƣơng tính-nhiễm bệnh khi OD của mẫu vƣợt quá ngƣỡng. NEG: Kết quả âm tính – Không nhiễm bệnh khi OD của mẫu dƣới ngƣỡng. Bên cạnh đó kết quả cũng có thể đƣợc đánh giá bằng mắt thƣờng thông qua sự đổi màu của các giếng: - Nếu màu đậm tƣơng đƣơng hoặc cao hơn so với đối chứng dƣơng: Đánh giá nhiễm bệnh - Nếu giếng không màu tƣơng đƣơng hoặc thấp hơn so với đối chứng âm: Đánh giá không nhiễm bệnh. 3.3.3.2 Phát hiện virus PLRV bằng phƣơng pháp RT-PCR Các mẫu sau khi đƣợc kiểm tra bằng kỹ thuật ELISA sẽ đƣợc chọn ra để thực hiện tiếp phản ứng RT-PCR. Trong đề tài này chúng tôi chỉ thực hiện phản ứng RT- PCR trên đối tƣợng virus PLRV. Tiêu chuẩn chọn mẫu để thực hiện RT-PCR - Dƣơng tính. - Trị số dƣơng tính từ máy đọc phải cao. 21 - Triệu chứng đƣợc quan sát phải đặc trƣng và biểu hiện ra ngoài. - Mẫu đƣợc bảo quản tốt (còn tƣơi). Dựa trên những tiêu chí trên, ta chọn ra đƣợc 5 mẫu đại diện cho 5 phƣờng tại thành phố Đà Lạt - Phƣờng 5: Mẫu 148 - Phƣờng 8: Mẫu 97 - Phƣờng 9: Mẫu 45 - Phƣờng 11: Mẫu 92 - Phƣờng 12: Mẫu 10 Kỹ thuật RT-PCR đƣợc sử dụng là 2 bƣớc (two steps), tức là gồm giai đoạn tổng hợp cDNA (Reverse) và giai đoạn khuếch đại cDNA (PCR). Virus PLRV đƣợc phát hiện dựa trên một đoạn gen có kích thƣớc 336 bp, mã hóa cho phân tử protein vỏ. Quá trình thực hiện phải qua 2 giai đoạn: Ly trích RNA, tổng hợp và khuếch đại cDNA nhờ phản ứng RT-PCR. Giai đoạn 1: Ly trích RNA Quá trình ly trích RNA đƣợc thực hiện theo hƣớng dẫn của bộ kit ly trích RNA (The Aurum total RNA kit). Tuy nhiên để thực hiện đúng yêu cầu ta phải chuẩn bị trƣớc một số dụng cụ và hóa chất sau: - Nƣớc phải đƣợc xử lý với DEPC để khử RNase. Cối chày phải đƣợc hấp khử trùng sau khi đã đƣợc tráng nƣớc chƣa khử DEPC. - Đầu tip, eppendoff phải đƣợc xử lý sao cho đảm bảo vô trùng và không còn sự hiện diện của enzyme phân hủy RNA. Tất cả phải đƣợc chuẩn bị trƣớc khi ly trích một ngày. *Quy trình ly trích Thực hiện theo chỉ dẫn của bộ kit. Lƣu ý, một số hóa chất không đƣợc cung cấp cùng với kit nên ta phải chuẩn bị riêng. Ta phải chuẩn bị - Polyvinyl pyrolidone (PVP) 2% -Tris base pH = 7,5 - Ethanol 70%, 100% - β - mercaptoethanol - Pha DNase I từ dạng bột thành dạng lỏng - Pha low stringency 22 Các bƣớc tiến hành ly trích RNA 1. Cân khoảng 80 mg mẫu lá, cắt ra từng miếng nhỏ (< 5 mm). Nghiền mịn trong nitơ lỏng. Chú ý không để cho mẫu bị chảy nƣớc trong lúc nghiền. 2. Cho 60 mg mẫu đã nghiền vào tube 2 ml có nắp đậy (có sẵn trong kit). Cho 14 µl PVP 2% vào mỗi 700 µl dịch ly trích mẫu (lysis solution). 3. Cho 700 µl dịch ly trích mẫu (lysis solution) đã bỗ sung PVP 2% vào tube chứa mẫu và trộn đều bằng pipet từ 12 - 15 lần. 4. Ly tâm với tốc độ 12000 vòng trong 3 phút ở 4oC. Sau đó hút dịch nổi sang tube 2 ml (có trong kit). 5. Cho 700 µl ethanol 70% vào tube chứa dịch nổi, trộn đều bằng pipet cho đến khi dịch không còn phân lớp. 6. Cho dịch hòa tan RNA (elution solution) vào bể điều nhiệt ở 70oC. Cho RNA binding column vào tube 2 ml không có nắp đậy. 7. Hút 700 µl dịch mẫu cho vào RNA binding column. Ly tâm ở tốc độ 12000 vòng trong 1 phút ở 4oC. Loại phần dịch bên dƣới ra khỏi tube (thực hiện nhiều lần cho đến khi hết mẫu thì thôi). 8. Cho 80 µl ethanol 100% vào 20 ml dịch rửa nhẹ (low stringency). 9. Cho 700 µl dịch rửa nhẹ (low stringency) đã bổ sung ethanol 100% vào RNA binding column. Ly tâm 12000 vòng trong 30 giây ở 4oC. Loại phần dịch bên dƣới. 10. Pha DNase I với 250 µl Tris base pH = 7,5, trộn đều. 11. Pha 5 µl DNase I với 75 µl dịch pha loãng DNase (DNase delution solution) cho một mẫu ly trích trong tube 1,5 ml. Cho 80 µl dung dịch DNase vào RNA binding column. Ủ 15 phút ở nhiệt độ phòng. Ly tâm 12000 vòng trong 30 giây ở 4oC. Loại phần dịch bên dƣới. 12. Thêm 700 µl dịch rửa mạnh (high stringency wash solution) vào RNA binding column. Ly tâm 12000 vòng trong 30 giây ở 4oC Loại phần dịch bên dƣới 13. Thêm 700 µl dịch rửa nhẹ (low stringency wash solution) vào RNA binding column. 23 Ly tâm 12000 vòng trong 30 giây ở 4oC Loại phần dịch bên dƣới. Ly tâm tiếp 60 giây với tốc độ 12000 vòng ở 4oC để loại hoàn toàn dịch rửa. 14. Cho RNA binding column vào tube 1,5 ml (có trong kit) có nắp đậy. Cho 80 µl dịch hòa tan RNA (elution solution) đã ủ ở 70oC vào RNA binding column, giữ ở nhiệt độ phòng trong 60 giây. Ly tâm 12000 vòng trong 2 phút ở 4oC để thu RNA tổng số. RNA đem ủ ở 4oC để dùng sau. *Những lƣu ý khi ly trích - Phải có khu vực làm việc riêng - Trong quá trình ly trích, phải thao tác càng nhanh càng tốt - Thay bao tay thƣờng xuyên khi thấy cần thiết Giai đoạn 2: Tổng hợp cDNA Mẫu RNA đƣợc ly trích ở trên sẽ đƣợc dùng để chạy RT-PCR. Mục đích để khuếch đại 1 đoạn gen mã hóa cho phân tử protein vỏ của virus PLRV. Quy trình này gồm hai bƣớc (two steps). Bƣớc 1: Tổng hợp cDNA Tổng hợp cDNA theo hƣớng dẫn của bộ kit tổng hợp cDNA (iScript cDNA kit). Thành phần các loại hóa chất cho 1 phản ứng tổng hợp cDNA đƣợc cho theo bảng dƣới đây. Đối với lƣợng RNA cho vào ta thay đổi thể tích từ 2 - 5 µl trong một phản ứng. Bảng 3.5 Thành phần hóa chất cho một phản ứng tổng hợp cDNA Thành phần Thể tích 5X iScript reaction Mix Enzyme RNA Nƣớc 4 µl 1 µl 5 µl (1 - 5 µg) Cho vào để đủ 20 µl Tổng thể tích 20 µl 24 Chu kỳ nhiệt của phản ứng tổng hợp cDNA 25 oC trong 5 phút 42 oC trong 30 phút 85 oC trong 5 phút Giữ ở 4oC cDNA đƣợc tổng hợp (20 µl) có thể đem sử dụng ngay trong phản ứng PCR hoặc cất ở 4oC để chạy PCR sau. Bƣớc 2: Thực hiện phản ứng PCR khuếch đại cDNA Bƣớc này ta không sử dụng kit mà thực hiện theo nghiên cứu của Fattouma DJILANI và Hatem FAKHFAKH ở đại học Tuynidi vào năm 2002. Thành phần hóa chất cho một phản ứng 25 µl đƣợc cho theo bảng dƣới đây Bảng 3.6 Thành phần hóa chất trong một phản ứng khuếch đại cDNA Thành phần Nồng độ cuối Dung dịch đệm PCR 10X MgCl2 Hỗn hợp dNTP (dNTP Mix) Mồi xuôi (sens primer) Mồi ngƣợc (antisens primer) iTaq polymerase cDNA Nƣớc 1X 1 mM 0,2 mM 0,3 µM 0,3 µM 1 U/µl 2,5 - 5 µl Cho vào để đủ 25 µl Tổng thể tích 25 µl Chu trình nhiệt của phản ứng PCR - 94 oC trong 5 phút - 94 oC trong 1 phút - 50 oC trong 1 phút 35 chu kỳ - 72 oC trong 1 phút - 72 oC trong 10 phút Lƣợng cDNA cho vào mỗi phản ứng thay đổi từ 2,5 – 5 µl. Sau khi thực hiện phản ứng PCR, ta sẽ thu đƣợc 25 µl sản phẩm (cDNA sợi đôi). Ta có thể thực hiện điện di ngay để xem kết quả hoặc cũng có thể trữ ở -20oC để chạy điện di sau. *Điện di đọc kết quả 25 Để kiểm tra sản phẩm RT-PCR có phải là đoạn gen mong muốn không ta thực hiện điện di trên gel agarose. Nồng độ gel: 1,5% Hiệu điện thế: 50 V Cƣờng độ dòng điện: 250 mA Thời gian điện di: 45 phút (có thể canh vạch loading dye) Tỷ lệ mẫu : loading dye là 4 µl : 2 µl Nhuộm ethidium bromide trong 20 phút Đọc kết quả trên máy chiếu tia UV. 3.3.3.3 Giải trình tự trực tiếp đoạn gen của virus PLRV Sau khi kiểm tra kết quả bằng điện di nếu thấy có đoạn gen mong muốn (kích thƣớc 336 bp), chúng tôi thực hiện tiếp bƣớc giải trình tự nhằm xác định chính xác đoạn gen của PLRV và khẳng định có sản phẩm phụ hay không. Việc giải trình tự tiến hành trực tiếp từ sản phẩm RT-PCR, theo nguyên tắc của Sanger. Phƣơng pháp này sử dụng một primer (hoặc sense hoặc antisense) cho một lần giải trình tự. Trong đề tài này, ta sẽ tiến hành giải trình tự bằng cả primer sense lẫn antisense. Bƣớc 1: Chạy cycle sequencing - Thành phần hóa chất cho 1 phản ứng Bigdye 2,5X 2 µl Bigdye buffer 5X 1 µl Sản phẩm PCR 3 - 10 ng Primer 3,2 pmol Nƣớc cho vào để đƣợc thể tích 10 µl Bigdye 2,5X bao gồm: enzyme kéo dài mẫu, buffer, dNTP và ddNTP. -Mỗi phản ứng chỉ sử dụng hoặc là primer xuôi hoặc là primer ngƣợc Quy trình nhiệt 96 oC trong 1 phút 96 oC trong 10 giây 50 oC trong 5giây 25 chu kỳ 60 oC trong 4 phút 26 Bƣớc 2: Làm sạch sản phẩm cycle sequencing - Cho 2,5 µl / tube EDTA 125 mM vào. - Cho 30 µl / tube ethanol 100% vào, đảo nhẹ. - Để ở nhiệt độ phòng 15 phút - Ly tâm 12000 vòng trong 30 phút ở 4oC - Loại dịch trong - Cho 30 µl / tube ethanol 70% vào - Ly tâm 12000 vòng trong 20 phút ở 4oC - Hút bỏ dịch trong và để khô. Bƣớc 3: Biến tính - Cho vào mỗi tube 10 µl Hidi formamide. - Biến tính ở 95oC trong 2 phút - Đƣa nhanh vào đá Sau đó cho 10 µl mẫu này vào máy giải trình tự. Bƣớc 4: Đọc kết quả Kết quả giải trình tự sẽ ở dạng peak (mỗi peak đại diện cho 1 nucleotide) và dạng ký tự (A, T, G, C). Sau khi có trình tự ta tiến hành kiểm tra bằng cách so sánh trình tự giải đƣợc với trình tự có sẵn trên ngân hàng gen (NCBI). Qua đây ta sẽ biết đƣợc trình tự giải đƣợc có phải là virus PLRV không và biết đƣợc mức độ tƣơng đồng giữa trình tự ta có với trình tự trên ngân hàng gene. 27 PHẦN 4. KẾT QUẢ VÀ THẢO LUẬN 4.1 Tình hình canh tác khoai tây tại Thành phố Đà Lạt Thời gian điều tra từ ngày 21 tháng 3 đến ngày 23 tháng 3 năm 2005. Tại thời điểm điều tra đang là mùa nắng - mùa chính để trồng khoai tây. Địa điểm điều tra gồm các phƣờng 5, 8, 9, 11 và 12. Diện tích điều tra tại phƣờng 5 là 1 hecta, phƣờng 8 là 1 hecta, phƣờng 9 là 1,6 hecta, phƣờng 11 là 0,6 hecta và phƣờng 12 là 1 hecta. Hai giống khoai tây đƣợc trồng chủ yếu tại các phƣờng trên là 06 và 07 nuôi cấy mô, giống 07 đƣợc trồng trên nền đất thịt còn giống 06 đƣợc trồng ít hơn trên nền đất xốp. Vào khoảng thời gian này, khoai tây đang ở các độ tuổi từ 1 đến 3 tháng tuổi, phần lớn các ruộng khoai tây đang ở giai đoạn sắp thu hoạch (tháng thứ 3). Điều kiện khí hậu lúc này là nắng nóng và khô hạn kéo dài. 100% ruộng khảo sát đều hiện diện ruồi đục lá và các loại rệp. 100% các ruộng đều canh tác theo cách lên luống và trồng hàng một, không trồng xen với các loại cây trồng khác. Đa số các ruộng khoai tây ở giai đoạn chuẩn bị thu hoạch nên việc quan sát triệu chứng của các bệnh là rất khó khăn. Tuy nhiên các bệnh thƣờng gặp là héo xanh, bã trầu, cuốn lá. Sự quan tâm cũng nhƣ nhận thức về bệnh virus và sự nguy hại do bệnh virus của nông dân là rất hạn chế. Do điều kiện thời tiết bất lợi nên năng suất dự kiến sẽ bị giảm và ƣớc tính khoảng 1,5 – 2,5 tấn / hecta. 4.2 Kết quả phát hiện virus PVX, PVY và PLRV bằng kỹ thuật ELISA 4.2.1 Tỷ lệ nhiễm virus PVX, PVY và PLRV tại các phƣờng Với khí hậu mát lạnh, khu vực Đà Lạt có điều kiện đặc biệt thuận lợi trồng khoai tây hầu nhƣ quanh năm. Theo thống kê của phòng nông nghiệp, tổng diện tích trồng khoai tây tại Đà Lạt là 856 ha với năng suất 98 tạ / ha đạt sản lƣợng 8425 tấn (năm 2004). Đà Lạt đƣợc xem là địa phƣơng có kỹ thuật canh tác rất cao, ngƣời dân đã biết áp dụng các kỹ thuật hiện đại, các loại chế phẩm sinh học, công nghệ nuôi cấy mô, sử dụng nhà kính từ nhiều năm nay. Trong đó các phƣờng 8, phƣờng 9 và phƣờng 12 đƣợc xem là những khu vực có kỹ thuật canh tác tƣơng đối vƣợt trội. Tuy nhiên kết quả thực tế về tình hình nhiễm các loại virus PVX, PVY và PLRV rất bất ngờ và đáng lo ngại. Dƣới đây là kết quả kiểm tra tỷ lệ nhiễm các loại virus PVX, PVY và PLRV tại các phƣờng đƣợc điều tra. 28 Bảng 4.1 Tỷ lệ nhiễm PVX ,PVY, PLRV tại các phƣờng -Từ số liệu trên ta có biểu đồ dƣới đây - Qua kết quả này ta thấy tất cả các phƣờng đƣợc điều tra tại thành phố Đà Lạt đã bị nhiễm PVX, PVY, PLRV. Trong đó, mức độ nhiễm trung bình PVX (41,75%) là thấp nhất còn PVY (97,58%) và PLRV (98,79%) là rất cao. - Tại Việt Nam virus PVY đƣợc xem là loại virus gây hại nghiêm trọng nhất tiếp đến là PVX (Lê Lƣơng Tề - Vũ Triệu Mân, 1999). Trong kết quả này tỷ lệ nhiễm PVY là rất cao, nhiễm PVX cũng khá cao. Chính vì vậy ta cần phải đƣa ra các biện pháp phòng trừ thích hợp nhằm ngăn chặn sự lây lan và tác hại của các loại virus trên. - Tại phƣờng 12, đa số các mẫu lấy tại đây đều chỉ ở F1 hoặc F2 nhƣng lại có tỷ lệ nhiễm các loại virus là cao nhất. Nguyên nhân có thể là nguồn gốc giống không đảm bảo (giống không sạch bệnh). - Các mẫu không biểu hiện triệu chứng của bệnh cũng cho kết quả dƣơng tính. Điều này chứng tỏ một điều là ta không thể dựa hoàn toàn vào triệu chứng mà định bệnh. Địa phƣơng lấy mẫu PVX PVY PLRV Tổn g số mẫu Số mẫu nhiễm Tỷ lệ (%) Tổng số mẫu Số mẫu nhiễm Tỷ lệ (%) Tổng số mẫu Số mẫu nhiễm Tỷ lệ (%) P5 32 18 56,25 33 30 90,91 33 32 96,97 P8 23 4 17,39 23 23 100 23 23 100 P9 33 7 21,21 33 32 96,97 33 32 96,97 P11 17 7 41,18 18 18 100 17 17 100 P12 22 16 72,73 21 21 100 22 22 100 Trung bình 41,75 97,58 98,79 Biểu đồ 4.1 So sánh tỷ lệ nhiễm PVX, PVY và PLRV theo từng phƣờng 0 20 40 60 80 100 PVX PVY PLRV Virus Tỷ lệ (% ) P5 P8 P9 P11 P12 29 4.2.2 Tỷ lệ nhiễm virus PVX, PVY và PLRV theo từng giống Bảng 4.2 Tỷ lệ nhiễm PVX, PVY và PLRV theo giống Giốn g PVX PVY PLRV Tổn g số mẫu Số mẫu nhiễm Tỷ lệ (%) Tổn g số mẫu Số mẫu nhiễm Tỷ lệ (%) Tổn g số mẫu Số mẫu nhiễm Tỷ lệ (%) 07 06 104 22 39 12 37,50 54,54 103 23 103 20 100 86,96 104 23 102 16 98,08 69,57 Từ bảng ta có biểu đồ dƣới đây - Qua bảng và biểu đồ ta thấy có sự khác biệt về mức độ nhiễm bệnh của hai giống khoai tây 06 và 07. Giống 06 cho tỷ lệ nhiễm với PVX cao hơn so với giống 07. Còn đối với PVY và PLRV thì giống 07 lại cho kết quả nhiễm cao hơn giống 06. Hai giống 06 và 07 là giống nhập nội nên có tỷ lệ nhiễm PLRV ở mức độ cao (Lê Lƣơng Tề - Vũ Triệu Mân, 1999). - Giống 07 đƣợc cho là có khả năng kháng bệnh cao. Tuy nhiên qua kết quả trên ta thấy giống 07 không tỏ ra ƣu thế trong việc kháng lại các loại virus trên so với giống 06. Vấn đề ở đây là yếu tố môi trƣờng và cách chăm sóc cũng tác động rất lớn đến khả năng nhiễm virus của các giống khoai tây. Tuy nhiên cũng có thể do lƣợng mẫu kiểm tra không đủ để phản ánh tỷ lệ nhiễm thực sự của giống 06. Do đó tùy từng điều kiện cụ thể mà ta nên trồng giống 06 hay 07 tuy nhiên dù trồng giống 06 hay 07 thì khâu sản xuất giống sạch bệnh hay kháng bệnh là quan trọng nhất. Giống 06 và 07 đƣợc trồng bằng cây nuôi cấy mô. Theo Lê Lƣơng Tề và Vũ Triệu Mân (1999), những cây con giống có thể bị nhiễm bệnh từ 90 đến 100% ở các mức độ khác nhau nếu nhƣ tế bào ban đầu đem nuôi cấy đã bị nhiễm virus. Biểu đồ 4.2 So sánh tỷ lệ nhiễm bệnh giữa hai giống 06 và 07 0 20 4 60 80 100 PVX PVY PLRV Virus Tỷ lệ (% ) 07 06 30 4.2.3 Tỷ lệ nhiễm virus PVX, PVY và PLRV theo từng thế hệ Bảng 4.3 Tỷ lệ nhiễm virus PVX, PVY và PLRV theo từng thế hệ của giống 07 Thế hệ PVX PVY PLRV Tổn g số mẫu Số mẫu nhiễm Tỷ lệ (%) Tổn g số mẫu Số mẫu nhiễm Tỷ lệ (%) Tổn g số mẫu Số mẫu nhiễm Tỷ lệ (%) F1 F2 F3 53 45 6 22 12 5 41,5 1 26,6 7 83,3 3 51 44 28 50 44 28 98,0 4 100 100 54 44 6 53 44 6 98,1 5 100 100 Từ bảng ta có biểu đồ Kết quả cho thấy, ở thế hệ sau tỷ lệ nhiễm virus cao hơn ở thế hệ trƣớc. Điều này hoàn toàn chính xác, đặc biệt với virus PLRV sự tái nhiễm ở vụ thứ hai hoặc thứ ba từ 69 – 90% (Vander Zang, 1983). Riêng đối với PVX thì thế hệ sau nhiễm ít hơn thế hệ trƣớc, có thể lý giải dựa vào điều kiện canh tác tốt đồng thời khí hậu khắc nghiệt của mùa nắng không thuận lợi cho sự phát triển và lây truyền của virus PVX. - Đối với PVY – virus gây hại quan trọng ở Việt Nam và PLRV cho tỷ lệ nhiễm rất cao ngay ở thế hệ F1. Điều này chứng tỏ nguồn cây giống (nuôi cấy mô) đã bị nhiễm bệnh từ đầu chứ không phải sạch bệnh nhƣ lời công bố của các nhà cung cấp giống. Qua đây ta rút ra kinh nghiệm là không nên để giống quá dài, bởi vì giống dễ bị thoái hóa và khả năng nhiễm các loại virus trên là rất cao ảnh hƣởng đến năng suất và chất lƣợng khoai tây. 0 10 20 30 40 50 60 70 80 90 100 PVX PVY PLRV Virus Tỷ lệ (% ) F1 F2 F3 Biểu đồ 4.3 So sánh tỷ lệ nhiễm bệnh giữa các thế hệ của giống 07 31 4.2.4 Tỷ lệ nhiễm virus PVX, PVY và PLRV theo tháng tuổi Bảng 4.4 Tỷ lệ nhiễm virus PVX, PVY và PLRV theo từng tháng tuổi Tuổi PVX PVY PLRV Tổng Số mẫu Số mẫu nhiễm Tỷ lệ (%) Tổng Số mẫu Số mẫu nhiễm Tỷ lệ (%) Tổng Số mẫu Số mẫu nhiễm Tỷ lệ (%) 1T 1,5T 2T 2,5T 3T 5 10 19 5 65 1 9 8 3 18 20 90 42,11 60 27,69 5 10 18 5 65 5 10 17 5 65 100 100 94,44 100 100 5 9 7 5 66 5 9 7 5 66 100 100 100 100 100 Từ bảng ta có biểu đồ Nhận xét - Không có sự khác biệt giữa các độ tuổi về tỷ lệ nhiễm PVY và PLRV. Từ 1 tháng đến 3 tháng tỷ lệ nhiễm luôn ở mức cao. Điều này chứng tỏ các giống đƣợc trồng có thể đã bị thoái hóa và nguồn cung cấp giống đã bị nhiễm từ ban đầu. - Đối với PVX, có sự thay đổi bất thƣờng, thời điểm 1,5 tháng cho tỷ lệ nhiễm cao nhất (90%), thấp nhất là lúc 1 tháng. - Sự hiện diện tƣơng đối nhiều các loại côn trùng nhƣ ruồi, rệp ở các ruộng khoai tây đƣợc khảo sát cũng là một nguyên nhân dẫn đến sự nhiễm các loại virus ở mức độ cao. 4.3 Kết quả RT-PCR - Dùng kit ly trích RNA do Bio - Rad cung cấp ta thu đƣợc 80 µl RNA tổng số. - Ta sẽ thu đƣợc 20 µl cDNA sau khi thực hiện phản ứng tổng hợp cDNA. Thành phần và quy trình nhiệt của phản ứng tổng hợp cDNA (theo hƣớng dẫn của kit tổng hợp 0 20 40 60 80 100 PVX PVY PLRV Virus Tỷ lệ (% ) 1T 1,5T 2T 2,5T 3T Biểu đồ 4.4 So sánh tỷ lệ nhiễm giữa các lứa tuổi 32 cDNA - iScript cDNA kit). Kết quả thu đƣợc ở lần chạy RT - PCR thứ 3 và có đƣợc những thông số nhƣ sau: Bảng 4.5 Kết qủa thành phần hóa chất cho một phản ứng tổng hợp cDNA Thành phần Thể tích 5X iScript reaction Mix Enzyme RNA Nƣớc 4 µl 1 µl 5 µl 10 µl - Lƣợng RNA thích hợp cho phản ứng tổng hợp cDNA là 5 µl. Quy trình nhiệt của phản ứng tổng hợp cDNA phải thay đổi so với kit (tăng thời gian của giai đoạn 42oC từ 30 phút lên 40 phút). Chu kỳ nhiệt trong phản ứng tổng hợp cDNA 25 oC trong 5 phút 42 oC trong 40 phút 85 oC trong 5 phút Giữ ở 4oC - Nồng độ hóa chất phù hợp hợp với quy trình đã nêu, kết quả thu đƣợc không có sự hiện diện của sản phẩm phụ. Lƣợng cDNA thích hợp cho phản ứng PCR là 5 µl. Bảng 4.6 Kết qủa thành phần hóa chất trong một phản ứng khuếch đại cDNA Thành phần Nồng độ cuối Dung dịch đệm PCR 10X MgCl2 Hỗn hợp dNTP (dNTP Mix) Mồi xuôi (sens primer) Mồi ngƣợc (antisens primer) iTaq polymerase Nƣớc 1X 1 mM 0,2 mM 0,3 µM 0,3 µM 1 U / µl Cho vào để đủ 25 µl Tổng thể tích 25 µl - Kết quả cũng cho thấy quy trình nhiệt là ổn định. Chu trình nhiệt trong phản ứng PCR - 94 oC trong 5 phút - 94 oC trong 1 phút - 50 oC trong 1 phút 35 chu kỳ 33 - 72 oC trong 1 phút - 72 oC trong 10 phút *Kết quả điện di - Do genome của PLRV không có đuôi poly A, lƣợng cDNA chỉ đƣợc tạo ra từ sự kéo dài các hexamer primer (không có cDNA tạo ra từ primer oligo dT) . Điều này chứng tỏ phản ứng PCR rất nhạy và hiệu quả khuếch đại rất cao. - Sản phẩm RT - PCR từ quy trình có sử dụng Taq của hãng Bio-rad cho kết quả rất chuẩn. Điều này đƣợc chứng minh bằng kết quả giải trình tự có đƣợc mà không cần tinh sạch sản phẩm RT-PCR. - Cặp primer đã sử dụng có độ đặc hiệu rất cao, chỉ cho đúng 1 band ở vị trí 336 bp trên gel điện di. Điều này cho phép khẳng định mẫu này đã bị nhiễm virus PLRV. - Tuy nhiên kết quả trên vẫn còn chƣa thuyết phục lắm. Tức là khả năng tồn tại những đoạn DNA ngoại lai vẫn có thể xảy ra. Do đó để chắc chắn rằng đây là đoạn gen của PLRV ta thực hiện giải trình tự, sau đó so sánh trên ngân hàng gen để có kết luận cuối cùng. L1: Thang DNA chuẩn 100 bp L2, L3: cDNA của mẫu 10 (P12) L2: Nồng độ Taq polymerase 1,25 U L3 : Nồng độ Taq polymerase 1 U 336bp Hình 4.1 Kết quả điện di cDNA của virus PLRV 34 4.4 Kết quả giải trình tự trực tiếp sản phẩm RT-PCR Kết quả giải trình tự sẽ cho ta trình tự dạng chữ (A, G, T, C) và trình tự dạng peak. Trình tự giải từ sens primer đƣợc tổng cộng 314 / 336 nucleotic : GGGGTAGGTAGGACCCTGTGGCACCCAGGCGCCGAAGACGCAGAAGAGGAGGCAATCGCCGCTCTACGAAGAACTGGAGTTCCCCG AGGACGAGGCTCAAGCGAGACATTCGTGTTTACAAAGGACAACCTCGTGGGCAACACCCAAGGAAGTTTCACCTTCGGGCCGAGTCT ATCAGACTGTCCGGCATTCAAGGATGGAATACTCAAGGCCTACCATGAGTATAAGATCACAAGCATCTTACTTCAGTTCGTCAGCGAG GCCTCTTCCACCTCCTCCGGTTCCATCGCTTATGAGTTGGACCCCCATTGCAA Kết quả giải trình tự bằng Antisense primer đƣợc 308 / 336 nucleotic: CTAGAGGAGGAGGTGGAGAGGCCTCGCTGACGAACTGAAGTAAGATGCTTGTGATCTTATACTCATGGTAGGCCTTGAGTATTCCATCC TTGAATGCCGGACAGTCTGATAGACTCGGCCCGAAGGTGAAACTTCCTTGGGTGTTGCCCACGAGGTTGTCCTTTGTAAACACGAATGT CTCGCTTGAGCCTCGTCCTCGGGGAACTCCAGTTCTTCTTGAGCGGCGATTGCCTCCTCTTCTGCGTCTTCGGCGCCTGGGTTGCCCAGG GGCCGTGACCATAACCACTGGC TGAACTCTGT TAGCGCGA Dùng phần mềm CLUSTAL X để so sánh hai trình tự giải đƣợc. Kết quả so sánh sẽ cho thấy những vị trí tƣơng đồng và không tƣơng đồng trên đoạn gen đó. Vị trí các nucleotide tƣơng đồng đƣợc đánh dấu “ * ”, không tƣơng đồng dấu “ - ”. Những Hình 4.3 Kết quả giải trình tự dạng peak bằng Antisense primer Hình 4.2 Kết quả giải trình tự dạng peak bằng Sense primer 35 nucleotide tại các vị trí không tƣơng đồng (thƣờng ở đoạn đầu), ta sẽ kết hợp với trình tự dạng peak để hoàn chỉnh đoạn gen mong muốn. Dƣới đây là kết quả so sánh trình tự giải đƣợc từ 2 primer. *: Trình tự tƣơng đồng -: Trình tự không tƣơng đồng anti: Trình tự giải đƣợc nhờ Antisense primer Sens: Trình tự giải đƣợc nhờ Sense primer Trình tự hoàn chỉnh của đoạn gen mong muốn sẽ có tổng số 339 nucleotic, trong đó có 3 nucleotide loại A, 1 ở đầu 3’ và 2 đầu 5’. Sở dĩ có thêm 3 nucleotic trên là do kết quả của phản ứng PCR (Dr. Mchael blader). Dƣới đây là trình tự cDNA hoàn chỉnh của PLRV sau khi đối chiếu kết quả giải trình tự dạng peak và dạng chữ từ hai primer Sense và Antisense. Hình 4.4 So sánh kết quả giải trình tự từ 2 primer 36 Kết quả so sánh trên ngân hàng gen với độ tƣơng đồng 100% . Nhƣ vậy trình tự ta có đƣợc là chính xác đồng thời kết quả này cũng khẳng định đây chính là đoạn gen của PLRV và mẫu đƣợc kiểm tra đã bị nhiễm virus PLRV chứ không phải virus nào khác. Ngoài ra cũng khẳng định đƣợc rằng tại Đà Lạt không hề có bất kỳ đột biến nào ở đoạn gene trên. Kết quả giải trình tự bằng Antisense primer Hình 4.5 Trình tự sợi Sense của đoạn cDNA của PLRV Hình 4.6 Kết quả so sánh trình tự sản phẩm PCR của PLRV trên ngân hàng gen (Query: Trình tự của sản phẩm PCR; Sbjct: Trình tự có sẵn trên ngân hàng gen) 37 PHẦN 5. KẾT LUẬN VÀ ĐỀ NGHỊ 5.1 Kết luận Từ các kết quả thu đƣợc tôi xin rút ra một số kết luận nhƣ sau: - Tất cả các phƣờng, các giống, các thế hệ đƣợc điều tra đều đã bị nhiễm virus PVX, PVY, PLRV sau khi kiểm tra bằng kỹ thuật ELISA. - Giống 06 nhiễm virus PVY và PLRV ít hơn giống 07, nhƣng lại nhiễm PVX cao hơn giống 07. - Càng về các thế hệ sau thì tỷ lệ nhiễm các loại virus PVY, PLRV càng tăng. - Không có sự khác biệt về mức độ nhiễm các virus trên ở các độ tuổi khác nhau. - Đã phát hiện đƣợc virus PLRV trên khoai tây nhờ phản ứng RT-PCR khuếch đại đoạn gene mã hóa cho protein vỏ (336 bp). - Kết quả giải trình tự sản phẩm RT-PCR của virus PLRV cho kết quả tƣơng đồng 100% với trình tự của virus PLRV trên ngân hàng gen. 5.2 Đề nghị - Ứng dụng các kỹ thuật ELISA, RT-PCR và giải trình tự rộng rãi hơn trong việc chẩn đoán virus trên khoai tây. - Cần nghiên cứu sâu thêm các yếu tố (giống, thế hệ, tuổi) ảnh hƣởng đến sự nhiễm các loại virus kể trên. - Cần tiến hành thực nghiệm trên số lƣợng mẫu lớn hơn với số lần lặp lại nhiều hơn để khẳng định độ chính xác và ổn định của quy trình chẩn đoán bằng RT – PCR. - Tìm các khung đọc (ORF) có thể có dựa trên trình tự đoạn gen giải đƣợc nhằm hiểu rõ hơn về đoạn gen trên. 38 PHẦN 6. TÀI LIỆU THAM KHẢO Tài liệu tiếng việt 1. Nguyễn Thị Chính - Ngô Tiến Hiển, 2001. Virút học. Nhà xuất bản ĐHQG Hà Nội. 2. Đƣờng Hồng Dật. Khoa học bệnh cây. Nhà xuất bản nông nghiệp. 3. Hồ Hùynh Thùy Dƣơng. Sinh học phân tử, 1998. NXB giáo dục 4. Mai Thạch Hoành (chủ biên) - Nguyễn Công Vinh, 2003. Giống và kỹ thuật thâm canh cây có củ. Nhà xuất bản nông nghiệp Hà Nội. 5. Vũ Triệu Mân-Hội sinh học phân tử bệnh lý thực vật Việt Nam, 2003. Chẩn đoán nhanh bệnh hại thực vật. NXB Hà Nội. 6. Z-Kiraly, Z Klement-F.Solymosy-J.Voros, Vũ Khắc Nhƣợng- Hà Minh trung dịch, 1983. Những phương pháp nghiên cứu cây. NXB nông nghiệp Hà Nội. 7. Nguyễn Văn Sơn, 2003. Một số sâu bệnh chính hại rau ở Lâm Đồng và các biện pháp phòng trừ tổng hợp. Chi cục bảo vệ thực vật Lâm Đồng. 8. Lê Lƣơng Tề - Vũ Triệu Mân, 1999. “Bệnh vi khuẩn và virus hại cây trồng”. NXB Giáo Dục. 9. Nguyễn Văn Thắng – Bùi Thị Mỹ, 1996.”Kỹ thuật trồng cà chua, khoai tây, hành tây và tỏi ta”. NXB Nông nghiệp Hà Nội. 10. Phạm Đức Toàn, 2001. Sử dụng kỹ thuật ELISA để chẩn đoán bệnh Tristeza trên cây cam quýt tại quận 9 TP. Hồ Chí Minh. Luận văn tốt nghiệp kỹ sƣ nông học, Đại học Nông lâm TP. Hồ Chí Minh, Việt Nam. 11. Nguyễn Văn Tuất, 2002. Kỹ thuật chẩn đoán và giám định bệnh hại cây trồng. NXB nông nghiệp Hà Nội. 12. Phạm Văn Ty - Đại học quốc gia Hà Nội, 2001. Miễn dịch học. NXB Đại học quốc gia Hà Nội. 13. Bùi Trang Việt, 2000. Sinh lý thực vật đại cương dinh dưỡng. Đại học quốc gia tp. Hồ Chí Minh. Trƣờng Đại học Khoa Học Tự Nhiên. 39 Tài liệu tiếng nƣớc ngoài 14. Ahmed M. Soliman, Hamed Mazyad and Ahmad Shalaby, 2002. Virus detection: Potato leaf roll virus Agriculture Research Center, Giza, Egypt. 15. Joe O’Connell, 2002. Methods in moleculer biologyTM. Volume 193 (RT-PCR protocol). Humana Press. Totowa, New Jersey. 16. John R. Crowther, 2001. Methods in moleculer biology TM . Volume 149 (The ELISA guidebook). Humana Press. Totowa, New Jersey. 17. Jay A.Levy., Heinz Fraenkel-conrat.,Robert A. Owen. Virology, 1994. Prentice-Hall, Inc. 18. Kamil Haliloglu and Hidayet Bostan, 2002. Nucleotide sequence analysis for assessment of variability of potato leafroll virus and phylogenetic comparisions. Online journal of biological sciences 2 (9): 582 – 586. 19. M. J. McPherson and S. G. Moller. PCR, 2000. BIOS Scientific Publishers Limited. 20. Sambrook and Russell.Molecular cloning-A laboratory manual. Volume 2. 3 rd edition, 2001. Cold spring harbor laboratory press, New York. 21. S. B. Ghosh, L. H. S. Nagi, T. R. Ganapathi, S. M. Paul Khurana and V. A. bapat, 2002. Clone and sequencing potato virus Y coat protein gene from an Indian isolate and development of transgenic tobacco for PVY resistance, 2002. Current Science, vol. 82, NO 7. 22. W. J. Hooker. Compendium of potato diseases, 1981. American Phytopathological Society. Các trang web --> 40

Các file đính kèm theo tài liệu này:

  • pdfKhoa luan tot nghiep.pdf
Luận văn liên quan