Nghiên cứu xạ khuẩn thuộc chi Streptomyces sinh chất kháng sinh chống nấm gây bệnh trên cây chè ở Thái Nguyên

Dựa trên kết quả điện di hình 3.14 cho thấy cả 2 chủng xạ khuẩn Đ1 và R2 đều có sự nhân lên của gen 16S - rRNA . Sản phẩm PCR có độ đặc hiệu cao, không có các sản phẩm phụ. Mặt khác, dựa trên DNA maker chuẩn cho thấy sản phẩm PCR có kích thước khoảng 1,5 kb tương ứng với kích thước theo tính toán lý thuyết trong quá trình lựa chọn mồi.

pdf78 trang | Chia sẻ: lylyngoc | Ngày: 07/11/2013 | Lượt xem: 3145 | Lượt tải: 10download
Bạn đang xem nội dung tài liệu Nghiên cứu xạ khuẩn thuộc chi Streptomyces sinh chất kháng sinh chống nấm gây bệnh trên cây chè ở Thái Nguyên, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
- 1ml; Thạch - 20; Nước cất - 1lit; pH 7,2 - 7,4. * Môi trường ISP - 9 (g/l) (NH4)2SO4 - 2,64; KH2PO4 - 2,38; K2HPO4 - 5,65; MgSO4 - 1; dung dịch muối B - 1ml; nguồn cacbon - 10; thạch - 20; H2O - 1lít; pH 6,8 - 7. - Dung dịch muối A (%): FeSO4 - 0,1; ZnSO4 - 0,15; MnCl2 - 0,1; Nước cất - 100ml. - Dung dịch muối B (%): CuSO4 - 0,64; FeSO4 - 0,11; MgCl2 - 0,79; nước cất - 100ml. * Môi trường 79 (g/l) Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -27- Glucoza -10; peptone -10; cazein thủy phân - 2; cao nấm men - 2; NaCl - 6, K2HPO4 - 0,2; thạch - 18; H2O - 1lít; pH 7 - 7,4. * Môi trường A4 - H (g/l) Glucoza - 15; bột đậu tương - 15; NaCl - 5; CaCO3 - 1; H2O - 1lít; pH 7. * Môi trường A - 4 (g/l) Glucoza - 10; bột đậu tương - 10; NaCl - 5; CaCO3 - 1; H2O - 1lít; pH 7. * Môi trường Tinh bột (g/l) Tinh bột - 20; K2HPO4 - 0,5; MgSO4 - 0,5; KNO3 - 1; NaCl - 0,5; FeSO4 - 0,01; Agar - 30,0; Nước - 1 lít; pH 7,2 - 7,4. * Môi trường Czapek Glycerin (g/l) Glycerin - 30,0; NaNO3 - 2,0; K2HPO4 - 1.0; MgSO4 - 0,5; KCl - 0,5; FeSO4 - 0,01; Agar - 20,0; Nước - 1 lít. * Môi trường Czapek Gluco (g/l) Gluco - 30,0; NaNO3 - 2,0; K2HPO4 - 1.0; MgSO4 - 0,5; KCl - 0,5; FeSO4 - 0,01; Agar - 20,0; Nước - 1 lít. 2.2 Phƣơng pháp nghiên cứu 2.2.1. Phƣơng pháp phân lập nấm gây bệnh từ các mẫu chè Chọn các mẫu chè có triệu chứng điển hình, mới. Rửa mẫu bệnh sạch đất cát dưới vòi nước,cắt chọn mảnh mô bệnh thích hợp. Khử trùng bề mặt các mảnh mô trên bằng cồn (etanol 70%) trong vòng 3 phút. Rửa lại bằng nước cất vô trùng, thấm khô mảnh mô bằng giấy thấm vô trùng. Dùng dao mổ vô trùng cắt các mảnh mô trên thành các mảnh nhỏ 1 - 3mm (chứa cả phần mô bệnh và mô khỏe). Dùng panh vô trùng đặt các mảnh mô nhỏ trên vào môi trường Czapek trên đĩa petri. Ghi chú cẩn thận bằng bút viết kính: ngày, cây, bệnh.. Để đĩa môi trường đã đặt mẫu trong tủ ấm 30 0 C. Theo dõi sự phát triển của sợi nấm mọc ra từ mô bệnh. Khi nấm đã phát triển từ mô bệnh ra môi trường, lấy phần đỉnh sợi nấm chuyển sang môi trường thích hợp: PDA hoặc Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -28- CZ. Thu nhận giống thuần khiết trong ống thạch nghiêng và bảo quản trong tủ lạnh ở 4 0 C [14]. 2.2.2. Phân lập và tuyển chọn xạ khuẩn 2.2.2.1. Phân lập xạ khuẩn theo Vinogradski Cân 1g đất cho vào bình nón 50 ml chứa 9ml nước cất vô trùng, lắc trên máy lắc 30 phút. Dùng pipet vô trùng hút 0,5 ml d ịch đất sang ống nghiệm có chứa 4,5 ml nước vô trùng và tiếp tục pha loãng đến 10 -2 , 10 -3 ...10 -6 . Từ mỗi nồng độ pha loãng ở các nồng độ 10 -3 đến 10 -6 , nhỏ 0,1ml sang đĩa Petri chứa môi trường Gause - I. Dùng que gạt vô trùng chang đều, sau đó nuôi ở nhiệt độ phòng từ 4 - 7 ngày. Trên mỗi mẫu đất, khuẩn lạc của xạ khuẩn được cấy 3 pha sang đĩa Petri chứa môi trường Gause - I để làm sạch. Sau đó nuôi ở nhiệt độ phòng 4 - 7 ngày, từ các khuẩn lạc được làm sạch cấy truyền sang ống nghiệm chứa môi trường thạch nghiêng Gause - I, tiếp tục nuôi ở điều kiện trên trong 10 - 14 ngày [12]. Theo ISP màu sắc khuẩn ty khí sinh của các chủng xạ khuẩn được chia thành 8 nhóm màu: White (W) nhóm trắng, Gray (Gy) nhóm xám, Red (R) nhóm đỏ, Yellow (Y) nhóm vàng, Green (Gn) nhóm xanh, Blue (B) nhóm xanh da trời, Violet (V) nhóm tím, và nhóm màu không xác định (X) [16],[19], [42]. 2.2.2.2. Xác định hoạt tính kháng sinh Phương pháp thỏi thạch (dùng để sơ tuyển Xạ khuẩn) Xạ khuẩn được nuôi cấy trên môi trường ISP - 4 hoặc Gause - I trong đĩa petri sau 7 ngày dùng khoan nút chai khoan các thỏi thạch đặt vào đĩa petri đã cấy VSV kiểm định. Sau đó để vào tủ lạnh 4 - 5h cho CKS khuếch tán vào môi trường thạch sau đó để vào tủ ấm. VSV kiểm định nuôi ở 28 - 30 0 C, đọc kết quả sau vài ngày [7]. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -29- HTKS được xác định dựa vào kích thước vòng vô khuẩn (D - d, mm), D là kích thước vòng vô khuẩn và d là đường kính thỏi thạch. Phương pháp đục lỗ (Xác định hoạt tính kháng sinh trong dịch thể) Dùng khoan nút chai đục các lỗ trên môi trường thạch đã cấy VSV kiểm định trong đĩa petri. Nhỏ vào các lỗ khoan dung d ịch cần thử (các bước tiếp theo tiến hành như phương pháp thỏi thạch). Phương pháp khoanh giấy lọc (Xác định hoạt tính kháng sinh trong dung môi) Khoanh giấy lọc F8 có đường kính 6mm được tẩm một lượng dịch CKS (1ml/10 khoanh giấy lọc). Sau đó sấy khô ở 40 0 C, đặt khoanh giấy lọc đã tẩm CKS vào đĩa petri đã cấy VSV kiểm định (các bước tiếp theo giống phương pháp thỏi thạch). 2.2.2.3. Tuyển chọn các chủng xạ khuẩn sinh chất kháng sinh Từ ống thạch nghiêng giống đã hoạt hóa được cấy truyền sang các bình nón dung tích 250 ml chứa 100 ml môi trường Gause - I và nuôi lắc 220 vòng/ phút trong 48 giờ ở nhiệt độ phòng. Giống phát triển được cấy truyền với tỷ lệ 10% sang bình nón dung tích 250 ml chứa 80 ml môi trường Gause - I dịch thể. Quá trình lên men kéo dài 96 giờ ở nhiệt độ phòng trên máy lắc 220 vòng /phút. Sau đó thử HTKS trong dịch lọc [7]. 2.2.3. Bảo quản giống Các chủng xạ khuẩn đã lựa chọn được cấy trên môi trường thạch nghiêng Gause - I ở nhiệt độ phòng. Sau 10 - 14 ngày khi xạ khuẩn mọc tốt, các ống giống được bảo quản trong tủ lạnh ở 4 - 6 0 C. Sau 2 - 3 tháng cấy truyền lại một lần. Để bảo quản lâu giống được giữ trong ống cát, trong parafin lỏng vô trùng giữ lạnh sâu trong glycerin hoặc đông khô, bảo quản được 6 tháng đến 2 năm. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -30- 2.2.4. Nghiên cứu các đặc điểm sinh học và phân loại xạ khuẩn 2.2.4.1. Đặc điểm hình thái Quan sát màu sắc của hệ sợi khí sinh Dựa theo tài liệu của ISP, Gause và cộng sự (1983), xác định màu sắc của HSKS dựa vào bảng màu của Tresner và Bakus. Căn cứ vào màu sắc HSKS của các chủng mới phân lập để phân thành các nhóm màu theo Gause và cộng sự: White (W) nhóm trắng, Gray (Gy) nhóm xám, Red (R) nhóm đỏ, Yellow (Y) nhóm vàng, Green (Gn) nhóm xanh... Quan sát màu sắc của hệ sợi cơ chất Màu sắc của HSCC được xác định qua quan sát trực tiếp trên môi trường thạch đĩa hoặc thạch nghiêng và mô tả theo thang màu chuẩn của Bondarsev (1953), Tresner và cộng sự (1961). Quan sát cuống sinh bào tử Xạ khuẩn được nuôi cấy trên môi trường Gause - I có găm lamen nghiêng 45 0 trên bề mặt môi trường. Sau 7 - 9 ngày nuôi ở nhiệt độ phòng lấy ra quan sát hình dạng chuỗi sinh bào tử trên lamen dưới kính hiển vi quang học. Chuỗi sinh bào tử có các dạng thẳng hay hơi lượn sóng ký hiệu là RF (Rectiflexibiles), hình móc câu hay hình xoắn không hoàn toàn ký hiệu là RA (Retinaculiaperti) và xoắn hoàn toàn ký hiệu là S (Spirales) [33], [35], [41]. Quan sát bề mặt bào tử Dùng màng cacbon đặt trực tiếp lên bề mặt khuẩn ty khí sinh có bào tử, sau đó quan sát và chụp ảnh dưới kính hiển vi điện tử quét. Bào tử có các hình dạng: tròn, ovan, elíp, hình que [33]. Bề mặt bào tử xạ khuẩn có các dạng: Nhẵn ký hiệu là Sm (Smooth), dạng mụn cóc ký hiệu là Wa (Warty), dạng gai ký hiệu là Sp (Spiny) và dạng tóc ký hiệu là Ha (Hairy). Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -31- 2.2.4.2. Đặc điểm nuôi cấy Màu sắc khuẩn ty khí sinh, khuẩn ty cơ chất và sắc tố tan Xạ khuẩn được nuôi cấy trên môi trường: Gause - I, Gause - II, ISP - 1, ISP - 2, ISP - 3, ISP - 4, ISP - 5, ISP - 6, ISP - 7 ở nhiệt độ phòng. Sau 7, 14, 21 ngày lấy ra quan sát màu sắc KTKS, KTCC và sắc tố tiết ra môi trường [33], [37]. Sự hình thành sắc tố melanin Xạ khuẩn được nuôi cấy trên môi trường ISP - 6 ở nhiệt độ phòng. Bắt đầu quan sát màu của môi trường sau 24 giờ cho đến ngày thứ 14. Nếu sinh melanin, màu của môi trường sẽ chuyển từ màu vàng nhạt sang màu nâu đậm cho đến màu đen [33]. 2.2.4.3. Đặc điểm sinh lý - sinh hóa Khả năng sinh enzym ngoại bào - Chiết dịch enzym Thu enzym từ môi trường lỏng: xạ khuẩn sau khi được nuôi trên môi trường Gause II dịch thể sẽ được lọc bỏ sinh khối hoặc ly tâm ở 5000 vòng/ phút trong 15 phút, chiết dịch trong thì thu được enzym thô. - Xác định hoạt tính các enzym ngoại bào bằng phương pháp khuếch tán trên thạch với một trong các nguồn cơ chất sau: - Tinh bột tan (xác định hoạt tính amylaza) - Cazein (xác định hoạt tính proteaza) - CMC (xác định hoạt tính endoglucanaza). Chuẩn bị môi trường cơ chất - thạch gồm: 20g thạch + 2 - 10g cơ chất, pha môi trường trong 1000 ml nước. Thanh trùng ở 1 atm trong 30 phút. Đổ môi trường vào các đĩa Petri sao cho bề dày lớp thạch khoảng 3 mm. Dùng khoan nút chai đục lỗ (d = 10 mm) trên lớp thạch cách nhau 40 mm. Nhỏ 0,2 ml dung dịch enzym cần thử và 0,2 ml nước làm đối chứng, để ở tủ lạnh 4 0 C khoảng 4 giờ, sau đó đặt vào tủ ấm 30 0 C trong 24 giờ [23]. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -32- Hoạt tính enzym được xác định bằng giá trị D - d (mm). Sau khi nhuộm màu đỏ Công gô (cơ chất CMC), axit tricloaxetic (cơ chất casein) và thuốc thử Lugol (cơ chất tinh bột). Vùng cơ chất bị phân giải không bắt màu ở xung quanh lỗ thạch. Khả năng chịu muối Cấy xạ khuẩn trên môi trường thạch nghiêng ISP - 1 có bổ sung thêm NaCl với các nồng độ 0,5; 3; 7; 9; 11; 12 (%). Sau 7 - 10 ngày lấy ra quan sát sự sinh trưởng. Khả năng sử dụng các nguồn cacbon Xạ khuẩn được nuôi cấy trên môi trường ISP - 9 có bổ sung 1% các nguồn đường: Glucoza, maltoza, fructoza, lactoza, sacaroza.... Cách làm: Cân 1g đường, thanh trùng bằng đèn UV rồi bổ sung vào 100ml môi trường ISP - 9 còn nóng. Lắc cho tan đường rồi đổ vào đĩa Petri và nuôi cấy xạ khuẩn ở nhiệt độ 28 -30 0 C, sau 14 ngày quan sát sự sinh trưởng của các chủng và so sánh với đối chứng [33]. Trong đó môi trường có glucoza được coi là đối chứng dương (+) và môi trường không có đường được coi là đối chứng âm (-). - Nếu xạ khuẩn sinh trưởng mạnh bằng hoặc kém hơn đối chứng dương một ít: có khả năng sử dụng loại đường đó. ký hiệu là (+). - Nếu xạ khuẩn sinh trưởng mạnh hơn đối chứng dương, ký hiệu là (++). - Nếu xạ khuẩn sinh trưởng bằng đối chứng âm hoặc không mọc: không có khả năng sử dụng loại đường đó, ký hiệu là (-). - Nếu xạ khuẩn sinh trưởng tốt hơn đối chứng âm một ít nhưng kém hơn đối chứng dương nhiều, ký hiệu là (±). 2.2.5. Lên men tạo kháng sinh 2.2.5.1. Lựa chọn môi trường lên men thích hợp Xạ khuẩn được lên men trên các môi trường cơ bản (theo Porter) là: Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -33- A - 4, A - 4H, A - 9, ISP - 4, Gause - I và Gause - II. Sau 96 giờ nuôi cấy trên máy lắc 220 vòng/ phút ở nhiệt độ phòng. Xác định HTKS trong dịch lên men (phương pháp đục lỗ) và sinh khối (phương pháp khoanh giấy lọc) để chọn ra môi trường cơ bản phù hợp cho những nghiên cứu tiếp theo [34]. 2.2.5.2. Ảnh hưởng của nguồn cacbon Bổ sung nguồn cacbon (%): Tinh bột tan 1 và 2; glucoza - 1,5; lactoza - 1,5; sacaroza - 1,5; rỉ đường - 1,5; vào hỗn hợp dung dịch muối (dung d ịch muối A) đã bổ sung 0,2 % (NH4)2SO4. Bổ sung giống và lên men trên máy lắc tròn với tốc độ 220 vòng/ phút. Sau 96 giờ lên men xác định HTKS trong dịch lên men bằng phương pháp đục lỗ thạch. 2.2.5.3. Ảnh hưởng của nguồn Nitơ Bổ sung nguồn Nitơ (%): Cao nấm men, bột đậu tương, (NH4)2SO4 và KNO3 vào hỗn hợp dung dịch muối đã bổ sung thêm 1,5% glucoza. Sau đó bổ sung giống rồi lên men và thử HTKS bằng phương pháp đục lỗ. 2.2.6. Các phƣơng pháp sinh học phân tử trong phân lập gen 16S - rRNA 2.2.6.1. Tách chiết DNA của xạ khuẩn bằng đệm CTAB Nguyên tắc: Phá vỡ thành tế bào của xạ khuẩn nhờ lyzozym. Loại bỏ protein khỏi DNA nhờ các enzym protease K. Phân tách các thành phần của tế bào sau khi phá vỡ thành hai pha nhờ dung dịch đệm chlorofom: isoamyl alcohol (24:1): pha trên chứa cặn tế bào, pha dưới chứa axit nucleic. Sau cùng, DNA được tủa bằng ethanol tuyệt đối (đã được làm lạnh - 22), được làm khô và hòa tan trong đệm TE [39]. Tiến hành: Lấy 1,5ml dịch nuôi cấy tế bào đem ly tâm tốc độ 3000 vòng/ phút trong 30 phút để thu cặn tế bào. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -34- Hòa tan cặn tế bào trong 0,8 ml TE 25S, lắc đều bằng vontex. Bổ sung 40 µl lysozym, ủ ở 37 0 C trong 90 phút (nồng độ cuối cùng của lysozym là 2mg/ ml). Bổ sung 10 µl protease K, mix đều, thêm 60 µl 10% SDS, đảo nhẹ, ủ 1giờ ở nhiệt độ 55 0 C (nồng độ cuối cùng của protease K là 0,18mg/ml, SDS là 0,5%). Bổ sung 150 µl NaCl 5M, mix đều. Sau đó bổ sung 130 µl CTAB, mix đều, ủ 10 phút ở 55 0 C. Đặt ở nhiệt độ phòng 5 phút, chia đều ra 2 ống eppendorf mới. Sau đó bổ sung vào mỗi ống 700 µl chlorofom/ isoamyl alcohol, mix đều 15 phút. Ly tâm 9000 vòng/phút trong 20 phút để tách pha. Chuyển dịch pha trên sang các eppendorf mới và bổ sung 0,6V isopropanol, đảo nhẹ. Đặt trong tủ - 20 0 C trong 30 - 40 phút. Ly tâm 9000 vòng/phút, rửa tủa bằng etanol 70%. Hòa tan DNA trong 100 µl TE. 2.2.6.2. Khuếch đại gen rRNA - 16S bằng phản ứng PCR Nguyên tắc: PCR là phản ứng trùng hợp, cho phép khuếch đại một đoạn DNA cụ thể lên hàng triệu lần nhờ sự xúc tác của DNA polymerase chịu nhiệt. Enzym này có khả năng hoạt động ở nhiệt độ cao. Sự hoạt động của enzym được kiểm soát của một chu kỳ nhiệt xác định. Đoạn DNA được tổng hợp được giới hạn về mặt kích thước bởi một cặp mồi đặc hiệu. Cặp mồi được sử dụng trong nghiên cứu có trình tự là: Trình tự mồi: Mồi xuôi 27 5 ' - agagtttgatcctggctcag - 3 ' 27- 47 Mồi ngược 1525 5 ' - aaaggaggtgatccagcc - 3 ' 1525 -1507 Tiến hành: Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -35- Thành phần phản ứng Chu kỳ nhiệt H2O 17,1µl Buffer (10X) 2,5µl dNTP (2,5mM) 2µl Primer 1 (10pml) 1µl Primer 2 (10pml) 1µl ADN khuôn 1µl Enzyme Taq 0,4µl 94 0 C 3 phút 94 0 C 1 phút 64 0 C 1 phút 72 0 C 1 phút 30 giây 4 0 C ∞ Tổng 25µl 2.2.5.3. Phương pháp điện di trên gel agarose Phương pháp điện di trên gel agrose được sử dụng để kiểm tra DNA plasmid, kiểm tra các phân đoạn DNA được nhân bằng kỹ thuật PCR và kiểm tra kết quả cắt giới hạn. Phương pháp này được chia làm một số bước như sau: - Chuẩn bị gel agarose: cân một lượng agarose tương ứng (tùy theo nồng độ gel yêu cầu) vào trong dung dịch 100ml TAE 1X. Đun sôi bằng lò vi sóng, để nguội xuống khoảng 50 0 C rồi đổ dung dịch vào bản gel đã cài sẵn lược. Sau khoảng 30 phút, đặt bản gel vào bể điện di và đổ dung dịch điện di TAE ngập bản gel. - Tra mẫu: lấy 1 - 2 g DNA pha loãng trong 16 l đệm TE, sau đó bổ sung 4 l dye mầu. Một lượng DNA maker tương ứng cũng được tra vào bản gel trước khi điện di. - Điện di: Điện di tại hiệu điện thế không đổi 100V trong khoảng 20 - 30 phút. Quan sát sự di động của DNA từ cực âm sang cực dương thông qua dye mầu. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -36- - Nhuộm bản gel: Bản gel sau điện di được ngâm vào dung dịch thuốc nhuộm EtBr nồng độ 2 g/ml trong khoảng 10 phút, lắc nhẹ trên máy lắc, sau đó soi gel trên đèn UV và chụp ảnh bằng máy chụp gel của hãng Bio - Rad. 2.2.7. Phương pháp xử lý số liệu Kết quả nghiên cứu được chúng tôi xử lý theo phương pháp thống kê sinh học trên phần mềm Excel. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -37- Chƣơng 3 KẾT QUẢ VÀ THẢO LUẬN 3.1. Phân lập và thuần khiết các chủng nấm gây bệnh trên chè Từ các mẫu chè bị bệnh thu thập ở các khu vực khác nhau của tỉnh Thái Nguyên, chúng tôi đã phân lập và thuần khiết được 3 chủng nấm được ký hiệu là CT - 1A, CT - 2E và CT - 5X. Các chủng nấm phân lập được đều có đặc điểm chung là: các sợi nấm đều không có màu sắc, sợi nấm có vách ngăn (hình 3.1). Mỗi chủng nấm được phân lập từ một mẫu chè có biểu hiện bệnh khác nhau. Kết quả được trình bày trên bảng 3.1. Bảng 3.1. Đặc điểm một số mẫu chè làm nguồn phân lập các chủng nấm Ký hiệu chủng nấm Nguồn phân lập Biểu hiện bệnh CT - 1A Lá chè non Trên bề mặt lá và mép lá có nhiều đốm nâu CT - 2E Lá chè non Vết bệnh có màu nâu sẫm, lúc đầu chỉ có chấm nhỏ màu đen, sau đó lan ra khắp lá. CT - 5X Lá chè non Các lá bị xoăn, trên mặt lá có thể bị nhăn. Sau khi được tinh sạch, 3 chủng nấm trên được giữ trong ống thạch nghiêng trên môi trường Czapek và được sử dụng làm VSV kiểm định để tuyển chọn xạ khuẩn sau này. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -38- Chủng CT - 1A Chủng CT - 2E Chủng CT - 5X Hình 3.1. Ba chủng nấm phân lập từ các mẫu chè bị bệnh 3.2. Phân lập và tuyển chọn xạ khuẩn 3.2.1. Hoạt tính kháng nấm của các chủng xạ khuẩn Từ các mẫu đất lấy ở độ sâu 5 - 10 cm tại các địa điểm khác nhau thuộc tỉnh Thái Nguyên, chúng tôi đã phân lập và thuần khiết được 80 chủng xạ khuẩn thuộc chi Streptomyces. Sau khi thử HTKS theo phương pháp khuếch tán trên thạch với 3 chủng nấm CT - 1A, CT - 2E, CT - 5X, chúng tôi đã tuyển chọn sơ bộ được 30 chủng trong tổng số 80 chủng xạ khuẩn có hoạt tính kháng nấm ở các mức độ khác nhau, chiếm tỷ lệ 37,5%. So sánh với tỷ lệ chủng xạ khuẩn kháng nấm gây bệnh đạo ôn đã công bố trước đây cùa Lê Gia Hy và cộng sự [18], tỷ lệ chủng xạ khuẩn có hoạt tính kháng nấm gây bệnh trên chè của chúng tôi có phần cao hơn. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -39- Bảng 3.2. Xạ khuẩn có hoạt tính kháng nấm theo nhóm màu Nhóm màu xạ khuẩn Các chủng có HTKN Tỷ lệ chủng có HTKN so với tổng số (%) Số lượng Tỷ lệ(%) Trắng (Allbus) 11 36,7 13,7 Xám (Griseus) 8 26,7 10,0 Xanh (Azeureus) 7 23,3 8,6 Hồng (Roseus) 2 6,7 2,6 Nâu (Chromogenes) 1 3,3 1,3 Lục (Viridis) 1 3,3 1,3 Tổng cộng 30 100 37,5 Tỷ lệ các chủng xạ khuẩn có hoạt tính kháng nấm phân chia theo nhóm màu của Shirling và Gottlieb [37]. Kết quả được thể hiện trên bảng 3.2 và hình 3.2. Hình 3. 2. Tỷ lệ các chủng xạ khuẩn có hoạt tính kháng nấm theo nhóm màu Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -40- Kết quả trên bảng 3.2 cho thấy: số lượng chủng có hoạt tính nhiều nhất là nhóm trắng chiếm 36,7%, sau đó là nhóm xám - 26,7%, nhóm xanh - 25,3%, nhóm hồng - 6,7% và ít nhất là các nhóm nâu và lục đều chiếm 3,3%. Kết quả này của chúng tôi cũng phù hợp với những nghiên cứu của một số tác giả trước đây [14],[18]. Đồng thời chúng tôi cũng nhận thấy khả năng đối kháng của các chủng xạ khuẩn với 3 chủng nấm gây bệnh trên chè có sự khác nhau (bảng 3.3). Bảng 3. 3. Tính đối kháng của xạ khuẩn với 3 chủng nấm gây bệnh trên chè Chủng XK có HTKN 3 chủng nấm gây bệnh chè CT - 1A CT - 2E CT - 5X Kháng cả 3 chủng Số lượng 9 16 13 4 Tỷ lệ (%) 30 53 43 13,3 Trong tổng số 30 chủng có hoạt tính kháng nấm, số chủng kháng nấm CT - 2E là cao nhất, có 16 chủng (chiếm 53% ), tiếp theo là số chủng kháng nấm CT - 5X, có 13 chủng (chiếm 43%) và ít nhất là chủng kháng nấm CT - 1A có 9 chủng (chiếm 30%). Hình 3.3. Tỷ lệ các chủng xạ khuẩn có hoạt tính kháng nấm Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -41- Đáng chú ý trong số đó, có 4 chủng có khả năng kháng được cả 3 chủng nấm, chiếm tỷ lệ 13,3%, các chủng còn lại phần lớn chỉ kháng được 1 đến 2 chủng nấm. Tỷ lệ các chủng kháng nấm được thể hiện trên hình 3.3. 3.2.2. Tuyển chọn các chủng xạ khuẩn có HTKN cao Sau khi đã tuyển chọn sơ bộ được 30 chủng có hoạt tính kháng nấm, chúng tôi đã chọn ra 2 chủng có hoạt tính kháng nấm mạnh nhất được ký hiệu là: Đ1 và R2. Ở bước này, các chủng được nuôi lắc trong môi trường dịch thể ISP - 4 để thu dịch nuôi cấy. Kết quả kiểm tra hoạt tính của dịch nuôi cấy theo phương pháp đục lỗ với các chủng nấm như trên được thể hiện trên bảng 3.4 và hình 3.4. Bảng 3. 4. Hoạt tính kháng nấm của 3 chủng xạ khuẩn Chủng xạ khuẩn Hoạt tính kháng nấm (D- d, mm) CT - 1A CT - 2E CT - 5X Đ1 12 14 15 R2 12 16 17 Kết quả trên bảng 3.4 cho thấy: mặc dù cả 2 chủng xạ khuẩn lựa chọn đều vẫn giữ được hoạt tính kháng nấm, song mức độ kháng đối với các chủng nấm có sự khác nhau. Khả năng kháng nấm CT - 1A của cả 2 chủng xạ khuẩn đều yếu nhất và khả năng kháng chủng CT - 5X của 2 chủng xạ khuẩn là cao nhất. Chúng tôi tiếp tục tiến hành nghiên cứu các đặc điểm sinh học và phân loại của 2 chủng xạ khuẩn Đ1 và R2. Hai chủng xạ khuẩn này thuộc hai nhóm màu khác nhau. Chủng Đ1 thuộc nhóm màu trắng và chủng R2 thuộc nhóm màu nâu. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -42- VSV kiểm định: CT - 5X VSV kiểm định: CT - 2E Hình 3.4. Hoạt tính kháng nấm của 2 chủng xạ khuẩn lựa chọn 3.3. Đặc điểm sinh học và đặc điểm phân loại của 2 chủng XK Đ1 và R2 3.3.1. Đặc điểm hình thái Chủng R2 có cuống sinh bào tử dạng xoắn, bề mặt bào tử có dạng gai. Chủng Đ1 có cuống sinh bào tử dạng thẳng, bề mặt bào tử xù xì. Hình 3. 5. Cuống sinh bào tử và bề mặt bào tử chủng R2 R2 D1 ĐC ĐC R2 D1 Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -43- Hình 3.6. Cuống sinh bào tử và bề mặt bào tử chủng Đ1 3.3.2.Đặc điểm nuôi cấy Xạ khuẩn được nuôi cấy trên các môi trường khác nhau để quan sát khả năng sinh trưởng của xạ khuẩn và màu sắc của hệ khuẩn ty. Kết quả cho thấy xạ khuẩn rất đa dạng về màu sắc khi nuôi cấy trên các môi trường khác nhau. Tùy theo thành phần của môi trường nuôi cấy mà màu sắc khuẩn ty cơ chất và khuẩn ty khí sinh hay sắc tố hòa tan tiết ra khác nhau. Các đặc điểm nuôi cấy của 2 chủng R2 và Đ1 được trình bày trên bảng 3.5 cho thấy: Đối với chủng Đ1: khi nuôi cấy trên các môi trường ISP - 1, ISP - 2, ISP - 3, ISP - 5, ISP - 7 màu sắc của KTKS và KTCC đều có màu trắng. Trên môi trường ISP - 4 màu sắc HSCC có màu xám và HSKS có màu trắng. Ở môi trường ISP - 6 màu sắc của HSKS có màu vàng và HSCC có màu trắng. Đối với chủng R2: màu sắc của HSCC và HSKS có đa dạng hơn khi nuôi cấy trên các môi trường ISP khác nhau. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -44- Bảng 3. 5: Đặc điểm nuôi cấy của chủng R2 và Đ1 Môi trƣờng Chủng Đ1 Chủng R2 HSCC HSKS Sắc tố HSCC HSKS Sắc tố ISP - 1 Trắng Trắng Không màu Nâu Trắng Không màu ISP - 2 Trắng Trắng Không màu Nâu Xám ghi Không màu ISP - 3 Trắng Trắng Không màu Trắng ngà Xám ghi Không màu ISP - 4 Xám Trắng Không màu Trắng Xám Không màu ISP - 5 Trắng Trắng Không màu Trắng ghi nâu Trắng ghi xanh Không màu ISP - 6 Trắng Vàng Không màu Nâu Xám ghi (yếu) Melanin ISP - 7 Trắng Trắng Không màu Nâu Xám ghi Nâu * Khả năng hình thành sắc tố melanin Chủng R2 và Đ1 được nuôi cấy trên môi trường ISP - 6 ở nhiệt độ 30 0 C. Sau 14 ngày quan sát chúng tôi nhận thấy: Hình 3.7. Khả năng hình thành sắc tố melanin của 2 chủng Chủng R2 Chủng Đ1 Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -45- Đối với chủng Đ1 màu sắc của môi trường không có sự biến đổi, tức là không có khả năng hình thành sắc tố melanin. Đối với chủng R2 màu sắc của môi trường biến đổi từ màu vàng nhạt sang màu nâu đậm, điều đó có nghĩa là chủng R2 có khả năng hình thành sắc tố melanin trên môi trường có chứa sắt. 3.3.3. Đặc điểm sinh lý - sinh hóa * Khả năng đồng hóa các nguồn cacbon Để đánh giá khả năng đồng hóa các nguồn cacbon khác nhau, chúng tôi tiến hành nuôi 2 chủng R2 và Đ1 trên môi trường ISP - 9 có bổ sung các nguồn cacbon khác nhau với nồng độ 1%. Sau 7 - 14 ngày nuôi cấy, kết quả được thể hiện trên bảng 3. 6. Bảng 3.6. Khả năng đồng hóa nguồn cacbon của 2 chủng xạ khuẩn Đ1 và R2 Nguồn cacbon Mức độ sinh trƣởng Chủng Đ1 Chủng R2 Glucose ++++ ++++ Saccharose ++++ ++ Fructose ++++ ++ Lactose - ++++ Manitol ++++ ++++ Dextrin ++ ++++ Cellulose + + Arabinose - +++ Ghi chú: ++++: Sinh trưởng rất tốt; +++: Sinh trưởng tốt; ++: Sinh trưởng yếu; +: Sinh trưởng rất yếu; - :Không sinh trưởng Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -46- Kết quả trên bảng 3.6 cho thấy: Cả 2 chủng xạ khuẩn nghiên cứu đều có khả năng đồng hóa tốt các nguồn cacbon khác nhau. Song chủng R2 đồng hóa tốt nhất nguồn cacbon là: Glucose, Lactose, Manitol, Dextrin và sinh trưởng yếu nhất trong môi trường có chứa nguồn cacbon Cellulose. Đối với chủng Đ1 có khả năng đồng hóa tốt nguồn cacbon Glucose, Saccharose, Fructose, Manitol và không có khả năng đồng hóa 2 nguồn cacbon là Lactose, Arabinose. * Nhiệt độ sinh trưởng thích hợp Chủng R2 và Đ1 được nuôi ở các thang nhiệt độ khác nhau. Khả năng sinh trưởng của 2 chủng được thể hiện trên bảng 3.7. Bảng 3. 7: Nhiệt độ sinh trƣởng thích hợp của 2 chủng XK Nhiệt độ Chủng 25 0 28 0 30 0 32 0 35 0 40 0 R2 + +++ +++ ++ + + Đ1 ++ +++ +++ + + - Ghi chú: +++: Sinh trưởng tốt; ++: Sinh trưởng bình thường; +: Sinh trưởng yếu; -: Không sinh trưởng. Kết quả trên bảng 3.6 cho thấy, hai chủng R2 và Đ1 có khả năng sinh trưởng trong khoảng nhiệt độ từ 25 0 - 32 0 C, chủng R2 sinh trưởng tốt nhất ở nhiệt độ 28 0 - 30 0 C và sinh trưởng yếu ở nhiệt độ 35 0 - 40 0 C. Chủng Đ1 cũng sinh trưởng tốt ở nhiệt độ 28 0 - 30 0 C và không sinh trưởng ở nhiệt độ 40 0 C. Như vậy nhiệt độ thích hợp cho cả 2 chủng phát triển tốt là 28 - 30 0 C. * Khả năng chịu muối Hai chủng R2 và Đ1 được nuôi cấy trong môi trường ISP - 1 có bổ sung NaCl ở các nồng độ 0,5; 3; 7; 9; 11; 12 và 0% đối chứng. Kết quả thu được ở bảng 3.8. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -47- Bảng 3.8: Khả năng chịu muối của 2 chủng R2 và Đ1 Nồng độ NaCl (%) Chủng 0,5 3 5 7 9 12 0 R2 +++ + ++ + + - - Đ1 +++ ++ + + + - - Ghi chú: +++: Sinh trưởng tốt; ++: Sinh trưởng bình thường; +: Sinh trưởng yếu; -: Không sinh trưởng. Nồng độ muối có ảnh hưởng đến khả năng sinh trưởng của xạ khuẩn. Kết quả trình bày trên bảng 3.8 cho thấy: cả 2 chủng đều có khả năng sử dụng nồng độ muối tới 9% , ở nồng độ muối cao hơn thi cả 2 chủng đều không phát triển được. Như vậy ở nồng độ muối 0,5% chủng xạ khuẩn R2 và Đ1 đều có tác dụng kích thích sự sinh trưởng. * Khả năng sinh enzym ngoại bào Tinh bột CMC Casein Hình 3.8. Hoạt tính enzym của các chủng xạ khuẩn R2 D1 D1 D1 R2 R2 ĐC ĐC ĐC Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -48- Trong quá trình sống, để phân giải các hợp chất hữu cơ phức tạp thành các hợp chất đơn giản có thể hấp thu được. Xạ khuẩn có khả năng tiết vào môi trường các enzym ngoại bào. Chúng tôi đã tiến hành kiểm tra khả năng này của 2 chủng xạ khuẩn nghiên cứu, kết quả được thể hiện trên hình 3.8 cho thấy cả 2 chủng xạ khuẩn đều có khả năng thủy phân mạnh casein, tinh bột và CMC. 3.3.4. Hoạt tính kháng sinh của 2 chủng R2 và Đ1 Hoạt tính kháng sinh của xạ khuẩn cũng là một trong các chỉ tiêu phân loại. Cùng với việc nghiên cứu khả năng kháng nấm gây bệnh trên chè. Chúng tôi cũng kiểm tra khả năng kháng một số chủng nấm kiểm định gây bệnh thực vật như đã nêu trong mục 2.1.1.3. Kết quả được thể hiện trên bảng 3.9 và hình 3.9. Bảng 3.9: Hoạt tính kháng sinh của 2 chủng R2 và Đ1 với 3 chủng nấm kiểm định Chủng xạ khuẩn Hoạt tính kháng sinh (D - d, mm) F. oxysporum F. moniliforme R. solani R2 22 15 17 Đ1 18 19 0 Kết quả trên bảng 3.9 cho thấy: chủng R2 có phổ ức chế các VSV kiểm định khá rộng, có khả năng kháng cả 3 loại nấm. Tuy nhiên chủng R2 có khả năng kháng nấm F. oxysporum là mạnh nhất với vòng ức chế là 22 mm, còn với nấm R. solani là 17 mm và nấm F. moniliforme là 15 mm (hình 3.9). Chủng Đ1 chỉ có hoạt tính chống nấm F. oxysporum và F. moniliforme mà không có khả năng kháng nấm R. solani. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -49- Khả năng đối kháng các chủng VSV cùng với các đặc điểm về hình thái, sinh lý, sinh hóa được dùng để tham khảo trong phân loại các chủng xạ khuẩn này. Từ các kết quả nghiên cứu trên cho thấy 2 chủng xạ khuẩn Đ1 và R2 không chỉ có khả năng kháng nấm gây bệnh trên chè mà cũng có khả năng kháng cả các nấm gây bệnh thực vật như F. oxysporum, F. moniliforme, R. solani. VSV kiểm định: F. oxysporum VSV kiểm định: F. monilforme F. oxysporum F. moniliforme VSV kiểm định: R. solani R. solani. Hình 3.9. Hoạt tính kháng 3 chủng nấm kiểm định của 2 chủng Đ1 và R2 F.oxysporum m D1 D1 D1 R2 R2 R2 ĐC ĐC ĐC Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -50- 3.3.5. Vị trí phân loại của hai chủng xạ khuẩn R2 và Đ1 * Phân loại chủng R2 Bảng 3.10. So sánh đặc điểm phân loại của chủng R2 với S. misawaensis Đặc điểm phân loại Chủng R2 Loài chuẩn S. misawaensis Hình thái Hình dạng cuống sinh bào tử Xoắn (S) Xoắn (S) Bề mặt bào tử Có gai ngắn Có gai ngắn Môi trường ISP - 6 Khả năng sinh melanin Có Có Môi trường tinh bột Màu KTCC Vàng nâu Vàng hoặc vàng nâu Màu KTKS Xám Xám hoặc xám trắng Sắc tố tan Vàng nhạt Vàng đến vàng nâu Môi trường Czapek Glycerin KTCC Nâu ghi Nâu ghi KTKS Trắng hồng Trắng hồng Sắc tố tan Melanin Melanin Sinh kháng sinh Có Acwaimycin Đối chiếu với khóa phân loại xạ khuẩn của Gause, 1983 [49]. Chúng tôi nhận thấy chủng R2 có nhiều đặc điểm giống với loài S. misawaensis. Kết quả so sánh các đặc điểm của chủng R2 với loài S. misawaensis được trình bày trên bảng 3. 10. Chủng R2 có cuống sinh bào tử dạng xoắn, bề mặt bào tử có gai ngắn. Khi nuôi cấy trên các môi trường tinh bột màu sắc KTCC từ màu trắng đến Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -51- vàng nâu, còn màu sắc KTKS biến đổi thành màu xám hoặc xám trắng. Trên môi trường Czapek Glycerin màu sắc của KTKS từ màu trắng biến đổi thành màu trắng hồng, còn KTCC biến đổi thành màu nâu ghi. Chủng R2 có khả năng sinh sắc tố melanin trên môi trường có chứa sắt. Khi so sánh các đặc điểm phân loại của chủng R2 với loài chuẩn S. misawaensis trong khóa phân loại của Gauze, 1983. Chúng tôi nhận thấy chủng R2 có nhiều đặc điểm giống với loài này về hình thái, cuống sinh bào tử, bề mặt bào tử, đặc điểm nuôi cấy, khả năng hình thành sắc tố melanin và CKS. Như vậy, chủng R2 rất có thể thuộc loài S. misawaensis, nhóm Cinereus, seri: chromogenes. Chủng này được Hamada et Okami, mô tả vào năm 1968c [28]. * Phân loại chủng Đ1 Đặc điểm phân loại của chủng Đ1 được thể hiện trên bảng 3.11 cho thấy: chủng Đ1 có cuống sinh bào tử dạng thẳng, bề mặt bào tử xù xì. Khi nuôi cấy trên môi trường Gause - I, màu sắc của KTCC từ màu vàng nhạt biến đổi thành màu vàng nâu, màu sắc KTKS có màu trắng. Trên môi trường Gause - II, màu sắc của KTKS từ màu vàng biến đổi thành màu nâu, KTCC không có màu. Trên môi trường Czapek Glucoza, màu sắc của KTCC từ màu trắng biến đổi thành màu nâu vàng, màu của KTKS có màu trắng ánh kem. Chủng Đ1 không có khả năng hình thành sắc tố melanin. Đối chiếu với khóa phân loại của Gauze, 1983, chúng tôi nhận thấy chủng Đ1 có nhiều đặc điểm giống với loài Actinomyces brunneofungus về các đặc điểm hình thái, cuống sinh bào tử, khả năng hình thành sắc tố melanin và đặc điểm nuôi cấy, khả năng hình thành CKS chống nấm. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -52- Như vậy, có thể chủng Đ1 thuộc loài A. brunneofungus, nhóm Albus, seri: albocolorabus. Chủng này được Krasilnikov et al, mô tả vào năm 1971[48]. Bảng 3.11. So sánh đặc điểm phân loại của chủng Đ1 với A.brunneofungus Đặc điểm phân loại Chủng Đ1 Loài chuẩn A.brunneofungus Hình thái Hình dạng cuống sinh bào tử Thẳng (RF) Thẳng và lượn sóng Bề mặt bào tử Xù xì Xù xì Môi trường ISP - 6 Khả năng sinh melanin Không Không Gauze - I Màu KTCC Vàng nâu Vàng nâu Màu KTKS Trắng Trắng Sắc tố tan Không Không có Gauze - II Màu KTCC Không màu Không màu Màu KTKS Nâu Nâu Sắc tố tan Không Không Czapek gluco Màu KTCC Nâu vàng Nâu hoặc nâu vàng Màu KTKS Trắng ánh kem Trắng ánh kem Sắc tố tan Yếu Yếu Sinh kháng sinh Có Flavofungina 3.4. Khả năng sinh tổng hợp CKS của 2 chủng xạ khuẩn đã lựa chọn 3.4.1. Lựa chọn môi trƣờng lên men thích hợp Trong công nghệ lên men, môi trường lên men đóng vai trò quan trọng. Một môi trường lên men tốt phải là môi trường vừa thuận lợi cho chủng sinh Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -53- trưởng tốt vừa cho hiệu suất kháng sinh cao. Để lựa chọn môi trường lên men đáp ứng được cả hai điều kiện trên, chúng tôi sử dụng 5 loại môi trường lên men cơ sở là: A - 4H, A - 4, Gause - I, Gause - II và ISP - 4. Quá trình lên men được tiến hành trong bình nón dung tích 250 ml có chứa 25ml môi trường. Sau 120 giờ nuôi lắc ở nhiệt độ 28 0 C - 30 0 C, thu d ịch lên men, xác định HTKS bằng phương pháp đục lỗ. Kết quả được thể hiện ở bảng 3.12 và hình 3. 12 Bảng 3.12: Hoạt tính kháng sinh của 2 chủng xạ khuẩn trên các môi trƣờng lên men khác nhau Chủng XK Môi trƣờng Sinh khối (mg/ml) HTKS (D-d,mm) R2 A - 4H 8,34 ± 0,12 22,33 ± 1,42 A - 4 4,6 ± 0,15 19,52 ± 0,48 Gauze - I 5,51 ± 0,23 17,65 ± 0,58 Gauze - II 7,52 ± 0,21 13,93 ± 0,13 ISP - 4 3,19 ± 0,15 12,18 ± 0,15 Đ1 A - 4H 9,24 ± 0,23 21,34 ± 0,21 A - 4 4,43 ± 0,18 18,72 ± 0,17 Gauze - I 6,48 ± 0,33 16,23 ± 0,44 Gauze - II 7,25 ± 0,22 9,14 ± 0,34 ISP - 4 2,78 ± 0,26 7,25 ± 0,14 Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -54- Hình 3.10: Ảnh hƣởng của môi trƣờng đến khả năng tổng hợp CKS Kết quả trên bảng 3.12 và hình 3.10 cho thấy: Trong 5 môi trường lên men cả 2 chủng nghiên cứu đều cho sinh khối lớn nhất trong môi trường A - 4H. Với chủng R2 là 8,0 mg/ml, chủng Đ1 là 9,0 mg/ml. Đồng thời dịch lên men của môi trường A - 4H cũng có hoạt tính kháng sinh mạnh nhất (21mm). Từ kết quả này đã chứng tỏ các thành phần trong môi trường lên men có ảnh hưởng nhiều đến khả năng hình thành CKS của xạ khuẩn như nhiều nghiên cứu trước đã khẳng định [14],[17]. Với mục đích là lựa chọn môi trường lên men thích hợp cho quá trình sinh tổng hợp CKS, căn cứ vào kết quả này chúng tôi nhận thấy môi trường A - 4H là thích hợp nhất và được sử dụng cho các nghiên cứu tiếp theo. 3.4.2. Ảnh hƣởng của nguồn cacbon Các hợp chất cacbon vừa là nguồn dinh dưỡng lại vừa là nguồn cung cấp năng lượng cho cơ thể. VSV nói chung và xạ khuẩn nói riêng có khả năng sử dụng được nhiều nguồn cacbon khác nhau. Để nghiên cứu ảnh hưởng của nguồn cacbon lên khả năng sinh trưởng và hình thành CKS, đồng thời xác định được nguồn cacbon thích hợp nhất cho 2 chủng R2 và Đ1, chúng tôi tiến hành khảo sát một số nguồn cacbon thông thường được sử dụng để lên men CKS. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -55- Bảng 3.13. Ảnh hƣởng của nguồn cacbon lên khả năng sinh tổng hợp CKS của 2 chủng R2 và Đ1 Các chỉ tiêu Ký hiệu chủng Nguồn cacbon Glucose Tinh bột Lactose Sacarose Sinh khối R2 17,44 ± 0,22 16,23 ± 0,42 13,58 ± 0,56 18,93 ± 0,57 Đ1 18,53 ± 0,45 15,75 ± 0,33 11,55 ± 0,15 17,26 ± 0,34 HTKS R2 15,24 ± 0,36 18,21 ± 0,32 20,23 ± 0,61 21,22 ± 0,78 Đ1 17,53 ± 0,16 16,82 ± 0,58 16,34 ± 0,74 18,29 ± 0,65 Kết quả trình bày trên bảng 3.13 cho thấy: cả 2 chủng xạ khuẩn R2 và Đ1 đều có khả năng sử dụng được cả 4 nguồn đường nghiên cứu. Tuy nhiên ảnh hưởng của các nguồn cacbon này lên sự sinh trưởng và khả năng tạo kháng sinh của các chủng có sự khác nhau. Đối với chủng R2 nguồn cacbon sacarose cho sinh khối lớn nhất và HTKS mạnh nhất. Chủng Đ1 nguồn cacbon Glucose cho sinh khối lớn nhưng sacarose có HTKS mạnh nhất. Hình 3.11: Ảnh hƣởng của nguồn cacbon đến khả năng tổng hợp CKS Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -56- 3.4.3. Ảnh hƣởng của nguồn nitơ Nitơ là nguồn dinh dưỡng không thể thiếu đối với VSV nói chung và xạ khuẩn nói riêng. Trong môi trường lên men, nguồn nitơ có ảnh hưởng nhiều đến sự tổng hợp CKS của xạ khuẩn [3]. Nguồn nitơ được sử dụng trong môi trường lên men xạ khuẩn có thể ở dạng vô cơ hoặc hữu cơ. Vì vậy chúng tôi tiến hành khảo sát ảnh hưởng của cả 2 nguồn nitơ này đến khả năng sinh tổng hợp CKS của 2 chủng xạ khuẩn nghiên cứu. Bảng 3.14. Ảnh hƣởng của nguồn nitơ lên khả năng sinh tổng hợp CKS của 2 chủng R2 và Đ1 Nguồn nitơ Nồng độ (%) Sinh khối (mg/ml) Hoạt tính kháng sinh (D-d,mm) R2 Đ1 R2 Đ1 Bột đậu tương 1 12,6 ± 0,25 11,2 ± 0,32 21,63 ± 0,58 20,32 ±0,15 Cao nấm men 1 13,52 ± 0,23 13,28 ±0,17 19,78 ± 0,26 19,73 ±0,52 (NH4)2SO4 1 9,73 ± 0,18 8,01 ± 0,22 17,65 ± 0,44 16,82 ±0,38 KNO3 1 7,82 ± 0,52 8,56 ± 0,24 16,92 ±0,32 14,34±0,17 Nguồn nitơ hữu cơ được chúng tôi sử dụng là cao nấm men và bột đậu tương, nguồn nitơ vô cơ là nitrat kali (KNO3) và muối sunfat amon ((NH4)2SO4.). Các nguồn nitơ này được bổ sung vào môi trường A - 4H. Quá trình lên men được tiến hành trong bình nón 250 ml có chứa 25 ml môi trường. Sau 120 giờ nuôi lắc, thu dịch lên men và xác định HTKS. Kết quả được trình bày trên bảng 3.14 và hình 3.12. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -57- Từ kết quả trên cho thấy cả 2 chủng xạ khuẩn nghiên cứu đều sinh trưởng tốt ở trong 2 môi trường có nguồn nitơ hữu cơ là bột đậu tương và cao nấm men. Song chưa rõ có sự khác nhau rõ rệt giữa 2 nguồn nitơ này. Hình 3.12 : Ảnh hƣởng của nguồn nitơ đến khả năng tổng hợp CKS Cũng như sự sinh trưởng, HTKS của 2 chủng nghiên cứu cũng cao hơn ở trong 2 môi trường có bột đậu tương và cao nấm men. Các kết quả này đã khẳng định ưu thế của nguồn nitơ hữu cơ lên khả năng sinh trưởng cũng như sinh tổng hợp CKS của xạ khuẩn nói chung. Điều này có thể giải thích trong các nguồn nitơ hữu cơ, ngoài thành phần protein còn chứa các chất cần thiết cho quá trình tổng hợp CKS. Kết quả nghiên cứu này của chúng tôi cũng phù hợp với một số kết quả đã công bố trước đây [14]. 3.5. Phân loại các chủng xạ khuẩn theo phƣơng pháp sinh học phân tử 3.5.1. Kết quả tách chiết DNA tổng số của các chủng xạ khuẩn Trong nghiên cứu này, chúng tôi đã tiến hành tách chiết DNA từ 2 chủng xạ khuẩn là Đ1 và R2. Trước khi tiến hành tách chiết DNA, các chủng xạ khuẩn được nuôi cấy trên môi trường tăng sinh để thu sinh khối tế bào. DNA được tách chiết theo phương pháp của Ausubel và cs có cải tiến [39] đã Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -58- được trình bày ở trên. Kết quả tách chiết được kiểm tra bằng cách điện di trên gel agarose 0,8% và được trình bày trong hình 3.13. Đ1 R2 Hình 3.13. Ảnh điện di DNA tổng số của 2 chủng xạ khuẩn Trên cơ sở kết quả thu được trong hình 3.13 cho thấy DNA đã được tách ra từ cả 2 chủng xạ khuẩn nêu trên. Tương ứng với mỗi chủng, sản phẩm điện di chỉ có một băng duy nhất đã chứng tỏ DNA không bị đứt gãy trong quá trình tách chiết. Hàm lượng DNA thu được là tương đối lớn và có độ sạch cao. Như vậy, có thể nói rằng DNA thu được trong quá trình tách chiết đã đạt được các yêu cầu đề ra. Sản phẩm DNA đáp ứng tốt cho các nghiên cứu khuếch đại gen 16S - rRNA bằng phản ứng PCR. 3.5.2. Kết quả nhân gen 16S - rRNA bằng phản ứng PCR Để tạo tiền đề cho việc định loại 2 chủng xạ khuẩn đã được phân lập nêu trên, trong nghiên cứu này chúng tôi đã tiến hành khuếch đại gen 16S - rRNA. Đây là một gen chỉ thị được dùng phổ biến trong định loại VSV. Cặp mồi được thiết kế để khuếch đại cho phản ứng PCR cho phép khuếch đại trình tự trọn vẹn của gen 16S - rRNA, đảm bảo tốt cho các nghiên cứu tách dòng và Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -59- xác định trình tự đầy đủ của gen này. Kết quả khuếch đại gen được trình bày trong hình 3.14. Hình 3.14. Ảnh điện di sản phẩm PCR của 2 chủng xạ khuẩn nghiên cứu M. Maker ΦX174 cắt bằng Hind III 3,4. chủng Đ1. 5,6. Chủng R2 Dựa trên kết quả điện di hình 3.14 cho thấy cả 2 chủng xạ khuẩn Đ1 và R2 đều có sự nhân lên của gen 16S - rRNA. Sản phẩm PCR có độ đặc hiệu cao, không có các sản phẩm phụ. Mặt khác, dựa trên DNA maker chuẩn cho thấy sản phẩm PCR có kích thước khoảng 1,5 kb tương ứng với kích thước theo tính toán lý thuyết trong quá trình lựa chọn mồi. Như vậy có thể kết luận là đoạn DNA được nhân lên chính là gen 16S - rRNA. Kết quả này là cơ sở quan trọng để chúng tôi có thể tiếp tục tách dòng và xác định trình tự đầy đủ của gen 16S ở 2 chủng nghiên cứu. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -60- Chƣơng 4 KẾT LUẬN VÀ KIẾN NGHỊ 4.1. KẾT LUẬN 1. Từ các mẫu đất khác nhau, đã phân lập và thuần khiết được 80 chủng xạ khuẩn thuộc chi Streptomyces, trong số đó có 30 chủng có hoạt tính kháng nấm gây bệnh trên chè ở các mức độ khác nhau, chiếm tỷ lệ 37,5%. Trong số các chủng có hoạt tính kháng nấm, nhóm trắng chiếm 36,7%, xám - 26,7%, xanh - 23,3%, hồng - 6,7%, nâu - 3,3%, lục - 3,3%. 2. Đã tuyển chọn được 2 chủng xạ khuẩn là Đ1 và R2 có hoạt tính mạnh nhất trong số 30 chủng có hoạt tính kháng nấm, kháng được cả 2 chủng nấm gây bệnh trên chè là CT - 2E và CT - 5X, đồng thời cũng có khả năng kháng các nấm kiểm định. 3. Đã tiến hành xác định các đặc điểm hình thái, sinh lý, sinh hóa, khuếch đại gen 16S - rRNA để nhận định: - Chủng R2 có thể là loài Streptomyces misawaensis. - Chủng Đ1 có thể là loài Actinomyces brunneofungus. 4. Đã xác định được một số điều kiện lên men thích hợp cho sự sinh tổng hợp CKS của 2 chủng xạ khuẩn. - Môi trường A - 4H thích hợp cho lên men tạo chất kháng sinh cho cả 2 chủng xạ khuẩn Đ1 và R2. - Nguồn cacbon thích hợp nhất để tổng hợp CKS của chủng R2 là Sacarose và chủng Đ1 là glucose. - Bột đậu tương và cao nấm men đều là những nguồn nitơ hữu cơ thích hợp cho lên men CKS của cả 2 chủng xạ khuẩn này. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -61- 4. 2. KIẾN NGHỊ VỀ NHỮNG NGHIÊN CỨU TIẾP THEO 1. Tiếp tục nghiên cứu để giải trình tự gene 16S của hai chủng xạ khuẩn Đ1 và R2. 2. Tiếp tục nghiên cứu khả năng tổng hợp CKS của hai chủng Đ1 và R2. 3. Tách chiết và xác định bản chất hóa học của các CKS. 4. Tìm hiểu khả năng ứng dụng của các CKS thô và cần được khảo nghiệm trên diện rộng để đánh giá hiệu quả sử dụng trong công tác bảo vệ thực vật. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -62- CÔNG TRÌNH CÔNG BỐ LIÊN QUAN ĐẾN LUẬN VĂN Bùi Thị Hà, Vi Thị Đoan Chính (2008), "Khả năng kháng nấm gây bệnh trên chè của một số chủng xạ khuẩn phân lập từ đất Thái Nguyên", Tạp chí khoa học và công nghệ, số 2 (46), tr. 92 - 96. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -63- TÀI LIỆU THAM KHẢO TIẾNG VIỆT 1. Bộ nông nghiệp và phát triển nông thôn (2006), Kỹ thuật trồng,chăm sóc và chế biến chè, NXB Nông nghiệp, tr. 72 - 77. 2. Ngô Đình Quang Bính (2005), Vi sinh vật học công nghiệp, Viện sinh thái và tài nguyên sinh vật, Trung tâm khoa học Tự nhiên và công nghệ Quốc gia, Hà Nội, tr.53 - 71. 3. Nguyễn Văn Cách (2004), Công nghệ lên men các chất kháng sinh, NXB khoa học và kỹ thuật, Hà Nội. 4. Chi cục bảo vệ thực vật Phú Thọ, Sử dụng an toàn, hiệu quả thuốc bảo vệ thực vật trên cây chè, 07/2003, tr. 24 - 30. 5. Nguyễn Hoàng Chiến (2000), Nghiên cứu chủng xạ khuẩn Streptomyces V6 sinh chất kháng sinh chống vi khuẩn gây bệnh héo xanh cà chua, Luận văn thạc sĩ sinh học, Hà Nội. 6. Vi Thị Đoan Chính (2000), Nghiên cứu khả năng nâng cao hoạt tính kháng sinh của chủng Streptomyces rimosus R77 và Streptomyces hygroscopicus 5820 bằng kỹ thuật dung hợp tế bào trần, Luận án TS sinh học, Viện công nghệ sinh học, Hà Nội. 7. Nguyễn Lân Dũng, Phạm Thị Trân Châu (1978), Một số phương pháp nghiên cứu vi sinh vật học - Tập III. NXB khoa học và kỹ thuật, Hà Nội. 8. Nguyễn Lân Dũng, Đoàn Xuân Mượu, Nguyễn Phùng Tiến, Đặng Đức Trạch, Phạm Văn Ty (1972), Một số phương pháp nghiên cứu vi sinh vật học, Tập I, NXBKHKT Hà Nội, 328 - 345. 9. Nguyễn Lân Dũng, Phạm Văn Ty, Nguyễn Đình Quyến (1977), Vi sinh vật học - tập II, Nhà xuất bản Đại học và Trung học chuyên nghiệp, Hà Nội. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -64- 10. Nguyễn Lân Dũng, Nguyễn Đình Quyến, Phạm Văn Ty (2002), Vi sinh vật học, Nhà xuất bản Giáo Dục, Hà Nội, tr. 39 - 41. 11. Nguyễn Lân Dũng, Nguyễn Nữ Kim Thảo, Các nhóm vi khuẩn chủ yếu, Vietsciences, 15/02/2006 12. Nguyễn Thành Đạt (2000), Sinh học vi sinh vật, NXB Giáo dục 13. Nguyễn Thành Đạt, K.A. Vinogradva V.A.Poltorac (1974), Tính biến dị bề mặt bào tử Xạ khuẩn sinh choromomycin, Act.A. buraviensis, microbiologia, TXL III, N5, NXB Academia cccp. 14. Bùi Thị Việt Hà (2006), "Nghiên cứu xạ khuẩn sinh chất kháng sinh chống nấm gây bệnh thực vật ở Việt Nam", Luận án tiến sĩ sinh học, Hà Nội. 15. Đỗ Thu Hà (2004) Nghiên cứu xạ khuẩn sinh chất kháng sinh chống nấm phân lập từ đất Quảng Nam-Đà Nẵng, Luận án tiến sĩ sinh học, Hà Nội. 16. Lê Gia Hy (1994), "Nghiên cứu Xạ khuẩn thuộc chi Streptomyces sinh chất kháng sinh chống nấm gây bệnh đạo ôn và thối cổ rễ phân lập ở Việt Nam", Luận án Tiến sĩ, Hà Nội. 17. Lê Gia Hy, Nguyễn Quỳnh Châu, Phạm Kim Duy, "Ảnh hưởng của canxi và coban lên khả năng sinh tổng hợp clotetraxyclin và vitamin B12 bằng phương pháp lên men bề mặt", Tạp chí sinh học, số 4, 1992. 18. Lê Gia Hy và cộng sự (1992), "Tính đối kháng của xạ khuẩn phân lập từ đất Việt Nam đối với bệnh đạo ôn", Tạp chí Sinh học, tập 14, số 4, 11 - 12. 19. Lê Mai Hương (1993), Nghiên cứu Xạ khuẩn sinh chất kháng sinh phân lập ở Hà Nội và vùng phụ cận, luận án tiến sĩ, Hà Nội. 20. Biền Văn Minh (2000), Nghiên cứu khả năng sinh chất kháng sinh của một số chủng xạ khuẩn phân lập từ đất Bình Trị Thiên, Luận án tiến sĩ sinh học, Hà Nội. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -65- 21. Lương Đức Phẩm (1998), Công nghệ vi sinh vật, NXB Xây dựng, Hà Nội, tr.47-49. 22. Lê Xuân Phương (2001), Vi sinh vật học công nghiệp, Nhà xuất bản xây dựng, Hà Nội, tr.47 - 49. TIẾNG ANH 23. Berdy,J. (1974), "Recent development in antibiotic research and classification of antibiotic according to the chemical structure", Adv. Appl.Microbiol, 18. 309 - 406. 24. Demain. A.L.A. (1974), "How do antibiotic - producing microorganism avoid suicide" Annuals of the New York academy of science, 235, 601-602. 25. Demain. A.L.A - Fang (1995) "Emerging concept of secondary metabolism in actinomycetes", J. Actinomycetologica, 9, 98 - 117. 26. Furimai,T,K.Saitoh, M.Kakushima, S.Yamamuto, K.Suzuki, C.Ikeda,S. Kobaru, M.Hatori and T.Oki, BSM - 181184, A new pradimicins deverative, J. Antibiotics 1993, N046 (2), p - 265 - 274. 27. Goldat S. iu., 1958, Antibiotiki, N4, p.14-18. 28. Hamada M., Okami Y. 1968c. In: Sazaki M., Hara T., Takeuchi T. et al. J. Antibiot., A 21, p. 37-44. 29. Hopwood D.A and MJ. Merrick, (1997), "Genetics of antibiotic production" , J. Bacteriol, pp. 596 - 636. 30. Jongsik Chun, Seung. B.K, youn Kyung Oh, Goodfellow. M (1999), "Amycolatopsis thermoflava sp.nov, anovel soil actinomycete from Hainan Island, China", Int. J, Syst. Bacteriol - 49, 1369 - 1373. 31. Martin, J. F, A.L. Demain, (1980), "Control of antibiotics synthesis", Microbiol Rev, 44 (2): 230 - 252. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -66- 32. Miyadoh S. (2001), Identification manual of Actinomycetes, Business Center for Academic Scieties Japan. 33. Newman D.J, Cragg G.M, Snader K.M, (2003), Natural products as ourees of new drugs over the period", J Nat Prod, 66, 1022 - 1037. 34. Porter. N, (1995), "Culture conditional for antibiotic - producing icroorganisms", Methods in enzymol, XVIII, 3 - 23. 35. Robert D. Nolan, Thomas C (1988), "Isolation and Screeming of Actinomycetes". In Actinomycetes in Biotechnology, Academic Press, london. 36. Sezaki M, Miyadoh S, (2001), "Practically used Antibiotics and their related substances", In Indentification Manual of Actinomycetes, Japan. 37. Shirling E.B, Gotilieb D. (1966), " Methods for characterization of Streptomyces spectes", International Journal of Systematic Bacteriology, Vol 16, No 3, 313 - 340. 38. Shirling E.B, Gotilieb D, "Cooperative deription of type cultures of Streptomyces" V.Additional descriptions, International journual of systematic Bacteriology Vol 22, 1972, p.265 - 394. 39. Tobias Kieser, Mervyn Bibb, Mark J. Buttner Keith F. Chater, David A, Hopwood (2000), Practical Streptomyces genetics, The John Innes Foundation Norwich, p.170 - 171. 40. Tong chai. K, Phuripun.L, Charan, C (1995), Antibiotic Production of Actinomycetes in Forest Termite Soil, 20 - 40. 41. Tresner. H. D, M. C. Davies, and E. Jackus, (1961), "Electron icroscopy of Streptomyces spore morphology and its role in species ifferentiation". J. Bacteriol. 81, 70 - 80. 42. Trerner, H.D, Buckus. E.J (1963), "System of color wheels for Streptomyces taxonomy" Appl. Microbiol, 11, 335 - 338. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên -67- 43. Waksman, S. A. (1961) The Actinomycetes. Classification, identification and descriptions of genera and species, vol 2, The Williams & Wilkins Co., Baltimore, USA. 44. Williams and Wilkin, Bergey ' s maunual of systematic Bacteriology, Vol 4, 1989, pp. 2451 - 2492. 45. Werner Braun (1976), Di truyền học vi khuẩn (Người dịch Lê Đình Lương), NXB khoa học và kỹ thuật, Hà Nội. 46. Weinberrg E.D (1973), Secondary metabolism Control by temperature and inorganic photphate, Ind. Microbiol 15, 1 - 14. 47. Yoo JC, Kim JH, Ha JW, Park NS, Sohng JK, Production and biological activity of laidlomycin, anti - MRSA/ VRE antibiotic from streptomyces sp, CS684, J Microbiol, 2007/ 2, 45 (1): 6 - 16. TIẾNG NGA 48. Н.А. Красилников (1971) Лучитые Грибки. Издательство «Наука», Москва. 49. Г. Ф. Гаузе, Т.П.Преображенская, М. А. Свешникова, Л.П.Терехова,Т.С.Максимова,(1983),Определитель Актиномицетов. Издательство «Наука», Москва. 50.

Các file đính kèm theo tài liệu này:

  • pdfstreptomyces2_188.pdf
Luận văn liên quan