Phân biệt các loại thịt heo, bõ, cừu bằng phương pháp Multiplex PCR

Khi đã xác định đƣợc quy trình này hoàn toàn phù hợp để xác định thịt đã xử lý nhiệt, chúng tôi tiến hành m-PCR trên đối tƣợng bột thịt của 3 cơ sở: CE, A, VY. Qua điện di ba mẫu PCR bột thịt cùng với ba đối chứng là sản phẩm s-PCR của DNA thịt heo, bò, cừu (mục 4.2), kết quả thu đƣợc: bột thịt CE có nguồn gốc từ thịt heo, còn bột thịt A và VY có nguồn gốc từ thịt bò

pdf70 trang | Chia sẻ: lylyngoc | Ngày: 03/12/2013 | Lượt xem: 1958 | Lượt tải: 1download
Bạn đang xem nội dung tài liệu Phân biệt các loại thịt heo, bõ, cừu bằng phương pháp Multiplex PCR, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
g Tris – HCl ở pH = 8,3. Những hoạt chất ổn định enzym (enzym stabilizers) cũng đƣợc chú ý nhƣ: gelatin (0,01%), Triton X – 100 (0,1% (v/v)) trong những dung dịch đệm để tồn trữ enzym. Có trƣờng hợp ngƣời ta sử dụng cả hai làm dung dịch điệm. Ion Mg2+ Một trong những ảnh hƣởng có tính chất quyết định đến sự chuyên biệt và hiệu quả của phản ứng PCR là nồng độ Mg2+. Môi trƣờng có tính chất ion cao sẽ làm cho dung dịch đệm trở nên năng động rất nhiều. Do đó nồng độ Mg2+ cao hay thấp đều tạo ra những ảnh hƣởng rất lớn. Nồng độ Mg2+ cao sẽ làm cho phân tử DNA mạch đôi ổn định hơn nhƣng đồng thời ngăn cản sự biến tính hoàn toàn của sản phẩm trong mỗi chu kì và do đó làm giảm sản phẩm PCR tạo ra. Ngoài ra lƣợng Mg 2+ dƣ còn làm tăng hiện tƣợng bắt cặp giả tạo ra những sản phẩm không mong muốn với số lƣợng khá lớn. Ngƣợc lại nếu nồng độ Mg2+ quá thấp (< 0,5 M), sẽ ảnh hƣởng xấu đến quá trình kéo dài vì Mg2+ đóng vai trò là co-factor của Taq polymerase. Một vài ion Mg 2+ sẽ đƣợc kẹp giữ bởi dNTP trong phản ứng. Vì vậy cần phải tỷ lệ thích hợp giữa dNTP và Mg2+ . Nucleotid Cần phải có cả bốn loại nucleotid dạng triphophat: dATP, dTTP, dCTP, dGTP. Ngƣời ta khuyến cáo rằng mỗi loại deoxynucleotid đƣợc sử dụng là 200 M. 15 Phải giữ cho nồng độ của tất cả các deoxynucleotid luôn bằng nhau, để tránh sự gắn kết nhầm lẫn. Thời gian và số chu kỳ Phản ứng PCR diễn ra qua hai giai đoạn, giai đoạn đầu số lƣơng bản sao tăng theo cấp số nhân nhƣng sau đó hiệu quả khuếch đại giảm dần vì một số nguyên nhân sau: Cạn kiệt các thành phần phản ứng, nhất là sự giảm nồng độ các nucleotid. Xuất hiện các sản phẩm phụ ức chế phản ứng. Các bản sao vừa mới đƣợc tổng hợp không bắt cặp với mồi mà bắt cặp với nhau. Ngoài ra, số lƣợng chu kì còn phụ thuộc vào số lƣợng bản sao ban đầu, nếu số lƣợng ban đầu là 105 thì thực hiện 25 – 30 chu kì, còn số lƣợng mẫu là 102 – 103 thì phải thực hiện 30 – 40 chu kì (Trần Thị Xô và Nguyễn Thị Lan, 1999). Thiết bị và dụng cụ Thực chất thiết bị và dụng cụ để tiến hành phản ứng PCR chỉ cần đáp ứng đƣợc nhu cầu thay đổi nhiệt độ nhanh và chính xác. Các thiết bị hiện nay đã đƣợc cải thiện tối đa để tránh sự bốc hơi nƣớc trong quá trình phản ứng và cho phép tiến hành phản ứng PCR ngay trên mô và tế bào... Tuy nhiên, mỗi kiểu thiết bị đều có đặc điểm khuếch đại riêng nên mọi thí nghiệm của một nghiên cứu cần đƣợc tiến hành cùng một chủng loại thiết bị. Hơn nữa ống nghiệm dùng cho các phản ứng của cùng một thí nghiệm phải thuộc cùng một kiểu vì đặc tính truyền nhiệt của của các ống này cũng nhƣ độ tiếp xúc giữa ống và bộ phận tạo nhiệt của thiết bị có ảnh hƣởng lớn đến quá trình khuếch đại (Hồ Huỳnh Thuỳ Dƣơng, 2002). Ƣu và nhƣợc điểm của phản ứng PCR Ưu điểm của phản ứng PCR Thời gian thực hiện nhanh, đơn giản, ít tốn kém. 16 Không đòi hỏi mẫu phải tinh sạch cao (vết máu khô, mẫu vật khảo cổ). Nhược điểm của phản ứng PCR Đòi hỏi phải biết trình tự nucleotid của đoạn DNA cần khuếch đại, hay ít nhất cũng phải biết trình tự hai đầu của phân tử DNA. Chỉ khuếch đại những phân tử DNA có kích thƣớc nhỏ hơn 3 kb, tốt nhất là 1 kb. Rất dễ bị nhiễm, dẫn đến tạo sản phẩm phụ (dƣơng tính giả). Ứng dụng của kỹ thuật PCR Do có khả năng khuếch đại một lƣợng DNA cực nhanh và chuyên biệt nên kỹ thuật PCR đƣợc áp dụng rộng rãi trên nhiều lĩnh vực (Nguyễn Văn Uyển, 1995): - Sản xuất các mẫu dò. - Ứng dụng trong khuếch đại DNA, RNA. - Ứng dụng để phân tích đa dạng di truyền. - Ứng dụng trong chẩn đoán bệnh. 2.4.6 Nguyên tắc multiplex PCR Multiplex PCR là phản ứng PCR cho phép phát hiện cùng lúc nhiều gen của một sinh vật hay nhiều sinh vật khác nhau bằng cách sử dụng nhiều cặp mồi khác nhau trong một phản ứng. 2.5 Các công trình nghiên cứu về phát hiện loài trong thịt chế biến bằng phƣơng pháp multiplex PCR Hơn một thập kỉ qua, sau khi ra đời phƣơng pháp PCR nói chung và multiplex PCR nói riêng đã đƣợc sử dụng rộng rãi để phát hiện hay phân biệt DNA các sinh vật khác nhau từ nhiều nguồn mẫu. Vì vậy phƣơng pháp multiplex PCR cũng đã đƣợc nhiều nhà nghiên cứu sử dụng trong việc phân biệt loài động vật trong thịt chế biến. Năm 1997, Wayne và ctv đã có công trình nghiên cứu về trình tự mtDNA dài2001 bp của 23 dòng chó. Kết quả nghiên cứu cho thấy trên mtDNA có trình tự bảo toàn cho cả 23 dòng chó. 17 Tại Hoa Kỳ, Sawyer (1997) đã tìm ra một phƣơng pháp nhanh và nhạy để xác định và ngăn chặn tình trạng nhập khẩu bò nhiễm BSE. Tác giả đã xây dựng quy trình PCR phát hiện thịt bò trong thịt và bột thịt xƣơng dựa trên đoạn gen bảo tồn của mtDNA bò (B – mtDNA). Năm 1998, Matsugana đã công bố công trình nghiên cứu phát hiện 6 loại thịt (bò, heo, gà, cừu, dê, ngựa) từ thịt chế biến. Tác giả sử dụng 7 đoạn mồi với tỉ lệ thích hợp để phát hiện DNA chuyên biệt cho từng loài. Mồi xuôi đƣợc thiết kế dựa trên trình tự DNA bảo toàn của gen mtDNA, còn mồi ngƣợc đƣợc thết kế dựa vào trình tự chuyên biệt ở mỗi loài. Các cặp mồi này cho các sản phẩm PCR có kích thƣớc khác nhau tƣơng ứng với 6 loại thịt. Các đoạn DNA của dê, gà, bò, cừu, heo, ngựa lần lƣợt có khích thƣớc: 157, 227, 274, 331, 398, 439 bp. Kết quả PCR đƣợc quan sát bằng điện di. DNA của dê, gà, bò, cừu, heo đƣợc phát hiện cả đối với DNA tách chiết từ thịt xử lý nhiệt ở 1000C hay 1200C, riêng đối với thịt ngựa thì không phát hiện đƣợc ở 1200C. Giới hạn nhỏ nhất của nồng độ DNA mà phản ứng PCR còn phát hiện đƣợc là 0,25 ng. Năm 2000, Montiel-Sosa và ctv đã thiết kế cặp mồi có tính chuyên biệt cao trên đoạn bảo tồn của gen mtDNA. Cặp mồi này đƣợc dùng để khuếch đại đoạn DNA dài 531bp của gia cầm bằng phƣơng pháp PCR. Phƣơng pháp này tỏ ra hữu dụng đối với cả thịt tƣơi và hỗn hợp thịt chế biến bao gồm thịt phơi khô và thịt nấu chín từ bò, cừu, gà. Năm 2004, Myers và ctv cũng đã dựa vào đoạn mtDNA để thiết lập phản ứng multiplex PCR nhằm phát hiện thịt các loài bò, heo, cừu, dê, ngựa trong thức ăn chó. Giới hạn DNA để phát hiện là 1 g/kg. Kết quả cho thấy chỉ có 27 mẫu trong tổng số 31 mẫu là chứa thịt bò và heo (các mẫu thức ăn chó đƣợc ghi trên nhãn là chỉ gồm thịt bò và heo). 18 Chƣơng 3 NỘI DUNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 3.1 Nội dung thực hiện (1) Tách chiết DNA từ thịt tƣơi và thịt xử lý nhiệt ở: 800C/15’, 1200C/15’, 120 0C/30’, 1300C/15’. (2) Thực hiện phản ứng single PCR (s-PCR) đối với DNA từ ba loại thịt tƣơi (heo, bò, cừu) để làm cơ sở cho phản ứng multiplex PCR (m-PCR). (3) Tối ƣu hóa quy trình m-PCR để xác định loại thịt trong hỗn hợp thịt tƣơi xay nhuyễn. (4)Thực hiện phản ứng s-PCR đối với DNA từ thịt xử lý ở nhiệt độ: 800C/15’, 120 0C/15’, 1200C/30’, 1300C/15’. (5) Thực hiện phản ứng m-PCR để xác định ba loại thịt heo, bò, cừu. Thực hiện phản ứng m-PCR đối với hỗn hợp DNA heo, bò, cừu có nồng độ của DNA bò, cừu giảm dần để xác định ở nồng độ nào phản ứng m-PCR vẫn còn phát hiện đƣợc hai loài này. Thực hiện phản ứng m-PCR với hỗn hợp thịt đã xử lý ở các nhiệt độ 80 0C/15’, 1200C/15’, 1200C/30’, 1300C/15’. (6) Thực hiện phản ứng m-PCR phát hiện thịt heo, bò, cừu trong bột thịt. 3.2 Thời gian và địa điểm tiến hành Đề tài đƣợc tiến hành từ ngày 01-02-2007 đến ngày 30-07-2007 tại Trung Tâm Phân Tích Thí Nghiệm trƣờng Đại Học Nông Lâm TP.Hồ Chí Minh. 19 3.3 Vật liệu 3.3.1 Nguồn mẫu tách chiết DNA Mẫu cơ vân đƣợc lấy từ thịt heo, bò, cừu mua ở siêu thị Metro TP. Hồ Chí Minh. Mẫu bột xƣơng thịt sử dụng trong thức chế biến thức ăn gia súc của các hãng CE, A, VY. 3.3.2 Đoạn mồi Matsugana và ctv (1998) đã xác định đƣợc trình tự bảo toàn trên gen mtDNA, dựa vào trình tự này tác giả đã thiết kế đoạn mồi xuôi chung cho DNA thịt heo, bò, cừu. Đoạn mồi này đƣợc kí hiệu là FSIM: 5’– GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA – 3’ Tuy nhiên ở mỗi loài thú khác nhau sẽ có những trình tự trên gen mtDNA khác nhau, từ đó tác giả cũng đã thiết kế mồi xuôi cho từng loại gia súc heo, bò, cừu, đƣợc kí hiệu lần lƣợt là: RP, RB, RS: RP: 5’ – GCTGATAGTAGATTTGTGATGACCGTA – 3’. RB: 5’ – CTAGAAAAGTGTAAGACCCGTAATATAAG – 3’. RS: 5’ – CTATGAATGCTGTGGCTATTGTCGCA – 3’. 3.3.3 Hóa chất 3.3.3.1 Hóa chất dùng trong tách chiết DNA Tris-HCl, NaCl, SDS, EDTA, proteinase K, sodium acetate, isoamyl alcohol, phenol, chloroform, ethanol, TE 1 X. 3.3.3.2 Hóa chất dùng trong điện di Agarose, TBE 0,5 X (Tris borate EDTA, pH = 8,3), loading dye 6 X, ladder 100bp, 200bp, ethidium bromide. 20 3.3.3.3 Hóa chất dùng trong phản ứng PCR Taq DNA polymerase: 5UI/µl (Promega), dung dịch đệm 10X (Promega), dNTP 25 mM (Promega), MgCl2 25 mM (Promega), 4 đoạn mồi (khuếch đại gen mtDNA ở heo, bò, cừu), nƣớc cất 2 lần (khử ion, hấp vô trùng, chiếu UV, pH 6,8 –7). 3.3.3.4 Thiết bị và dụng cụ Tủ sấy (Jencons - PLS), water bath (Memmert), autoclave (Tommy), máy cất nƣớc (khử ion) (Branstead), máy ly tâm (Mikro Z2K/Sigma 3K30C), tủ trữ mẫu và hóa chất (Reetech, Brandt, Sanyo), máy chụp gel (Biorad), máy luân nhiệt (Eppendorf, version 2.11.32), bộ điện di (Biorad), máy đo OD (Hewlett Packard), micropipet, đầu tip, eppendorf, kéo, chày, kẹp… 3.4 Phƣơng pháp tiến hành 3.4.1 Lấy và bảo quản mẫu Mua 500 g mỗi loại thịt bỏ vào túi nilon sạch kích thƣớc 5 x 10 cm, dán nhãn cho mỗi loại thịt, trữ trong thùng đá, đem về phòng thí nghiệm, trữ ở –700C. 3.4.2 Phối hợp các loại thịt để tạo hỗn hợp thịt và xử lý nhiệt Mỗi loại thịt, lấy khoảng 150 g đem nghiền nhuyễn bằng máy nghiền mẫu. Sau đó đem cân và trộn các loại thịt với tỉ lệ thịt heo, bò, cừu giảm dần (bảng 3.1). Mỗi túi mẫu có khối lƣợng 20 g. 21 Bảng 3. 1 Tỷ lệ các loại thịt trong các hỗn hợp thịt STT Đơn vị tính Thịt heo Thịt bò Thịt cừu 1 % 50 50 0 g 10 10 0 2 % 50 0 50 g 10 0 10 3 % 50 25 25 g 10 5 5 4 % 80 10 10 g 16 2 2 5 % 90 5 5 g 18 1 1 6 % 98 1 1 g 19,6 0,2 0,2 Sau đó chia mỗi hỗn hợp thành 4 phần, bỏ vào các túi nilon chịu nhiệt có dán nhãn ghi rõ về thành phần, tỉ lệ, nồng độ và thời gian xử lí nhiệt. Hấp hỗn hợp thịt bằng nồi hấp autoclave ở các nhiệt độ và thời gian: 800C/15 phút, 1200C/15 phút, 120 0C/30 phút, 1300C/15 phút. Làm nguội và trữ lạnh ở - 700C cho đến khi sử dụng. 3.4.3 Tách chiết DNA * Qui trình tách chiết Sau khi rã đông mẫu ở nhiệt độ phòng, tách chiết DNA theo dẫn liệu của Lƣơng Quý Phƣơng (2006). 1. Cho khoảng 0,1 g mẫu vào eppendorf 1,5 ml. Dùng chày nghiền nhuyễn mẫu. 2. Cho vào 60 µl dung dịch đệm tách chiết (50 mM Tris-HCl, 20 mM NaCl, 1 mM EDTA và 1% SDS, pH= 8) và 3 µl dung dịch protease K (20 mg/ml). Ủ hỗn hợp ở 55oC trong 1h. 22 3. Cho vào 375 µl nƣớc cất khử ion vô trùng; vortex 14000 vòng/phút trong 30 giây. Cho thêm 200 µl dung dịch hỗn hợp phenol/chloroform/isoamyl alcohol (25:24:1); vortex 14000 vòng/phút trong 1 phút; ly tâm 12000 vòng/phút trong 2 phút ở 10oC. 4. Lấy phần nƣớc nổi bên trên chuyển vào eppendorf 1,5 ml mới đã có sẵn 1 ml dung dịch cồn tuyệt đối; trộn đều; ủ – 20oC trong 1 giờ. 5. Ly tâm 12000 vòng/phút trong 2 phút ở 10oC; lấy cặn làm ráo. 6. Rửa cặn bằng 1ml ethanol 70 %, ly tâm 12000 vòng/phút trong 2 phút ở 10 oC, lấy cặn. 7. Làm khô cặn trong tủ ấm ở 55oC. 8. Hòa tan cặn bằng 200 µl dung dịch TE; ủ 55oC trong 2 giờ. Sản phẩm DNA sau khi tách chiết đƣợc trữ ở – 20oC hoặc sử dụng ngay. Kiểm tra độ tinh sạch DNA bằng cách đo mật độ quang (OD: optical density) ở bƣớc sóng 260 nm và 280 nm bằng quang phổ kế (model HP 8453). Hàm lƣợng DNA đƣợc ƣớc lƣợng theo công thức DNA (ng/μl) = 62,9*OD260nm – 36*OD280nm. Các mẫu DNA tách chiết có tỷ số OD260 nm/OD280 nm (tỷ số OD) trên 1,6 đƣợc sử dụng cho PCR. Sau khi đo OD, chúng tôi pha loãng mẫu đến nồng độ 100 ng/ l. Kết quả OD đƣợc xử ký bằng phần mền Statgraphics Version 7.0. 3.4.4 Thực hiện phản ứng s-PCR Để tìm quy trình PCR phù hợp cho việc xác định 3 loại thịt heo, bò, cừu trong hỗn hợp thịt, đầu tiên chúng tôi thử nghiệm phản ứng s-PCR theo quy trình của Matsugana và ctv (1998). Thành phần phản ứng đƣợc trình bày trong bảng 3.2 và bảng 3.3 23 Bảng 3. 2 Thành phần hóa chất PCR Tên hóa chất Nồng độ cuối Dung dịch đệm PCR 1X MgCl2 1,5 mM FSIM 0,4 M reversal Tùy mỗi loại thịt (bảng 3.3) dNTP 200 µM/mỗi loại Taq 1,25 UI DNA mỗi loại 100 ng /phản ứng H2O cất vừa đủ 50 µl Bảng 3. 3 Nồng độ mồi ngƣợc đối với mỗi loại thịt trong s-PCR Tên mồi Nồng độ mồi ( M) RP 0,24 RB 0,24 RS 1,2 Và có chu trình nhiệt nhƣ bảng 3.4. Bảng 3. 4 Chu trình nhiệt của phản ứng Giai đoạn Diễn giải Nhiệt độ 1 Tiền biến tính 940C trong 4 phút 2 Lặp lại 35 chu kỳ Biến tính Bắt cặp Kéo dài 94 0 C trong 30 giây. 60 0C trong 30 giây 72 0C trong 30 giây 3 Kéo dài cuối cùng 720C trong 5 phút 24 3.4.5 Tối ƣu hóa phản ứng m-PCR 3.4.5.1 Thực hiện m-PCR theo quy trình của Matsugana và ctv (1998) Đầu tiên, chúng tôi thực hiện phản ứng m-PCR theo quy trình của Matsugana và ctv (1998). Thành phần phản ứng đƣợc trình bày ở bảng 3.5. Bảng 3. 5 Thành phần hóa chất PCR Tên hóa chất Nồng độ cuối Dung dịch đệm PCR 1X MgCl2 1,5 mM FSIM 0,4 M RP 0,24 M RB 0,24 M RS 1,2 M dNTP 200 µM/mỗi loại Taq 1,25 UI DNA tổng số (hỗn hợp heo, bò, cừu) 100 ng /phản ứng H2O cất vừa đủ 50 µl Chu trình nhiệt của phản ứng tƣơng tự bảng 3.4 Chúng tôi thực hiện lặp lại 3 lần để khẳng định quy trình. 3.4.5.2 Thí nghiệm điều chỉnh thành phần phản ứng Để tối ƣu hóa phản ứng PCR, trƣớc tiên chúng tôi thực hiện việc giảm thể tích phản ứng xuống còn 30 l và giữ nguyên nồng độ cuối nhƣ bảng 3.5. Sau đó, chúng tôi chỉnh lại nồng độ Mg2+ (lên 2 mM thay vì 1,5 mM) để tăng độ hoạt động của Taq polymerase. 3.4.5.3 Thí nghiệm điều chỉnh chu trình nhiệt Giảm nhiệt độ bắt cặp từ 600C xuống 560C và 540C đồng thời giữ nguyên thời gian của chu trình nhiệt. 25 Giảm nhiệt độ bắt cặp xuống còn 540C và tăng thời gian lúc biến tính, bắt cặp và kéo dài (bảng 3.6) Bảng 3. 6 Chu trình nhiệt của phản ứng trƣớc và sau khi điều chỉnh Giai đoạn Chu trình nhiệt chƣa điều chỉnh Chu trình nhiệt đã điều chỉnh Nhiệt độ Thời gian Nhiệt độ Thời gian Biến tính 940C 30 giây 940C 1 phút Bắt cặp 600C 30 giây 540C 45 giây Kéo dài 720C 30 giây 720C 1 phút 3.4.5.4 Thí nghiệm điều chỉnh nồng độ mồi trong 1 phản ứng Giảm nồng độ mồi của loại thịt có sản phẩm PCR đậm và rõ để loại trừ việc mồi tác dụng mạnh ức chế mồi tác dụng yếu - giảm RS (bảng 3.7). Bảng 3. 7 Điều chỉnh nồng độ mồi RS (giảm) Tên mồi Nồng độ mồi gốc ( M) Điều chỉnh lần 1 ( M) Điều chỉnh lần 2 ( M) Điều chỉnh lần 3 ( M) FSIM 0,4 0,4 0,4 0,4 RP 0,24 0,24 0,24 0,24 RB 0,24 0,24 0,24 0,24 RS 1,2 0,67 0,33 0,17 Tiếp tục giảm RS xuống còn 0,17 M đồng thời tăng RP (tăng nồng độ mồi của đối tƣợng không xuất hiện rõ band sản phẩm PCR) cụ thể đƣợc trình bày ở bảng 3.8. 26 Bảng 3. 8 Điều chỉnh nồng độ mồi RP (tăng) Tên mồi Nồng độ mồi gốc ( M) Điều chỉnh lần 4 ( M) Điều chỉnh lần 5 ( M) Điều chỉnh lần 6 ( M) Điều chỉnh lần 7 ( M) FSIM 0,4 0,4 0,4 0,4 0,4 RP 0,24 0,33 0,5 0,67 0,83 RB 0,24 0,24 0,24 0,24 0,24 RS 1,2 0,17 0,17 0,17 0,17 Sau khi tìm ra quy trình m-PCR thích hợp để phát hiện ba loại thịt heo, bò, cừu tƣơi, chúng tôi tiếp tục lặp lại phản ứng 3 lần để khẳng định tính ổn định của quy trình này. 3.4.6 Thực hiện phản ứng m-PCR hai loài (heo, bò và heo, cừu) ở các nồng độ DNA khác nhau Sau khi tìm ra quy trình m-PCR thích hợp, trƣớc tiên chúng tôi thử nghiệm phản ứng với hai đối tƣợng heo và bò, heo và cừu để xác định ở nồng độ nào DNA của bò, cừu phản ứng m-PCR còn phát hiện đƣợc, làm cơ sở thực hiện phản ứng m-PCR của DNA cả ba loài. Việc thực hiện thí nghiệm với các nồng độ DNA giảm dần của bò, cừu nhằm tạo cơ sở xét nghiệm các sản phẩm chỉ gian lận một lƣợng rất nhỏ hai lọai thịt này. Thực hiện phản ứng m-PCR đối với DNA thịt heo, bò, chúng tôi phối hợp DNA theo các nồng độ ở bảng 3.9. Bảng 3. 9 Phối hợp DNA của heo và bò ở các nồng độ khác nhau Ký hiệu Nồng độ DNA heo (ng/ l) Nồng độ DNA bò (ng/ l) Tỷ lệ (%) T1.1 50 50 50:50 T1.2 75 25 75:25 T1.3 80 20 80:20 T1.4 95 5 95:5 T1.5 99 1 99:1 27 Nồng độ mồi của phản ứng này đƣợc tối ƣu ở bảng 3.8 Thực hiện phản ứng m-PCR với hai đối tƣợng heo, cừu ở các nồng độ DNA đƣợc trình bày trong bảng 3.10. Bảng 3. 10 Phối hợp DNA của heo và cừu ở các nồng độ khác nhau Ký hiệu Nồng độ DNA heo (ng/ l) Nồng độ DNA cừu (ng/ l) Tỷ lệ (%) T2.1 50 50 50:50 T2.2 50 25 75:25 T2.3 80 20 80:20 T2.4 95 5 95:5 T2.5 99 1 99:1 3.4.7 Thực hiện phản ứng m-PCR cho hỗn hợp DNA heo, bò, cừu Để tạo cơ sở cho việc thực hiện phản ứng m-PCR ở các nồng độ DNA heo, bò, cừu khác nhau và để xác định ở nồng độ nào của DNA bò, cừu mà phản ứng m-PCR còn phát hiện đƣợc, chúng tôi phối trộn DNA theo các tỷ lệ khác nhau nhƣ bảng 3.11. Bảng 3. 11 Thành phần các hỗn hợp DNA heo, bò, cừu STT Kí hiệu hỗn hợp Tỷ lệ của hỗn hợp (heo, bò, cừu) 1 C1.1 50:50:0 2 C1.2 50:0:50 3 C1.3 50:25:25 4 C1.4 80:10:10 5 C1.5 90:5:5 6 C1.6 98:1:1 3.4.8 S-PCR đối với DNA của thịt xử lý nhiệt ở các nhiệt độ khác nhau: 80 0 C/15 phút, 1200C/15 phút, 1200C/30 phút, 1300C/15 phút Nhằm xác định mức độ biến tính và xác định sự phù hợp của quy trình đối với DNA tách chiết từ thịt đã xử lý nhiệt, chúng tôi thực hiện phản ứng s-PCR cho 28 DNA của từng loại thịt xử lý nhiệt ở: 800C/15 phút, 1200C/15 phút, 1200C/30 phút, 130 0C/15 phút. Thực hiện phản ứng này theo chu trình nhiệt tối ƣu đã xác định ở bảng 3.6 và nồng độ mồi tối ƣu (bảng 3.8). 3.4.9 M-PCR để phát hiện thịt heo, bò, cừu trong các hỗn hợp thịt xử lý nhiệt ở các nhiệt độ khác nhau Để khẳng định khả năng phát hiện cùng lúc ba loại thịt heo, bò, cừu xử lý nhiệt đồng thời xác định ở nồng độ nào của thịt bò, cừu phản ứng m-PCR vẫn còn phát hiện đƣợc hai loài này. Tiến hành thí nghiệm này với tỉ lệ các mồi tƣơng tự ở bảng 3.8 và với các hỗn hợp thịt theo bảng 3.12. Bảng 3. 12 Hỗn hợp thịt ở các nhiệt độ xử lý khác nhau Tỷ lệ thịt heo: bò:cừu trong các hỗn hợp Kí hiệu hỗn hợp thịt biến tính ở 80 0C/15 phút Kí hiệu hỗn hợp thịt biến tính ở 120 0C/15 phút Kí hiệu hỗn hợp thịt biến tính ở 120 0C/30 phút Kí hiệu hỗn hợp thịt biến tính ở 130 0C/15 phút 50:50:0 C2.1 C3.1 C4.1 C5.1 50:0:50 C2.2 C3.2 C4.2 C5.2 50:25:25 C2.3 C3.3 C4.3 C5.3 80:10:10 C2.4 C3.4 C4.4 C5.4 90:5:5 C2.5 C3.5 C4.5 C5.5 98:1:1 C2.6 C3.6 C4.6 C5.6 3.4.10 M-PCR đối cới bột thịt làm nguyên liệu thức ăn gia súc Với mục đích đánh giá khả năng ứng dụng của quy trình m-PCR này chúng tôi tiến hành xét nghiệm sản phẩm bột thịt trên thịt trƣờng. Chọn mẫu bột thịt của ba hãng: CE, A, VY. Sau khi tách chiết DNA và tiến hành m-PCR, chúng tôi điện di cùng với ba đối chứng s-PCR của heo, bò, cừu để xác định nguồn gốc của các loại bột thịt trên. 29 Chƣơng 4 KẾT QUẢ VÀ THẢO LUẬN 4.1 Kết quả tách chiết DNA thịt heo, bò, cừu (thịt tƣơi và thịt xử lý nhiệt) đƣợc tách chiết theo quy trình đƣợc trích dẫn bởi Lƣơng Quý Phƣơng (2006). Kết quả đo OD thịt heo, bò, cừu (thịt tƣơi) đƣợc trình bày ở bảng 4.1. Bảng 4. 1 Tỷ số OD và hàm lƣợng DNA của thịt bò, heo, cừu Chỉ tiêu DNA thịt bò ( X ± SD) DNA thịt heo ( X ± SD) DNA thịt cừu ( X ± SD) Xác xuất thống kê Tỷ số OD 1,93 ± 0,3 2,09 ± 0,24 2,03 ± 0,26 P = 0,46 Hàm lƣợng DNA (µg /µl) 0,15 ± 0,08 0,32 ± 0,1 0,43 ± 0,2 P = 0,0001 Tổng số mẫu 14 14 14 1.93 0.154 2.14 0.32 2.03 0.426 0 0.5 1 1.5 2 2.5 bò heo cừu Loại thịt tỷ số OD nồng độ DNA Biểu đồ 4. 1 So sánh tỷ số OD và nồng độ DNA của thịt heo, bò, cừu 30 Kết quả bảng 4.1 cho thấy độ tinh sạch của DNA tách chiết từ thịt heo, bò, cừu khác nhau không ý nghĩa (p > 0,05). Hàm lƣợng DNA của ba loại thịt khác nhau có ý nghĩa (p<0,001). Cả ba loại thịt trên đều đƣợc ly trích cùng một quy trình nên DNA thu đƣợc có độ tinh sạch giống nhau. Tuy nhiên mỗi loài gia súc khác nhau thì số tế bào cơ trên đơn vị diện tích hoặc đơn vị khối lƣợng cũng khác nhau do đó hàm lƣợng DNA tách chiết từ ba loại thịt trên là khác nhau. Cụ thể là hàm lƣợng DNA tách chiết từ thịt bò thì khác biệt so với thịt heo và thịt cừu còn hàm lƣợng DNA từ thịt heo và thịt cừu khác nhau nhƣng không có ý nghĩa (phụ lục 4). Sự sai khác này phụ thuộc vào: tỉ lệ nƣớc, hàm lƣợng mô liên kết, vị trí cơ thể học, mức độ luyện tập của thú và nhiêṭ đô ̣xử lý. Kết quả đo OD thịt tƣơi, thịt xử lý nhiệt của thịt thuần loài với số lƣợng mẫu của mỗi loài đều bằng nhau ở hai loại này (bảng 4.2). Bảng 4. 2 Tỷ số OD và hàm lƣợng DNA tách chiết từ thịt tƣơi và thịt xử lý nhiệt Chỉ tiêu DNA thịt tƣơi ( X ± SD) DNA xử lý nhiệt ( X ± SD) Xác xuất thống kê Tỷ số OD 2,02 ± 0,2 1,95 ± 0,2 P = 0,24 Hàm lƣợng DNA (µg /µl) 0,37 ± 0,02 0,16 ± 0,09 P = 0,0000 Tổng số mẫu 32 32 2.02 0.356 1.95 0.59 0 0.5 1 1.5 2 2.5 thịt tươi thịt xử lý nhiệt Loại thịt tỷ số OD nồng độ DNA Biểu đồ 4. 2 So sánh tỷ số OD và nồng độ DNA của thịt tƣơi và thịt xử lý nhiệt 31 Kết quả cho thấy độ tinh sạch của DNA tách chiết từ loại thịt tƣơi và thịt xử lý nhiệt khác nhau có ý nghĩa (p>0,05) nhƣng hàm lƣợng DNA lại có sự khác biệt rõ rệt (p<0,0001). Tƣơng tự nhƣ, trên độ tinh sạch của DNA các mẫu thịt đƣợc ly trích cùng một quy trình nên không có sự khác biệt. Thịt đã xử lý nhiệt thì DNA đã bị biến tính một phần do đó hàm lƣợng thấp hơn so với thịt tƣơi. 4.2 Kết quả s-PCR đối với thịt tƣơi thuần loài theo quy trình của Matsugana và ctv (1998) Tiến hành phản ứng s-PCR theo quy trình của Matsugana và ctv (1998) với một loại DNA tách chiết từ loại thịt tƣơi đã biết trƣớc, kết quả thu đƣợc là mỗi giếng có một band sản phẩm PCR chuyên biệt cho từng loài (heo, cừu, bò) có kích thƣớc tƣơng ứng: 398, 331, 274 (hình 4.1). Vậy các cặp mồi trong quy trình Matsugana và ctv (1998) gồm: FSIM, RP, RB, RS (mục 3.2.2) có tính chuyên biệt cao và thích hợp cho việc phát hiện các loại thịt heo, bò, cừu. t. heo t. bò t.cừu lad Hình 4.1 Sản phẩm s-PCR theo quy trình của Matsugana và ctv (1998) 274 bp 331 bp 398 bp 32 4.3 Kết quả phản ứng m-PCR 3 loài theo quy trình của Matsugana và ctv (1998) Thực hiện quá trình phản ứng m-PCR theo quy trình của Matsugana và ctv với nồng độ hóa chất và DNA giữ nguyên nhƣ bảng 3.5, kết quả điện di cho thấy ở các mẫu thí nghiệm chỉ có 1 band 398 bp chuyên biệt cho thịt heo mà thôi (hình 4.2). Matsugana và ctv (1998) đã xác định các loại thịt trong thịt xử lý nhiệt chính xác 100% khi tiến hành với quy trình m-PCR này. Nhƣng khi m-PCR với cùng quy trình của Matsugana và ctv (1998), chúng tôi không thu đƣợc kết quả mong muốn (chỉ có một band DNA chuyên biệt cho thịt heo). Chúng tôi tiến hành thí nghiệm này với hóa chất của hãng Promega và điều kiện phòng thí nghiệm Đại học Nông lâm còn Matsugana và ctv (1998) thì tiến hành trong điều kiện ở Nhật Bản. Có thể điều này đã tạo ra sự khác biệt về kết quả. Chúng tôi cho rằng quy trình này chƣa phù hợp với việc phát hiện hỗn hợp DNA ba loài heo, bò, cừu với điều kiện thí nghiệm trong nƣớc hiện nay. t.heo H14 Hình 4.2 Sản phẩm m- PCR theo quy trình của Matsugana và ctv (1998) ĐC Quy trình của Matsugana Band heo (389 bp) Tạp 33 4.4 Kết quả quá trình thiết lập và tối ƣu hóa phản ứng m- PCR 4.4.1 Điều chỉnh thể tích phản ứng Bƣớc đầu tiên để tối ƣu hóa quy trình phản ứng m-PCR, chúng tôi tiến hành giảm chi phí thí nghiệm (giảm lƣợng hóa chất) bằng cách giảm thể tích xuống còn 30 l. Khi thực hiện m-PCR của hỗn hợp DNA thịt heo, bò, cừu (tỉ lệ 1:1:1) với thể tích phản ứng là 30 l, điện di mẫu cùng với hai đối chứng s-PCR của DNA heo, bò (thí nghiệm 4.2), kết quả chỉ thu đƣợc hai band DNA của thịt bò và cừu (274 bp và 331 bp), không thu đƣợc band DNA của thịt heo (hình 4.3). Có thể khi giảm thể tích phản ứng xuống còn 30 l đã tăng độ đồng đều về nhiệt độ trong phản ứng m-PCR do đó kết quả đạt đƣợc tốt hơn. 4.4.2 Kết quả thí nghiệm điều chỉnh nồng độ Mg2+ Sau khi tiến hành tăng nồng độ Mg2+ lên 2 mM, điện di mẫu m-PCR (của hỗn hợp DNA heo, bò, cừu tỉ lệ 1:1:1) với đối chứng là sản phẩm s-PCR của DNA cừu (mục 4.2), kết quả thu đƣợc lần này vẫn chỉ có hai band bò và cừu (274 bp và 331 bp) nhƣng đậm và rõ nét hơn (hình 4.4). Hình 4.3 Sản phẩm m-PCR khi điều chỉnh thể tích phản ứng Heo bò ĐC ĐC hỗn hợp Band bò (274 bp) Tạp Band cừu (331bp) Band heo (398 bp) 34 Theo Yale (1997), phản ứng m-PCR khi các sản phẩm kích thƣớc ngắn không xuất hiện thì một trong các biện pháp giải quyết để có đƣợc các sản phẩm mong muốn là tăng nồng độ Mg2+ và vẫn giữ nguyên nồng độ dNTP. Việc tăng nồng độ Mg 2+ sẽ làm cho phản ứng trở nên linh hoạt hơn, tăng hoạt tính của Taq polymerase, tăng lƣợng sản phẩm. Do đó chúng tôi đã thu đƣợc kết quả các band rõ hơn. 4.4.3 Kết quả thí nghiệm điều chỉnh chu trình nhiệt Giảm nhiệt độ bắt cặp từ 600C xuống 560C, 540C (hình 4.5): 56 0 C 54 0 C 56 0 C 54 0 C 56 0 C 54 0 C ĐC: tăng Mg2+ t.cừu Hình 4.4 Sản phẩm m-PCR sau khi tăng nồng độ Mg2+ Tạp Band bò (274bp) Band cừu (331bp) Band cừu (331 bp) ĐC Hỗn hợp (cừu) Hình 4.5 Sản phẩm m-PCR khi điều chỉnh nhiệt độ bắt cặp: 560C và 540C Band cừu (331pb) Band heo (mờ) (398bp) Tạp Band bò (mờ) (274bp) 56 0 C 54 0 C 35 Nhiệt độ bắt cặp có vai trò quan trọng trong phản ứng PCR, nó quyết định khả năng gắn mồi vào khuôn để khởi đầu tổng hợp nên sợi mới, do đó ảnh hƣởng lớn đến khả năng tạo sản phẩm PCR. Nhiệt độ bắt cặp phụ thuộc vào Tm của mồi. Nhƣng trong phản ứng m-PCR có nhiều cặp mồi do đó phải lựa chọn nhiệt độ bắt cặp sao sao phù hợp nhất đối với tất cả các mồi, thông thƣờng nhiệt độ này đƣợc lệch so với Tm là 5-100C. Theo Yale (1997), trong phản ứng PCR khi đã sử dụng cặp mồi chuyên biệt mà vẫn không xuất hiện sản phẩm mong muốn thì ta nên tăng khả năng bắt cặp của mồi vào khuôn bằng cách giảm nhiệt độ bắt cặp. Tuy nhiệt độ bắt cặp 600C là phù hợp đối với các đoạn mồi đã đƣợc thiết kế nhƣng trong điều kiện thí nghiệm của chúng tôi ở nhiệt độ bắt cặp này không thu đƣợc sản phẩm PCR của thịt bò. Cho nên chúng tôi đã tiến hành lần lƣợt giảm nhiệt độ bắt cặp xuống còn 560C và 540C. Khi nhiệt độ bắt cặp là 540C, kết quả thu đƣợc cả ba band sản phẩm PCR của ba loài. Tuy nhiên các band này chƣa đƣợc rõ. Vậy nhiệt độ 540C là nhiêt độ bắt cặp tƣơng đối thích hợp cho việc khuếch đại đồng thời DNA của ba loài thịt heo, bò, cừu. Giảm nhiệt độ bắt cặp xuống còn 540C và tăng thời gian biến tính, bắt cặp, kéo dài (lặp lại hai phản ứng). Kết quả thu đƣợc ba band sản phẩm DNA rõ nét hơn nhƣng vẫn chƣa hoàn toàn tối ƣu (band heo, bò còn vẫn mờ) (hình4.6). Lặp lai lần: 1 2 Lặp lại lần: 1 2 Band bò (274bp) Band cừu (331bp) Hình 4.6 Sản phẩm m-PCR khi điều chỉnh chu trình nhiệt Band heo (mờ)(398bp) Lặp lại lần: Lần 1 lần 2 Tạp 36 Theo Sambrook và Russell (2001), thời gian của mỗi bƣớc trong giai đoạn lặp lại của các chu kỳ ảnh hƣởng quyết định đến năng suất sản phẩm PCR. Nếu thời gian biến tính không đủ lâu để cắt đứt hoàn toàn các liên kết hidro trong mạch đôi thì giai đoạn bắt cặp sẽ không đạt hiệu quả cao. Thời gian kéo dài chuỗi ngắn quá cũng hình thành sản phẩm không chuyên biệt. Theo lý thuyết, tốc độ kéo dài chuỗi của Taq polymerase là 2000 nucleotide/phút. Tuy nhiên, trong thực tế, ngƣời ta thƣờng thấy loại Taq này kéo dài 1000 nucleotid trong vòng 1 phút. Theo quy trình của Matsugana và ctv (1998), thời gian trong mỗi bƣớc của giai đoạn lặp lại đều là 30 giây. Nhóm tác giả này đã xác định các loại thịt trong hỗn hợp thịt chế biến chính xác đến 100% khi tiến hành với chu trình nhiệt ấy. Nhƣng khi thí nghiệm với cùng chu trình của tác giả, chúng tôi hoàn toàn không thu đƣợc kết quả mong muốn (chỉ đƣợc một band DNA chuyên biệt cho thịt heo). Vì vậy chúng tôi đã tiến hành giảm nhiệt độ bắt cặp đã đƣợc xác định ở phần trên đồng thời tăng thời gian của các bƣớc: biến tính, bắt cặp và kéo dài, kết quả thu đƣợc sản phẩm PCR gồm ba band có thể nhận diện đƣợc ba loài heo, bò, cừu. Vậy chu trình nhiêt (giai đoạn 2) thích hợp cho phản ứng m-PCR phân biệt ba loài heo, bò, cừu là: biến tính ở 940C/1phút, bắt cặp ở 540C/45 giây, kéo dài ở 72 0C/1 phút. 4.4.4 Kết quả thí nghiệm điều chỉnh nồng độ mồi Giảm nồng độ RS. Kết quả mỗi giếng đều có 3 band nhƣng band DNA của thịt heo và thịt bò mờ hơn band DNA của thịt cừu. Tuy vậy ở giếng thứ 3 (với RS là 0,17 M) thì thu đƣợc kết quả rõ ràng nhất (hình 4.7). 37 Tăng nồng độ RP. Kết quả là ở mỗi lần điều chỉnh đều thu đƣợc 3 band heo bò cừu. Trong đó ở nồng độ RS (0,17 M) và RP (0,83 M) xuất hiện ba band tốt nhất (hình 4.8). Hình 4.7 Kết quả m-PCR khi giảm RS Điều chỉnh nồng độ RS ( M) Band cừu (331bp) 0,67 0,33 0,17 Tạp Band heo (398bp) Band bò (274bp) Hình 4.8 Kết quả m-PCR khi tăng RP Điều chỉnh nồng độ RP ( M) Band cừu (331bp) Tạp Band bò (274 bp) Band heo (389bp) 0,33 0,5 0,67 0,83 38 Ở mục 4.4.3, kết quả m-PCR thu đƣợc sau khi điều chỉnh chu trình nhiệt chỉ có band DNA của thịt cừu đậm và rõ còn band DNA của thịt bò và heo nhạt hơn nhiều. Theo Yale (1997), trong phản ứng m-PCR, nếu có một số sản phẩm PCR mạnh (band DNA đậm và rõ) và một số sản phẩm PCR khác yếu (band DNA không rõ) thì nên tăng nồng độ mồi của sản phẩm yếu và giảm nồng độ mồi của sản phẩm mạnh. Vì vậy sau khi điều chỉnh mồi nhƣ bảng 3.7, thu đƣợc RS (0,17 M) là tốt nhất, sau đó tiếp tục giữ nguyên lƣợng RS và tăng RP nhƣ bảng 3.8, chúng tôi đã thu đƣợc kết quả mong muốn (hình 4.8). Vậy nồng độ mồi FSIM: RP: RB: RS thích hợp cho phản ứng m-PCR phát hiện ba loại thịt heo, bò, cừu lần lƣợt là: 0,4: 0,83: 0,24: 0,17 M. 4.4.5 Kết quả kiểm tra tính ổn định của quy trình Sau ba lần lặp lại phản ứng m-PCR với quy trình tối ƣu (nồng độ mồi theo bảng 3.8), chúng tôi thấy cả ba lần đều có kết quả tốt – có ba band chuyên biệt cho ba loài heo, bò, cừu đậm và rõ (hình 4.9). Lặp lại 3 lần: 1 2 3 Lad Hình 4.9 Kết quả kiểm tra tính ổn định của quy trình 398 bp (heo) 331 bp (cƣ̀u) 274bp (bò) Tạp 39 Nhƣ vậy quy trình này là quy trình tối ƣu cho việc xác định ba loại thịt heo, bò, cừu. 4.5 Kết quả m-PCR đối với 2 loài Sau khi đã pha loãng DNA đến nồng độ 100ng/ l, chúng tôi tiến hành phối trộn các DNA theo bảng 3.9 và bảng 3.10 và tiến hành m-PCR, kết quả thu đƣợc nhƣ sau: Phản ứng m-PCR đối với heo, bò (hình 4.10). Phản ứng m-PCR đối với heo, cừu (hình 4.11). Hình 4.11 Sản phẩm m-PCR đối với DNA heo, cừu T2.1 T2.2 T2.3 T2.4 T2.5 Band heo (398bp) Band cừu (331bp) Tạp Band heo (398bp) Tạp Band bò (274bp) Hình 4.10 Sản phẩm m-PCR đối với heo, bò T1.1 T1.2 T1.3 T1.4 T1.5 40 Kết quả trên cho thấy ở nồng độ DNA tách chiết từ thịt bò, cừu 1ng/ l (trong hỗn hợp T5.1 và T5.2) vẫn còn có thể phát hiện bằng m-PCR. Theo Matsugana và ctv (1998), nồng độ DNA nhỏ nhất còn có thể phát hiện đƣợc bằng PCR là 0,25 ng/ l. 4.6 Kết quả m-PCR đối với các hỗn hợp DNA có nồng độ giảm dần của DNA bò, cừu Sau khi phối trộn DNA của heo, bò, cừu nhƣ bảng 3.11 và thực hiện phản ứng m-PCR, kết quả thu đƣợc là ở nồng độ 1ng/ l của DNA tách chiết từ thịt bò, cừu vẫn còn phát hiện đƣợc bằng PCR (hình 4.12). 4.7 Kết quả s-PCR của thịt xử lý nhiệt Mức nhiệt độ để xử lý sản phẩm thịt chế biến rất đa dạng tùy thuộc quy trình chế biến của nhà sản xuất và mục đích sử dụng sản phẩm. Các sản phẩm nhƣ xúc xích, lạp xƣởng... đƣợc xử lý ở 800C. Xúc xích tiệt trùng, thịt hộp các loại... thƣờng đƣợc xử lý ở 120 0C trở lên. Riêng đối với bột thịt sử dụng trong chế biến thức ăn gia súc đƣợc xử lý ở 1300C. Do đó chúng tôi tiến hành các thí nghiệm s-PCR đối với thịt xử lý nhiệt ở các nhiệt độ: 800C/15 phút, 1200C/15 phút, 1200C/30 phút, 1300C/15 phút. Mục đích của thí nghiệm là xác định hiệu quả của phƣơng pháp PCR đối với thịt xử lý ở vài mức Hình 4.12 Kết quả m-PCR của các hỗn hợp DNA C1.1 C1.2 C1.3 C1.4 C1.5 C1.6 Band heo (398bp) Band bò (274) Band cừu (331bp) 41 nhiệt độ và thời gian xử lý trên để làm cơ sở xác định các loại thịt chế biến lƣu hành trên thị trƣờng. Kết quả thu đƣợc nhƣ sau: Phản ứng s-PCR đối với thịt xử lý nhiệt ở 800C/15 phút (hình 4.13). Phản ứng s-PCR đối với thịt xử lý nhiệt ở 1200C/15 phút (hình 4.14). Band bò (274bp) Hình 4.13 Kết quả s – PCR đối với thịt xử lý nhiệt ở 80 0C/15 phút t.heo t.bò t.cừu Band cừu (331pb) Band heo (398bp) Hình 4.14 Kết quả s-PCR đối với thịt xử lý nhiệt ở 120 0C/15 phút Tạp Band cừu (331bp) t.heo t.bò t.cừu Band heo (398bp) Band bò (274bp) 42 Phản ứng s-PCR đối với thịt xử lý nhiệt ở 1200C/30 phút (hình 4.15). Phản ứng s-PCR đối với thịt xử lý nhiệt ở 1300C/15 phút (hình 4.16). t.heo t.bò t.cừu Hình 4.15 Kết quả s-PCR của thịt xử lý nhiệt ở 1200C/30 phút Band cừu (331bp) Band bò (274bp) Band heo (398bp) Tạp t.heo t.bò t.cừu Hình 4.16 Kết quả s-PCR của thịt xử lý nhiệt ở 1300C/15 phút Band heo ( (398bp) Band bò (274bp) Band cừu (331bp) t.heo t.bò t.cừu Tạp 43 Kết quả thí nghiệm cho thấy khi xử lý thịt ở: 800C/15phút, 1200C/15phút, 120 0C/30 phút, 1300C/15 phút thịt chƣa bị biến tính nhiều. Theo Ali (2005), thịt bò (mô cơ) xử lý ở 970C/200 phút và 1200C/90 phút vẫn phát hiện đƣợc bằng phƣơng pháp PCR. Năm 2003, Cheng và ctv cũng đã xác định bột xƣơng thịt xử lý ở 133 0 C/20 phút vẫn có thể cho sản phẩm PCR. Cho nên ở các nhiệt độ trong thí nghiệm của chúng tôi các loại thịt vẫn chƣa bị biến tính nhiều và cho kết quả s-PCR tốt. Vậy quy trình PCR tối ƣu hóa với tỷ lệ các mồi nhƣ bảng 3.8 thích hợp cho việc xác định DNA của thịt xử lý nhiệt từ 800C đến 1300C/15 phút. 4.8 Kết quả m-PCR đối với các hỗn hợp thịt xử lý nhiệt Kết quả m-PCR đối với các hỗn hợp thịt xử lý nhiệt ở 800C/15 phút (hình 4.17). Kết quả m-PCR đối với các hỗn hợp thịt xử lý nhiệt ở 1200C/15 phút (hình 4.18). Hình 4.17 Kết quả m-PCR đối với hỗn hợp thịt xử lý ở nhiệt độ 80 0C/15 phút C2.1 C2.2 C2.3 C2.4 C2.5 C2.6 Band bò (274bp) Band cừu (331bp) Band heo (398 bp) 44 Kết quả m-PCR đối với các hỗn hợp thịt xử lý nhiệt ở 1200C/30 phút (hình 4.19) Tạp Hình 4.18 Kết quả m – PCR đối với hỗn hợp thịt xử lý nhiệt ở1200C/15 phút Band bò (274bp) Band cừu (274bp) Band heo (398bp) C3.1 C3.2 C3.3 C3.4 C3.5 C3.6 Hình 4.19 Kết quả m-PCR đối với hỗn hỗn hợp xử lý nhiệt 120 0C/30 phút. C4.1 C4.2 C4.3 C4.4 C4.5 C4.6 Band bò (274 bp) Band cừu (331 bp) Band heo (398 bp) Tạp 45 Kết quả m-PCR đối với các hỗn hợp thịt xử lý nhiệt ở 1300C/15 phút – điện di với ladder để đối chứng (hình 4.20). Các kết quả này cho thấy, quy trình m-PCR của chúng tôi hoàn toàn có khả năng ứng dụng để phát hiện ba loại thịt heo, bò, cừu trong hỗn hợp thịt đã xử lý nhiệt. Với quy trình này, ở tỷ lệ 1% của thịt bò, cừu trong hỗn hợp thịt (C2.6, C3.6, C4.6, C5.6) đã xử lý từ 800C đến 1300C/15 phút vẫn còn phát hiện đƣợc. 4.9 Kết quả m-PCR đối với bột thịt Khi đã xác định đƣợc quy trình này hoàn toàn phù hợp để xác định thịt đã xử lý nhiệt, chúng tôi tiến hành m-PCR trên đối tƣợng bột thịt của 3 cơ sở: CE, A, VY. Qua điện di ba mẫu PCR bột thịt cùng với ba đối chứng là sản phẩm s-PCR của DNA thịt heo, bò, cừu (mục 4.2), kết quả thu đƣợc: bột thịt CE có nguồn gốc từ thịt heo, còn bột thịt A và VY có nguồn gốc từ thịt bò (hình 4.21). Tạp Lad C5.1 C5.2 C5.3 C5.4 C5.5 C5.6 Hình 4.20 Kết quả m-PCR của các hỗn hợp thịt xử lý nhiệt ở 1300C/15 phút Band cừu (274 bp) Band heo (398 bp) Band bò (331 bp) 46 Hình 4.21 Sản phẩm m-PCR của bột thịt 3 đối chứng T.heo T.bò T.cừu CE A VY Band bò (274 bp) Band heo (398 bp) Tạp 47 Chƣơng 5 KẾT LUẬN VÀ ĐỀ NGHỊ 5.1 Kết luận 1. Tách chiết DNA thành công đối với cả thịt tƣơi và thịt xử lý nhiệt ở 80 0C/15 phút, 1200C/15 phút, 1200C/30 phút, 1300C/15 phút với độ tinh sạch cao. 2. Thiết lập đƣợc quy trình m-PCR tối ƣu để phát hiện ba loài heo, bò, cừu trong hỗn hợp thịt chế biến. Quy trình này có thể áp dụng cho cả thịt tƣơi và thịt xử lý nhiệt ở nhiệt độ: 800C/15 phút, 1200C/15 phút, 1200C/30 phút, 1300C/15 phút. 3. Quy trình vẫn phát hiện đƣợc khi nồng độ DNA của thịt cừu và thịt bò ở mức 1 ng/ l và tỉ lệ trong hỗn hợp thịt là 1%. 4. Quy trình áp dụng đƣợc đối với việc phân tích bột thịt làm nguyên liệu cho thức ăn gia súc. 5.2 Đề nghị 1. Thử nghiệm quy trình m-PCR đối với hỗn hợp thịt xử lý ở các nhiệt độ cao hơn. 2. Tối ƣu hóa quy trình để thử nghiệm với các nồng độ DNA nhỏ hơn. 3. Thử nghiệm với nhiều loại thịt gia súc gia cầm khác để tiến tới một quy trình kiểm nghiệm và kiểm soát loài trong bột thịt nhập khẩu vào nƣớc ta. 4. Xây dựng quy trình định lƣợng DNA loài trong hỗn hợp thịt chế biến bằng phƣơng pháp real time PCR (RT- PCR). 48 TÀI LIỆU THAM KHẢO  Tài liệu tiếng Việt 1. Bùi Thị Cúc, 2006. Tình hình xuất nhập khẩu động vật và các sản phẩm động vật. Cục Thú y /Department of animal heath of Việt Nam. 2. Hồ Huỳnh Thùy Dƣơng, 2002. Sinh Học Phân Tử (Khái Niệm - Phương Pháp - ứng Dụng). Tái bản lần 2, NXB Giáo Dục, Thành Phố Hồ Chí Minh. 3. Hồ Thị Nguyệt Thu, 2003. Giáo trình môn học chế biến thịt. Giáo trình môn học, khoa công nghệ thực phẩm trƣờng Đại Học Nông Lâm Thành Phố Hồ Chí Minh. 4. Lƣơng Quý Phƣơng, 2006. Sản xuất bộ kit tách chiết DNA và bộ kit PCR phát hiện gen halothan trên heo. Khóa luận tốt nghiệp kỹ sƣ công ngệ sinh học, Trƣờng Đại Học Nông Lâm Thành Phố Hồ Chí Minh, Việt Nam. 5. Nguyễn Đình Trung, Nguyễn Minh Tâm, 2005. Giáo trình Giải phẩu sinh ký vật nuôi. NXB Hà Nội. Tr. 38-39. 6. Nguyễn Ngọc Tuân, Lê Thanh Hiền, 2004. Chế biến bảo quản thịt và sữa. NXB Nông nghiệp, Thành Phố Hồ Chí Minh. Tr 11- 16. 7. Nguyễn Thị Lang, Bùi Chí Bửu, 1999. Sinh học phân tử. Giới thiệu và ứng dụng. Nhà xuất bản Nông nghiệp TP. Hồ Chí Minh. 8. Nguyễn Văn Uyển, 1995. Những phương pháp công nghệ sinh học thực vật, Tập 1. Nhà xuất bản nông nghiệp 9. Phạm Văn Ty, 2001. Miễn dịch học. Nhà xuất bản Đại học Quốc Gia Hà Nội 10. Trần Nhật Phƣơng, 2004. Protein array. Tài liệu giảng dạy, bộ môn công nghệ sinh học, trƣờng Đại Học Nông Lâm Thành Phố Hồ Chí Minh. Tr. 6-10. 11. Trần Thị Xô, Nguyễn Thị Lan, 1999. Cơ sở di truyền và công nghệ gen. NXB Khoa Học và Kỹ Thuật Hà Nội. Tr. 163-169. 49 12. Xmolxki N.T., 1997. Hóa sinh học thịt gia súc. NXB KHKT, Hà Nội. (Đặng Đức Dũng dịch). 165 trang.  Tài liệu tiếng nƣớc ngoài 13. Ali A., Irfan O., Calicioglu M. , 2005. Effect of method of cooking on identification of heat processed beef using polymerase chain reaction (PCR) technique. Meat science 72: 326-330. 14. Garfin E. David, 2000. Electrophoretic Methods. Academic Press, A Harcourt Science and Technology Company. 109 p. 15. Rybicki E.D., Purves M., 2003. SDS polyacrylamide gel electrophoresis (SDS-page). Deft Microbiology, University of Cape Town. 51 pg. 16. Romans R. John, Costello J. William, Carson C. Wendell, Greaser L. Mairon, Kevin W. Jones, 1999. The meat we eat. Interstate publishers, INC. 593p. 17. Myers J. Michael, Farrell E. Dorothy; Heller N. David, Yancy F. Haile, 2004. Development of a polymerase chain reaction-based method to identify species-specific components in dog food. Food and drug Administration. 18. Davidson W. Michael, 2005. Molecular expressions cell biology and Microscopy structure and fuction of cell and viruses: animal cell structure. The Florida State University. 19. Montiel-Sosa JF, Ruiz-Pesini E, Montoya J, Roncalés P, López-Pérez MJ, Pérez-Martos A, 2000. Direct and highly species-specific detection of pork meat and fat in meat products by PCR amplification of mitochondrial DNA. Departamento de Bioquímica y Biología Molecular y Celular, Facultad de Veterinaria, Universidad de Zaragoza, E-50013 Zaragoza, Spain. 20. Murray BW, McClymont RA, Strobeck C, 1995. Forensic identification of ungulate species using restriction digests of PCR-amplified mitochondrial DNA. Department of Biology, McMaster University, Hamilton, Ontario, Canada. 21. Sambrook Joseph and Russell W. David, 2001. Molecular cloning (A laboratory manual). 3 rd edition, Cold Spring Harbor laboratory press, New York, USA. Vol.2: p. 8.23, Vol.3: p. A8.13. 50 22. Sawyer M, Rensen G, Smith W, Yee M, Wong A, Osburn B, Cullor J, 1997. Overcoming RNA inhibition in the fluorescent polymerase chain reaction assay to enhance detection of bovine DNA in cattle feeds. Department of Population Health and Reproduction, School of Veterinary Medicine, University of California, Sawyer, California 95616, USA. 23. Matsugana T., Chikuni K., Tanabe R., Muroya S., Shibata K, Yamada J., Shinmura Y.,1998. A quick and simple method for the identification of meat species and meat products by PCR assay. Meat science 51: p. 143- 148. 24. Yale T., 1997. Troubleshooting for PCR and multiplex PCR. 25. Wayne RK., Geffen E., Girman DJ., Koepfli KP., Lau LM., Marshall CR., 1997. Molecular systematics of the Canidae. Department of Biology, University of California, Los Angeles, California 90095, USA. 26. Cheng Y.H., Wen C.M., Ding S.T., Kao C.C., Kuo T.Y., 2003. Detecting meat – bone meal in ruminant’s feeds by species – specific PCR. Journal of Animal and Sciences, 12, 2003, 851-860.  Tài liệu internet: 27. http:// www.cucthuy.gov.vn>. 28. >. 29. > 30. - 37k> 31. 4573.2006.00046.x 32. meat.htm. PHỤ LỤC Phụ lục 1: 30/08/07 03:05:53 PM Page 1 Analysis of Variance for TTTBT.tsod - Type III Sums of Squares ------------------------------------------------------------------------- ------- Source of variation Sum of Squares d.f. Mean square F-ratio Sig. level ------------------------------------------------------------------------- ------- MAIN EFFECTS A:TTTBT.mau .0819391 1 .0819391 1.374 .2457 RESIDUAL 3.6984594 62 .0596526 ------------------------------------------------------------------------- ------- TOTAL (CORRECTED) 3.7803984 63 ------------------------------------------------------------------------- ------- 0 missing values have been excluded. All F-ratios are based on the residual mean square error. 30/08/07 03:06:52 PM Page 1 Table of Least Squares Means for TTTBT.tsod ------------------------------------------------------------------------- ------- 95% Confidence Level Count Average Stnd. Error for mean ------------------------------------------------------------------------- ------- GRAND MEAN 64 1.9848438 .0305298 1.9238016 2.0458859 A:TTTBT.mau t 32 2.0206250 .0431757 1.9342984 2.1069516 c 32 1.9490625 .0431757 1.8627359 2.0353891 ------------------------------------------------------------------------- ------- 30/08/07 03:07:39 PM Page 1 Multiple range analysis for TTTBT.tsod by TTTBT.mau ------------------------------------------------------------------------- ------- Method: 95 Percent LSD Level Count LS Mean Homogeneous Groups ------------------------------------------------------------------------- ------- c 32 1.9490625 X t 32 2.0206250 X ------------------------------------------------------------------------- ------- contrast difference +/- limits t - c 0.07156 0.12208 ------------------------------------------------------------------------- ------- * denotes a statistically significant difference. Phụ lục 2: 30/08/07 03:08:40 PM Page 1 Analysis of Variance for TTTBT.NDDND - Type III Sums of Squares ------------------------------------------------------------------------- ------- Source of variation Sum of Squares d.f. Mean square F-ratio Sig. level ------------------------------------------------------------------------- ------- MAIN EFFECTS A:TTTBT.mau .7331641 1 .7331641 26.615 .0000 RESIDUAL 1.7078977 62 .0275467 ------------------------------------------------------------------------- ------- TOTAL (CORRECTED) 2.4410618 63 ------------------------------------------------------------------------- ------- 0 missing values have been excluded. All F-ratios are based on the residual mean square error. 30/08/07 03:09:12 PM Page 1 Table of Least Squares Means for TTTBT.NDDND ------------------------------------------------------------------------- ------- 95% Confidence Level Count Average Stnd. Error for mean ------------------------------------------------------------------------- ------- GRAND MEAN 64 .2660625 .0207465 .2245814 .3075436 A:TTTBT.mau t 32 .3730938 .0293400 .3144306 .4317569 c 32 .1590312 .0293400 .1003681 .2176944 ------------------------------------------------------------------------- ------- 30/08/07 03:09:52 PM Page 1 Multiple range analysis for TTTBT.NDDND by TTTBT.mau ------------------------------------------------------------------------- ------- Method: 95 Percent LSD Level Count LS Mean Homogeneous Groups ------------------------------------------------------------------------- ------- c 32 .1590312 X t 32 .3730938 X ------------------------------------------------------------------------- ------- contrast difference +/- limits t - c 0.21406 0.08296 * ------------------------------------------------------------------------- ------- * denotes a statistically significant difference. Phụ lục 3: 30/08/07 03:36:41 PM Page 1 Analysis of Variance for BPS.tisood - Type III Sums of Squares ------------------------------------------------------------------------- ------- Source of variation Sum of Squares d.f. Mean square F-ratio Sig. level ------------------------------------------------------------------------- ------- MAIN EFFECTS A:BPS.mau .1804513 2 .0902256 .785 .4637 RESIDUAL 4.1364154 36 .1149004 ------------------------------------------------------------------------- ------- TOTAL (CORRECTED) 4.3168667 38 ------------------------------------------------------------------------- ------- 0 missing values have been excluded. All F-ratios are based on the residual mean square error. 30/08/07 03:37:08 PM Page 1 Table of Least Squares Means for BPS.tisood ------------------------------------------------------------------------- ------- 95% Confidence Level Count Average Stnd. Error for mean ------------------------------------------------------------------------- ------- GRAND MEAN 39 2.0166667 .0542786 1.9065591 2.1267743 A:BPS.mau b 13 1.9269231 .0940133 1.7362111 2.1176350 p 13 2.0915385 .0940133 1.9008265 2.2822504 s 13 2.0315385 .0940133 1.8408265 2.2222504 30/08/07 03:37:42 PM Page 1 Multiple range analysis for BPS.tisood by BPS.mau ------------------------------------------------------------------------- ------- Method: 95 Percent LSD Level Count LS Mean Homogeneous Groups ------------------------------------------------------------------------- ------- b 13 1.9269231 X s 13 2.0315385 X p 13 2.0915385 X ------------------------------------------------------------------------- ------- contrast difference +/- limits b - p -0.16462 0.26971 b - s -0.10462 0.26971 p - s 0.06000 0.26971 ------------------------------------------------------------------------- ------- * denotes a statistically significant difference. Phụ lục 4: 30/08/07 03:14:08 PM Page 1 Analysis of Variance for BPS.dna - Type III Sums of Squares ------------------------------------------------------------------------- ------- Source of variation Sum of Squares d.f. Mean square F-ratio Sig. level ------------------------------------------------------------------------- ------- MAIN EFFECTS A:BPS.mau .4887762 2 .2443881 12.075 .0001 RESIDUAL .7286095 36 .0202392 ------------------------------------------------------------------------- ------- TOTAL (CORRECTED) 1.2173857 38 ------------------------------------------------------------------------- ------- 0 missing values have been excluded. All F-ratios are based on the residual mean square error. 30/08/07 03:14:37 PM Page 1 Table of Least Squares Means for BPS.dna ------------------------------------------------------------------------- ------- 95% Confidence Level Count Average Stnd. Error for mean ------------------------------------------------------------------------- ------- GRAND MEAN 39 .3005128 .0227805 .2543010 .3467246 A:BPS.mau b 13 .1544615 .0394570 .0744204 .2345027 p 13 .3206154 .0394570 .2405742 .4006565 s 13 .4264615 .0394570 .3464204 .5065027 ------------------------------------------------------------------------- ------- 30/08/07 03:15:05 PM Page 1 Multiple range analysis for BPS.dna by BPS.mau ------------------------------------------------------------------------- ------- Method: 95 Percent LSD Level Count LS Mean Homogeneous Groups ------------------------------------------------------------------------- ------- b 13 .1544615 X p 13 .3206154 X s 13 .4264615 X ------------------------------------------------------------------------- ------- contrast difference +/- limits b - p -0.16615 0.11320 * b - s -0.27200 0.11320 * p - s -0.10585 0.11320 ------------------------------------------------------------------------- ------- * denotes a statistically significant difference.

Các file đính kèm theo tài liệu này:

  • pdftrinh_thi_thanh_huyen_5196.pdf