Phân lập và định danh tác nhân gây bệnh đốm lá cây cải ngọt tại Tp Hồ Chí Minh bằng phương pháp PCR và giải trình vùng 16S – 23S RDNA

Mục đích đề tài nhằm định danh tác nhân gây bệnh bằng kỹ thuật PCR, giải trình tự gen nhằm làm cơ sở cho các nghiên cứu phòng và trị bệnh sau này. Các nội dung nghiên cứu bao gồm: 1. Phân lập tác nhân gây bệnh từ các mẫu bệnh thu được từ các vùng trồng rau ở huyện Củ Chi, Hóc Môn và quận 12, thành phố Hồ Chí Minh. 2. Dùng kỹ thuật PCR và giải trình tự gen nhằm định danh tác nhân gây bệnh. Kết quả thu được như sau: 1. Phân lập được 8 dòng vi khuẩn gây bệnh đốm lá tại các vùng trồng rau thuộc huyện Củ Chi, Hóc Môn và quận 12, Tp HCM. 2. Sử dụng kỹ thuật PCR đã khuyếch đại vùng 16S – 23S rDNA ITS làm vật liệu giải trình tự và gen hrpF đặc trưng của vi khuẩn gây bệnh. 3. Do hạn chế phương pháp giải trình tự gen không mang lại kết quả. Tuy nhiên, kết quả PCR cho phép xác định vi khuẩn gây bệnh thuộc giống Xanthomonas campestris pv. campestris. MỤC LỤC CHưƠNG TRANG Trang tựa Lời cảm tạ .i Tóm tắt ii Mục lục iii Danh sách các chữ viết tắt vi Danh sách các bảng . vii Danh sách các hình viii 1. MỞ ĐẦU 1 1.1.Đặt vấn đề 1 1.2.Mục đích và yêu cầu 2 1.2.1. Mục đích 2 1.2.2. Yêu cầu 3 2. TỔNG QUAN TÀI LIỆU .4 2.1. Tổng quan nghiên cứu ngoài nước 4 2.1.1. Lịch sử phát hiện và sự phân bố 4 2.1.2. Tác nhân và triệu chứng bệnh .5 2.1.3. Tác động kinh tế của bệnh. .6 2.1.4. Sinh lý, sinh thái và điều kiện phát triển bệnh .7 2.1.5. Hình thái, đặc điểm sinh lý, sinh hóa của vi khuẩn gây bệnh 8 2.1.6. Phương pháp phân lập và dịnh danh tác nhân gây bệnh 8 2.1.7. Những nghiên cứu về phát hiện và dịnh danh tác nhân gây bệnh bằng phương pháp sinh học phân tử .10 2.2. Tổng quan nghiên cứu trong nước 12 2.3. Vùng ITS (rDNA intergenic spacer) và gen hrpF (hypersensitive reaction and pathogenicity). . 13 2.3.1. Gen hrpF (hypersensitive reaction and pathogenicity). 13 2.3.2. Ribosome DNA (rDNA). 13 3. VẬT LIỆU VÀ PHưƠNG PHÁP TIẾN HÀNH . 15 3.1. Thời gian và địa điểm . 15 3.1.1. Thời gian . 15 3.1.2. Địa điểm 15 3.2. Vật liệu . 15 3.3. Hóa chất 15 3.3.1. Các hóa chất dùng ly trích DNA từ vi khuẩn 15 3.3.2. Các hóa chất dùng trong điện di 16 3.3.3. Hóa chất cho phản ứng PCR (do công ty Bio – Rad cung cấp) 16 3.3.4. Môi trường . 17 3.4. Dụng cụ, thiết bị 17 3.5. Phương pháp 17 3.5.1. Phương pháp thu thập mẫu bệnh . 17 3.5.2. Phương pháp phân lập vi sinh vật từ mẫu bệnh 18 3.5.3. Phương pháp chủng bệnh trên rau cải trồng trong nhà lưới 18 3.5.3.1. Phương pháp trồng cây kí chủ 18 3.5.3.2. Chủng bệnh . 19 3.5.4. Phương pháp ly trích DNA từ vi khuẩn 20 3.5.5. Phương pháp PCR .20 3.5.5.1. Khuếch đại đoạn DNA trong vùng ITS của vi khuẩn .20 3.5.5.2. Khuếch đại đọan DNA trong gen hrpF 22 3.5.6. Phương pháp điện di và đọc kết qủa .22 3.5.6.1. Điện di trên gel agarose 22 3.5.6.2. Đọc kết quả điện di .22 3.5.7. Phương pháp xác định trình tự gen từ sản phẩm PCR. .23 3.5.7.1. Chuẩn bị khuôn DNA .23 3.5.7.2. Phản ứng đọc trình tự sử dụng BigDye Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems). 24 3.5.7.3. Tinh sạch sản phẩm khuếch đại. 25 3.5.7.4. Chạy điện di và ghi nhận tín hiệu trên máy sequencer. .25 3.5.7.5. Quy trình tóm tắt các bước đọc trình tự. 26 4. KẾT QUẢ VÀ THẢO LUẬN .27 4.1. Kết quả thu thập và phân lập mẫu vi khuẩn gây bệnh 27 4.2. Kết quả chủng bệnh trên rau cải ngọt trồng trong nhà lưới 28 4.3. Kết quả ly trích và pha loãng DNA vi khuẩn. .31 4.4. Kết quả phản ứng PCR. .32 4.4.1. Kết quả PCR khuếch đại vùng ITS. .32 4.4.2. Kết quả điện di tinh sạch sản phẩm PCR .32 4.4.3. Kết quả PCR khuếch đại vùng hrpF. .33 5. KẾT LUẬN VÀ ĐỀ NGHỊ .34 TÀI LIỆU THAM KHẢO .36 PHỤ LỤC 39

pdf52 trang | Chia sẻ: lvcdongnoi | Ngày: 25/01/2013 | Lượt xem: 3101 | Lượt tải: 12download
Bạn đang xem nội dung tài liệu Phân lập và định danh tác nhân gây bệnh đốm lá cây cải ngọt tại Tp Hồ Chí Minh bằng phương pháp PCR và giải trình vùng 16S – 23S RDNA, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NÔNG LÂM TP. HCM BỘ MÔN CÔNG NGHỆ SINH HỌC ***000*** TRẦN VĂN KỲ PHÂN LẬP VÀ ĐỊNH DANH TÁC NHÂN GÂY BỆNH ĐỐM LÁ CÂY CẢI NGỌT TẠI TP. HCM BẰNG KỸ THUẬT PCR VÀ GIẢI TRÌNH TỰ VÙNG 16S – 23S rDNA LUẬN VĂN KỸ SƢ CHUYÊN NGÀNH: CÔNG NGHỆ SINH HỌC Thành phố Hồ Chí minh -2006- BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NÔNG LÂM TP. HCM BỘ MÔN CÔNG NGHỆ SINH HỌC ***000*** PHÂN LẬP VÀ ĐỊNH DANH TÁC NHÂN GÂY BỆNH ĐỐM LÁ CÂY CẢI NGỌT TẠI TP. HCM BẰNG KỸ THUẬT PCR VÀ GIẢI TRÌNH TỰ VÙNG 16S – 23S rDNA Giáo viên hƣớng dẫn: Sinh viên thƣc hiện: TS. LÊ ĐÌNH ĐÔN TRẦN VĂN KỲ KS. HOÀNG XUÂN QUANG Thành phố Hồ Chí Minh -2006- MINISTRY OF EDUCATION AND TRAINING NONG LAM UNIVERSITY, HCMC DEPARTMENT OF BIOTECHNOLOGY ***000*** ISOLATING AND IDENTIFYING AGENT CAUSED Brassica chinensis L. LEAF SPOT DISEASE IN HO CHI MINH CITY USING POLYMERASE CHAIN REACTION AND SEQUENCING 16S – 23S rDNA REGION GRADUATION THESIS MAJOR: BIOTECHNOLOGY Professor Student Ph.D, LE DINH DON TRAN VAN KY MSc, HOANG XUAN QUANG HCMC, 09/2006 i LỜI CẢM TẠ Xin chân thành gửi lời cảm tạ đến:  Ban Giám Hiệu Trƣờng Đại Học Nông Lâm thành phố Hồ Chí Minh.  Ban chủ nghiệm Bộ Môn Công Nghệ Sinh Học, cùng tất cả quý thầy cô đã truyền đạt kiến thức cho chúng tôi.  TS. Lê Đình Đôn và KS. Hoàng Xuân Quang đã hƣớng dẫn tận tình cho tôi trong suốt quá trình thực tập và giúp tôi hoàn thành khóa luận tốt nghiệp.  TS. Bùi Minh Trí, Trƣởng Trung Tâm Phân Tích Hóa – Sinh trƣờng Đại Học Nông Lâm thành phố Hồ Chí Minh.  Đặc biệt, xin bày tỏ lòng biết ơn sâu sắc đến cha mẹ, anh chị đã sinh thành, dạy dỗ và ủng hộ tinh thần cũng nhƣ vật chất cho tôi.  Các anh chị làm việc tại Trung Tâm Phân Tích Thí Nghiệm Hóa – Sinh đã hết lòng giúp đỡ, chia sẽ và động viên tôi trong suốt thời gian làm khóa luận.  Các bạn sinh viên thực tập tại Trung Tâm Phân Tích Thí Nghiệm Hóa – Sinh, trƣờng Đại Học Nông Lâm thành phố Hồ Chí Minh đã giúp đỡ tôi.  Các bạn bè thân yêu của lớp Công Nghệ Sinh Học Khóa 28 đã chia sẻ cùng tôi những vui buồn trong thời gian học cũng nhƣ hết lòng hỗ trợ, giúp đỡ tôi trong thời gian thực tập. ii TÓM TẮT Đề tài nghiên cứu: “Phân lập và định danh tác nhân gây bệnh đốm lá cây cải ngọt tại Tp HCM bằng phƣơng pháp PCR và giải trình vùng 16S – 23S rDNA” đƣợc thực hiện từ ngày 6 tháng 2 năm 2005 đến ngày 30 tháng 7 năm 2006 tại trƣờng Đại Học Nông Lâm thành phố Hồ Chí Minh, Viện Khoa Học Kỹ Thuật Nông Nghiệp Miền Nam. Đề tài do sinh viên Trần Văn Kỳ thực hiện dƣới sự hƣớng dẫn của TS. Lê Đình Đôn và KS. Hoàng Xuân Quang. Đối tƣợng nghiên cứu là vi khuẩn Xanthomonas campestris pv. campestris gây bệnh đốm lá trên cây cải ngọt. Hiện nay, tại các vùng trồng rau ở Huyện Củ Chi, Hóc Môn và quận 12, thành phố Hồ Chí Minh, bệnh đốm lá đang gây thiệt hại rất lớn cho nông dân trồng rau cải ngọt. Triệu chứng điển hình của bệnh là sự xuất hiện các đốm nhỏ có kích thƣớc 1 – 2 mm trên lá rau. Khi bệnh phát triển, các đốm bệnh lớn dần, có thể lên kết lại dẫn đến lá rau bị vàng và chết. Bệnh làm giảm năng suất cũng nhƣ chất lƣợng cây rau cải ngọt. Mục đích đề tài nhằm định danh tác nhân gây bệnh bằng kỹ thuật PCR, giải trình tự gen nhằm làm cơ sở cho các nghiên cứu phòng và trị bệnh sau này. Các nội dung nghiên cứu bao gồm: 1. Phân lập tác nhân gây bệnh từ các mẫu bệnh thu đƣợc từ các vùng trồng rau ở huyện Củ Chi, Hóc Môn và quận 12, thành phố Hồ Chí Minh. 2. Dùng kỹ thuật PCR và giải trình tự gen nhằm định danh tác nhân gây bệnh. Kết quả thu đƣợc nhƣ sau: 1. Phân lập đƣợc 8 dòng vi khuẩn gây bệnh đốm lá tại các vùng trồng rau thuộc huyện Củ Chi, Hóc Môn và quận 12, Tp HCM. 2. Sử dụng kỹ thuật PCR đã khuyếch đại vùng 16S – 23S rDNA ITS làm vật liệu giải trình tự và gen hrpF đặc trƣng của vi khuẩn gây bệnh. 3. Do hạn chế phƣơng pháp giải trình tự gen không mang lại kết quả. Tuy nhiên, kết quả PCR cho phép xác định vi khuẩn gây bệnh thuộc giống Xanthomonas campestris pv. campestris. iii MỤC LỤC CHƢƠNG TRANG Trang tựa Lời cảm tạ ..................................................................................................................... i Tóm tắt ........................................................................................................................ ii Mục lục ...................................................................................................................... iii Danh sách các chữ viết tắt .......................................................................................... vi Danh sách các bảng................................................................................................... vii Danh sách các hình .................................................................................................. viii 1. MỞ ĐẦU .......................................................................................................... 1 1.1. Đặt vấn đề ........................................................................................................ 1 1.2. Mục đích và yêu cầu ........................................................................................ 2 1.2.1. Mục đích ................................................................................................ 2 1.2.2. Yêu cầu .................................................................................................. 3 2. TỔNG QUAN TÀI LIỆU ................................................................................. 4 2.1. Tổng quan nghiên cứu ngoài nƣớc .................................................................. 4 2.1.1. Lịch sử phát hiện và sự phân bố. ........................................................... 4 2.1.2. Tác nhân và triệu chứng bệnh ............................................................... 5 2.1.3. Tác động kinh tế của bệnh. ................................................................... 6 2.1.4. Sinh lý, sinh thái và điều kiện phát triển bệnh. ...................................... 7 2.1.5. Hình thái, đặc điểm sinh lý, sinh hóa của vi khuẩn gây bệnh. ............... 8 2.1.6. Phƣơng pháp phân lập và dịnh danh tác nhân gây bệnh ........................ 8 2.1.7. Những nghiên cứu về phát hiện và dịnh danh tác nhân gây bệnh bằng phƣơng pháp sinh học phân tử………………….......................10 2.2. Tổng quan nghiên cứu trong nƣớc ................................................................ 12 2.3. Vùng ITS (rDNA intergenic spacer) và gen hrpF (hypersensitive reaction and pathogenicity). ............................................... 13 2.3.1. Gen hrpF (hypersensitive reaction and pathogenicity). ...................... 13 iv 2.3.2. Ribosome DNA (rDNA). .................................................................... 13 3. VẬT LIỆU VÀ PHƢƠNG PHÁP TIẾN HÀNH ............................................... 15 3.1. Thời gian và địa điểm ................................................................................... 15 3.1.1. Thời gian ............................................................................................. 15 3.1.2. Địa điểm .............................................................................................. 15 3.2. Vật liệu ......................................................................................................... 15 3.3. Hóa chất ........................................................................................................ 15 3.3.1. Các hóa chất dùng ly trích DNA từ vi khuẩn ...................................... 15 3.3.2. Các hóa chất dùng trong điện di .......................................................... 16 3.3.3. Hóa chất cho phản ứng PCR (do công ty Bio – Rad cung cấp) .......... 16 3.3.4. Môi trƣờng ........................................................................................... 17 3.4. Dụng cụ, thiết bị ............................................................................................ 17 3.5. Phƣơng pháp .................................................................................................. 17 3.5.1. Phƣơng pháp thu thập mẫu bệnh ......................................................... 17 3.5.2. Phƣơng pháp phân lập vi sinh vật từ mẫu bệnh .................................. 18 3.5.3. Phƣơng pháp chủng bệnh trên rau cải trồng trong nhà lƣới ................ 18 3.5.3.1. Phƣơng pháp trồng cây kí chủ .................................................... 18 3.5.3.2. Chủng bệnh ................................................................................. 19 3.5.4. Phƣơng pháp ly trích DNA từ vi khuẩn .............................................. 20 3.5.5. Phƣơng pháp PCR ............................................................................... 20 3.5.5.1. Khuếch đại đoạn DNA trong vùng ITS của vi khuẩn ............. 20 3.5.5.2. Khuếch đại đọan DNA trong gen hrpF .................................... 22 3.5.6. Phƣơng pháp điện di và đọc kết qủa ................................................... 22 3.5.6.1. Điện di trên gel agarose ............................................................ 22 3.5.6.2. Đọc kết quả điện di................................................................... 22 3.5.7. Phƣơng pháp xác định trình tự gen từ sản phẩm PCR. ....................... 23 3.5.7.1. Chuẩn bị khuôn DNA. .............................................................. 23 3.5.7.2. Phản ứng đọc trình tự sử dụng BigDye Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems). ............................ 24 3.5.7.3. Tinh sạch sản phẩm khuếch đại. .............................................. 25 3.5.7.4. Chạy điện di và ghi nhận tín hiệu trên máy sequencer. ........... 25 v 3.5.7.5. Quy trình tóm tắt các bƣớc đọc trình tự. .................................. 26 4. KẾT QUẢ VÀ THẢO LUẬN ............................................................................... 27 4.1. Kết quả thu thập và phân lập mẫu vi khuẩn gây bệnh. ........................... 27 4.2. Kết quả chủng bệnh trên rau cải ngọt trồng trong nhà lƣới.................... 28 4.3. Kết quả ly trích và pha loãng DNA vi khuẩn. ....................................... 31 4.4. Kết quả phản ứng PCR. ......................................................................... 32 4.4.1. Kết quả PCR khuếch đại vùng ITS. ............................................... 32 4.4.2. Kết quả điện di tinh sạch sản phẩm PCR ....................................... 32 4.4.3. Kết quả PCR khuếch đại vùng hrpF. ............................................. 33 5. KẾT LUẬN VÀ ĐỀ NGHỊ ................................................................................... 34 TÀI LIỆU THAM KHẢO ......................................................................................... 36 PHỤ LỤC .................................................................................................................. 39 vi DANH SÁCH CÁC CHỮ VIẾT TẮT CTAB :Cethyltrimethylammonium bromide EDTA :Ethyleneediamine tetraacetic acid ng : nano gram cDNA : complementary DNA nm : nano mol g : micro gram m : micro mol M : micro mol/lít l : micro lít TE : tris EDTA dNTP : deoxyribonucleotide – 5 – trphosphate TAE : tris acetic EDTA UI : unit international bp : base pair Kb : kilo base SDS : Sodium dodecyl sulphate PDA : Potato Dextrose agar RFLP : Restriction Fragment Lengh Polymorphism RAPD : Random Amplification of Polymorphic DNA Tm : melting temperature ctv : cộng tác viên PCR : Polymerase Chains Reaction UV : Ultra violet CC : Củ Chi HM : Hóc Môn Q12 : Quận 12 DC : Đối chứng vii DANH SÁCH CÁC BẢNG BẢNG TRANG Bảng 1.1 Sự phát triển của một số loài vi khuẩn Xanthomonas trên môi trƣờng bán chọn lọc.....................................................................9 Bảng 3.1 Thành phần phản ứng PCR………………………………………... 20 Bảng 3.2 Chu trình nhiệt phản ứng PCR với cặp mồi Xan1330 và Xan 322…21 Bảng 3.3 Chu trình nhiệt phản ứng PCR với cặp mồi XCR và XCF……….. 21 Bảng 3.4 Lƣợng DNA tối ƣu cho phản ứng đọc trình tự………………………. 23 Bảng 3.5 Thành phần hóa chất cho mỗi phản ứng đọc trình tự……………... 24 Bảng 4.1 Danh mục các dòng vi khuẩn sử dụng trong đề tài………………... 26 viii DANH SÁCH CÁC HÌNH HÌNH TRANG Hình 2.1 Sản phẩm rep – PCR trong nghiên cứu của Youfu Zhao và ctv…………………………………........................10 Hình 2.2 Cấu trúc vùng 16S – 23S rDNA ITS của vi khuẩn Xanthomonas.…………………………………………..…………..11 Hình 3.1 Sơ đồ tóm tắt quy trình đọc trình tự sản phẩm PCR………………...25 Hình 4.1 Lá cải bị bệnh thu thập ngoài ruộng rau…………………………… 26 Hình 4.2 Vết bệnh trên lá cải thu thập ngoài ruộng chụp dƣới kính hiển vi soi nổi….…….…………………………………………… 27 Hình 4.3 Nuôi cấy vi khuẩn trên môi trƣờng thạch………………………….. 27 Hình 4.4Vết bệnh sau khi chủng và vết thƣơng không bị nhiễm chụp dƣới kính hiển vi soi nổi……………………………………………28 Hình 4.5 Lá cải sau khi chủng bệnh 4 ngày, bên phải gân lá không bị nhiễm và bên trái bị nhiễm……………………………………………………29 Hình 4.6 Kết quả ly trích DNA từ các dòng vi khuẩn…………………..….... 30 Hình 4.7 Kết quả hiệu chỉnh nồng độ DNA………………………………….. 30 Hình 4.8 Kết quả khuếch đại vùng 16S – 23S rDNA………………………... 31 Hình 4.9 Kết quả tinh sạch sản phẩm PCR…………………………………... 32 Hình 4.10 Kết quả khuếch đại đoạn DNA vùng hrpF…………….…………. 32 Chƣơng 1. MỞ ĐẦU 1.1. Đặt vấn đề Cây rau cải nằm trong họ thập tự đƣợc trồng phổ biến ở khắp châu Âu, Địa Trung Hải, nơi đƣợc coi là nguồn gốc của chúng (Nguyễn Văn Thắng, Trần Khắc Thi, 1996). Chúng đƣợc sử dụng rộng rãi làm thức ăn cho ngƣời và gia súc, làm nguyên liệu nghành dƣợc. Cây cải chiếm vị trí quan trọng bậc nhất trong ngành rau nhờ chủng loại phong phú, sản lƣợng cao, thích nghi rộng rãi với điều kiện thời tiết, đất đai khác nhau, dễ vận chuyển, cất giữ lâu, dễ ăn, dễ chế biến và nấu nƣớng. Rau là loại thực phẩm không thể thiếu trong bữa ăn hằng ngày của con ngƣời, đặc biệt là với các dân tộc Châu Á và nhất là với ngƣời Việt Nam. Dù ở đâu – trong nƣớc hay ngoài nƣớc – bữa ăn của ngƣời Việt Nam luôn có món rau với số lƣợng nhiều hơn so với của các dân tộc khác. Có lẽ vì vậy mà ngƣời Việt trẻ hơn, đẹp hơn so với ngƣời cùng lứa tuổi của các châu lục khác. Theo sự phát triển của đời sống xã hội, nhiều nhà dinh dƣỡng học của Việt Nam cũng nhƣ của thế giới nghiên cứu về khẩu phần thức ăn cho nguời Việt Nam đã tính rằng hàng ngày chúng ta cần khoảng 2300 – 2500 calo năng lƣợng để sống và hoạt động. Để có đƣợc năng lƣợng này, nhu cầu tiêu dùng rau hằng ngày trung bình cho một ngƣời phải vào khoảng 250 – 300 g (tức là khoảng 7,5 – 9 kg/ngƣời mỗi tháng). Còn nghiên cứu của nhà khoa học Pháp, ông Dorolle từ năm 1942 đã tính là khoảng 360 g/ngày (tức là khoảng 10,8 kg/một tháng cho mổi ngƣời). Theo các số liệu thống kê thì hiện nay tính bình quân chung cả nƣớc chúng ta mới sản xuất đƣợc khoảng 4 – 5 kg/ngƣời mỗi tháng (không tính phần sản xuất tự túc trong dân) (Nguyễn Văn Thắng và Trần Khắc Thi, 1996). Nhƣng tác dụng của rau không phải là bảo đảm số calo chủ yếu trong khẩu phần dinh dƣỡng mà là cung cấp đủ chất xơ (xenlulo) để kích thích hoạt động của nhu mô ruột và các sinh tố (vitamin) cho cơ thể. Ở phía nam nƣớc ta, cải ngọt đƣợc trồng nhiều ở các tỉnh nhƣ: Tp HCM, Đồng Nai, Lâm Đồng, Long An. Cùng các loại rau khác, cải ngọt đã mang lại nhiều lợi ích thiết thực cho đời sống con ngƣời nhƣ cung cấp rau tƣơi, bổ sung nguồn dinh dƣỡng, chất xơ cũng nhƣ các loại vitamin. Trong một vài năm trở lại đây, do tốc độ đô thị hóa diễn 2 ra nhanh, các khu công nghiệp tập trung số lƣợng lớn công nhân, do vậy nhu cầu lƣợng rau xanh hàng ngày rất lớn. Chính vì vậy, cây cải ngọt (Brassica chinensis L.) đƣợc nông dân quan tâm, chọn trồng nhiều do chúng có những đặc tính sinh trƣởng phù hợp cho việc thu hoạch thƣờng xuyên nhƣ: thời gian sinh trƣởng ngắn (30 – 35 ngày), trồng đƣợc quanh năm, có nhiều giống trồng trong cả mùa khô và mùa mƣa, năng suất cao, đáp ứng đƣợc nhu cầu của thị trƣờng. Đối với cây cải ngọt, do hàm lƣợng nƣớc lớn, trên 90% (Mai Thị Vinh và Phạm Văn Biên, 1985) nên là ký chủ thích hợp cho nhiều loại vi sinh vật gây bệnh nhƣ nấm, vi khuẩn. Nhóm vi khuẩn gây bệnh trên cây cải ngọt bao gồm: vi khuẩn gây thối nhũn, cháy lá chữ V, đốm lá. Bệnh đốm lá vi khuẩn không phải là đối tƣợng quan trọng. Nhƣng hiện nay, khi diện tích gieo trồng tăng, trồng nhiều vụ trong năm, có sự tích lũy nguồn bệnh qua các vụ, nó trở thành vấn đề đƣợc nhiều ngƣời quan tâm. Triệu chứng ban đầu của bệnh là các đốm nhỏ xuất hiện ở bề mặt dƣới của lá. Vết bệnh dạng tròn, sũng nƣớc, đƣờng kính từ 1 – 3 mm. Vết bệnh lúc già thì phần mô ở giữa bị hoại tử, nhìn mặt trên lá sẽ thấy các đốm màu nâu. Bệnh cũng xuất hiện ở phần thân và cuống lá làm cho lá bị cong lại và vết bệnh có màu đen. Bệnh làm giảm năng suất, giá trị thƣơng phẩm của rau, giảm thời gian bảo quản nên giá trị kinh tế không cao. Hơn nữa, ngoài cải ngọt, bệnh cũng gây hại trên khá nhiều các loại cây trồng khác cùng họ thập tự nhƣ: cải bắp, súp lơ, cải thảo, cải xanh. Chính vì vậy, xác định đƣợc tác nhân gây bệnh là việc cần thiết nhằm làm cơ sở cho các nghiên cứu phòng trừ sau này. Đó là lý do tôi chọn thực hiện đề tài: “Phân lập và định danh tác nhân gây bệnh đốm lá cây cải ngọt tại Tp. HCM bằng phƣơng pháp PCR và giải trình tự vùng 16S – 23S rDNA”. Đề tài là một phần trong chƣơng trình nghiên cứu bệnh vi khuẩn trên cây họ thập tự của Bộ môn Bảo Vệ Thực Vật, Đại Học Nông Lâm Tp. HCM. 1.2. Mục đích và yêu cầu của đề tài 1.2.1. Mục đích Định danh tác nhân gây bệnh đốm lá trên cây cải ngọt làm cơ sở cho các nghiên cứu sâu hơn sau này nhằm phòng trừ bệnh có hiệu quả, giảm thiểu thiệt hại cho nông dân trồng rau. 3 1.2.2. Yêu cầu - Thu thập mẫu bệnh phẩm tại các vùng trồng rau Củ Chi, quận 12, Hóc Môn. - Phân lập vi sinh vật từ mẫu bệnh phẩm. - Chủng bệnh trên cây rau cải trồng trong nhà lƣới. - Chọn lọc các dòng vi khuẩn gây bệnh trong số các dòng thu thập đƣợc dựa vào kết quả chủng bệnh. - Ly trích DNA và thực hiện phản ứng PCR định danh tác nhân gây bệnh. - Đọc trình tự vùng 16S – 23S rDNA. Chƣơng 2. TỔNG QUAN TÀI LIỆU 2.1. Tổng quan nghiên cứu ngoài nƣớc 2.1.1. Lịch sử phát hiện và sự phân bố 4 Vi khuẩn gây bệnh đốm lá trên cây rau họ thập tự phân bố rộng rãi, chúng đã đƣợc ghi nhận là có mặt ở khoảng 85 quốc gia khắp Châu Phi, Châu Á, Bắc Mỹ và Nam Mỹ (Bradbury, 1986). Bệnh đƣợc ghi nhận lần đầu tiên vào năm 1929 trên cây cải ngựa, năm 1930 phát hiện trên củ cải trắng và củ cải đỏ (Youfu Zhao và ctv, 2005). Bệnh cũng đƣợc tìm thấy ở nhiều vùng thuộc nƣớc Mỹ nhƣ Riverside, Santa Barbara, Santa Clara (Matsumoto, 1975). Bệnh này đƣợc ghi nhận gây hại trên họ thập tự ở Argentina (Gaetan, 1995) và ở Brazil trong năm 1992 (Leit, 1994). Ở miền bắc Ấn Độ trong những năm từ 1989 – 1992 bệnh xuất hiện và gây hại nặng trên cây cải bông (Shyam, 1994). Vi kuẩn gây bệnh đã đƣợc tìm thấy từ hạt cải bắp ở Nhật Bản năm 1988 (Shiomi, 1992). Ở Hàn Quốc, đốm lá là bệnh quan trọng trên cây cải bắp (Kim, 1986). Schaad và Taveechi (1983) đã báo cáo rằng: bệnh xuất hiện ở vùng phía bắc, tây bắc và miền trung Thái Lan. Theo CPC (Crop protection compendium) (2001) cho đến nay, bệnh đã xuất hiện trên nhiều quốc gia khác nhau. Ở châu Âu bao gồm: Bungary, CH Séc, Đan Mạch, Pháp, Đức, Hy Lạp, Hungary, Iceland, Ireland, Ý Hà Lan, Na Uy, Bồ Đào Nha, Rumani, Nga, Thụy Điển, Thụy Sĩ, Anh. Ở châu Á bao gồm các quốc gia nhƣ: Brunei, Cam Pu Chia, Trung Quốc, Đài Loan, Tây Tạng, Ấn Độ, Inđônêxia, Iran, Nhật, Hàn Quốc, Malayxia, Nêpan, Philippin, Srilanka, Thái Lan, Thổ Nhĩ Kỳ, Uzbêkistan và Việt Nam. Châu Phi gồm có: Angola, Ethiopia, Ghana, Kenya, Libya, Malawi, Mauritius, Morocco, Mozambique, Seychelles, Somalia, Tanzania, Togo, Uganda, Zimbabwe. Ở vùng tây bán cầu có các quốc gia nhƣ: Argentina, Barbados, Bermuda, Bolivia, Brazil, Parana, Canada, British Columbia, Costa Rica, Cuba, Dominica, El Salvador, Guatemala, Haiti, Honduras, Jamaica, Mexico, Nicaragua, Panama, Puerto Rico. Ở nƣớc Mỹ, bệnh xuất hiện ở các bang nhƣ: California, Florida, Georgia, Hawaii, Illinois, Michigan, New York, Washington, Wisconsin. Ở châu Đại Dƣơng bệnh xuất hiện ở American Samoa, New South Wales. Ở Úc, bệnh xuất hiện ở các khu vực nhƣ: Queensland, Nam Úc, Tây Úc. Ngoài ra, bệnh cũng đƣợc ghi nhận là đã có mặt Cook Islands, Fiji New Caledonia, New Zealand, Norfolk Island, Papua New Guinea, Tonga. 5 Nhƣ vậy, chúng ta thấy rằng đây là bệnh phân bố khá rộng rãi, hầu nhƣ chúng có mặt ở hầu hết các quốc gia trên thế giới. 2.1.2. Tác nhân và triệu chứng bệnh Theo Lowell L. Black (2000), bệnh do vi khuẩn Xanthomonas campestris pv. armoraciae gây nên. Bệnh xuất hiện trên tất cả các loại cây trồng thuộc họ thập tự và một số giống cải hoang. Triệu chứng chính của bệnh là đốm trên lá thật, đôi khi bệnh cũng xuất hiện trên lá mầm, bông, cuống lá và bắp của cây cải bắp. Các đốm nhỏ xuất hiện trên bề mặt lá do sự xâm nhiễm qua lỗ khí khổng của vi khuẩn hoặc rìa mép lá do quá trình xâm nhiễm qua lỗ thủy khổng. Vết bệnh ban đầu là các lỗ nhỏ sũng nƣớc, về sau khi triệu chứng bệnh điển hình, đƣờng kính vết bệnh có thể lên đến 3 mm và có dạng hình tròn. Bao quanh vết bệnh là vành màu nâu sáng, khi bệnh già ở giữa có vùng hoại tử màu trắng. Vết bệnh trên gân, cuống lá thƣờng có dạng sọc đen dài. Youfu Zhao và ctv (2000, 2002) đã phân lập các vi khuẩn gây bệnh đốm lá trên các cây trồng họ thập tự ở Oklahoma (cải bắp, cải rổ, cải củ, cải thìa) là Xanthomonas campestris pv. armoraciae, Xanthomonas campestris pv. campestris, Pseudomonas syringae pv. maculicola. Trong đó hai loài vi khuẩn Xanthomonas campestris pv. armoraciae, Xanthomonas campestris pv. campestris là những tác nhân quan trọng. những vi khuẩn này cùng tồn tại và phát triển trên đồng ruộng. Vi khuẩn Xanthomonas campestris pv. campestris thuờng gây triệu chứng cháy lá chữ V (V – shape), đôi lúc cũng có triệu chứng đốm lá, nếu xâm nhiễm qua lỗ thủy khổng. Vi khuẩn Xanthomonas campestris pv. armoraciae gây triệu chứng đốm lá. Đối với bệnh đốm lá do vi khuẩn Pseudomonas syringae pv. maculicola gây triệu chứng đốm lá, vết bệnh thƣờng không định hình, kích thƣớc vết bệnh khoảng 2 mm, khi nhiều vết bệnh liên kết lại với nhau, đƣờng kính vết bệnh có thể lên tới 1 cm. Màu sắc vết bệnh thƣờng có dạng sũng nƣớc, viền úa vàng bao quanh vết bệnh. Trong nghiên cứu của mình về bệnh đốm lá trên cây canola (Brassica napus), một loại cây trồng thuộc họ thập tự, S. Geatan, N. Lopez (2005) đã xác định rằng, tác nhân của bệnh này là do vi khuẩn Xanthomonas campestris gây nên. Vi khuẩn xâm nhiễm qua lỗ khí khổng tạo nên các vết đốm hoại tử. Triệu chứng bệnh đôi lúc có dạng cháy lá chữ V, đó là kết quả của sự xâm nhiễm qua lỗ thủy khổng ở mép lá. 6 Từ tháng 12 năm 2001, K. Pernezn, E. Dickstein phát hiện dịch bệnh đốm lá cải bắp ở trang trại vùng Everglades thuộc phía nam bang Florida. Triệu chứng là các đốm nhỏ, kích thƣớc khoảng 1 – 2 mm và thƣờng xuất hiện ở phần mặt lá. Tác nhân là do vi khuẩn Xanthomonas campestris pv. armoraciae gây nên. Xanthomonas campestris pv. campestris và các chủng khác thuộc loại này nhƣ X. campestris pv. abbrans, raphani, armmoraciae, và incanae đƣợc biết đến nhƣ là những chủng gây bệnh đốm lá hoặc cháy lá chữ V trên các cây trồng họ thập tự (J.G. Vicente, 2001). Cũng theo J.G. Vicente và ctv (2006) phân lập và định danh tác nhân gây bệnh đốm lá trên cây củ cải trắng và cây cải ngựa (horseradish), kết quả cho thấy, tác nhân gây bệnh là vi khuẩn Xanthomonas campesrtis pv. armoraciae hoặc Xanthomonas campesrtis pv. raphani. Ở Queensland, Australia, tác nhân gây bệnh đốm lá họ thập tự do vi khuẩn Xanthomonas campestris pv. campestris gây nên. Vi khuẩn thƣờng gây hại mạnh trên các giống cải (Moffett, M.L và ctv, 1976). Nhƣ vậy, tác nhân gây bệnh đốm lá họ tập tự cho đến nay bao gồm hai giống chính, giống Xanthomonas bao gồm: Xanthomonas campestris pv. armoraciae, Xanthomonas campestris pv. campestris, Xanthomonas campesrtis pv. raphani. Và giống Pseudomonas gồm có: Pseudomonas syringae pv. maculicola. 2.1.3. Tác động kinh tế của bệnh Bệnh đốm lá vi khuẩn họ thập tự phân bố rộng rãi, gây hại nhiều loại cây trồng có giá trị kinh tế cao. Ở Oklahoma, hàng năm có khoảng 600 ha rau bị bệnh tấn công. Bệnh làm giảm năng suất và chất lƣợng của một số loại rau ăn lá họ thập tự. Từ 1994 đến 1996 bệnh làm thiệt hại hoàn toàn những cánh đồng trồng cải rổ, cải xanh, củ cải ở bang này (Youfu Zhao và ctv, 2000). Theo CPC (2001), bệnh đốm lá họ thập tự là bệnh quan trọng gây tổn thất đáng kể về năng suất cũng nhƣ chất lƣợng. Bệnh là đối tƣợng nguy hiểm cho cây trồng họ thập tự ở các bang phía bắc nƣớc Mỹ. Trong những năm 1960 và 1970, bệnh gây hại rất nặng rên cánh đồng trồng cải bắp của bang Texas. Năm 1972 và 1973, bệnh đã gây thành dịch cho các khu vực Đông – Bắc, và các bang phía tây nƣớc Mỹ, khoảng 70% cây con lấy từ típ ƣơm cây đều bị nhiễm bệnh, sự thiệt hại này ƣớc tính là khoảng 7 1 triệu USD. Ở Canada, trong vụ Đông 1979 – 1980, bệnh gây tổn thất khoảng 60% sản lƣợng cải bắp. Ở miền nam tỉnh Buenos Aires – Argentina, tỷ lệ bệnh đốm lá cây canola (Brassica napus) trung bình koảng 59%, những năm bệnh nặng, tỷ lệ bệnh khoảng 90% và làm thất thoát khoảng 20% năng suất (S. Geatan, N. Lopez, 2005). Các loài gây bệnh thuộc giống Xanthomonas spp. Là vi khuẩn gây tổn thất kinh tế nặng nề nhất trên các cây trồng họ thập tự nhƣ cải bông, cải bắp, cải xanh (J.G. Vicente và ctv, 2006). 2.1.4. Sinh lý, sinh thái và điều kiện phát triển bệnh. Vi khuẩn Xanthomonas campestris pv. armoraciae tồn tại trong tàn dƣ cây trồng ở trong đất, nhƣng không sống trong đất sau khi tàn dƣ cây trồng bị phân hủy. Vi khuẩn cũng có thể tồn tại trên cây cỏ, hạt giống. Bệnh phát triển mạnh khi có ẩm độ lá cao (trên 85%), khoảng nhiệt độ thích hợp để bệnh phát triển tƣơng đối rộng 20 – 30oC. Trong điều kiện thời tiết có sƣơng hoặc mƣa liên tục kết hợp với nhiệt độ cao là điều kiện rất thuận lợi để bệnh phát triển mạnh mẽ. Vi khuẩn có thể lan từ cây này qua cây khác do mƣa, tƣới và các dụng cụ lao động (Lowell L. Black, 2000). Theo Youfu Zhao (2002), vi khuẩn gây bệnh lan truyền qua hạt giống là chủ yếu. nếu bệnh do Xanthomonas campestris pv. campestris gây nên thì vi khuẩn có thể tồn tại cả ở hạt giống, tàn dƣ thực vật và cỏ dại. Chƣa phát hiện đƣợc sự tồn tại và lan truyền qua đất và tồn dƣ cây trồng của vi khuẩn gây bệnh là Xanthomonas campestris pv. armoraciae. Vi khuẩn Xanthomonas campestris pv. armoraciae và Pseudomonas syringae pv. maculicola gây bệnh đốm lá cây rau ăn lá họ thập tự gần nhƣ không tồn tại trong tàn dƣ cây trồng đƣợc chôn vùi sâu, nhƣng chúng tồn tại lâu hơn trong tàn dƣ cây trồng trên mặt đất. Điều này cũng tƣơng tự nhƣ vi khuẩn gây bệnh Pseudomonas syringae pv. phaseolicola. Chúng có thể tồn tại lâu hơn trong tồn dƣ thực vật trên mặt đất. Vi khuẩn gây bệnh cũng tồn tại trong tồn dƣ thực vật đã bị hoai mục. Cũng nhƣ các vi khuẩn gây bệnh khác, vi khuẩn Xanthomonas campestris pv. armoraciae có quan hệ chặt chẽ với sự xâm nhiễm vào mô lá qua lỗ hở tự nhiên (khí khổng, thủy khổng) và các vết thƣơng tạo nên hiện tƣợng đốm lá (Veronique Hugouvieux, 1998). 8 Theo CPC (2001), Xanthomonas campestris pv. campestris sống sót qua mùa đông trong đất, đặc biệt là các cây kí chủ nhiễm bệnh và các loài cỏ dại mọc gần ruộng trồng cây họ thập tự, vi khuẩn có thể tồn tại tới 3 năm. Vi khuẩn xâm nhập vào hạt, lỗ khí khổng và thủy khổng của cây. Vi khuẩn từ lá mầm ở cây con có thể lan truyền trực tiếp lên các lá thật. Vi khuẩn xâm nhập vào cây qua sự hình thành giọt nƣớc tiết ra từ lỗ thủy khổng trong giai đoạn buổi sáng (Ruisen và Gielink, 1993). Nhiệt độ thích hợp cho sinh trƣởng của vi khuẩn là 25 – 30oC. Trong những điều kiện nhƣ vậy, triệu chứng bệnh sẽ xuất hiện sau 7 – 14 ngày. Nhiệt độ thấp, triệu chứng bệnh xuất hiện chậm. Triệu chứng bệnh không thể hiện rõ khi nhiệt độ dƣới 18 – 20oC. Vi khuẩn có thể sống sót trên bề mặt lá đến 73 ngày sau khi lá đƣợc chủng bệnh bằng phƣơng pháp phun (Schultz và Gabrielson, 1986). Vi khuẩn có thể lây lan từ cây này qua cây khác nhờ gió, mƣa và công cụ lao động. 2.1.5. Hình thái, đặc điểm sinh lý, sinh hóa của vi khuẩn gây bệnh Các loài vi khuẩn gây bệnh thuộc giống Xanthomonas thƣờng có phản ứng Gram âm, háo khí, tế bào hình gậy (0,4 – 0,7 x 0,7 – 1,8 μm), tiêm mao đơn cực, không sản sinh nitrates, phản ứng catalase dƣơng tính, tạo axít yếu từ các nguồn carbonhydrate. Khuẩn lạc có màu vàng, nhầy, lồi và bóng trên môi trƣờng NGA và YDC agar. Đối với các loài Xanthomonas, khuẩn lạc có thể mọc và phát triển ở nhiệt độ 35oC, hóa lỏng gelatin, không tạo urease, sản sinh axit từ arabinose, glucose và manose (N.W. Schaad, 1998). 2.1.6. Phƣơng pháp phân lập tác nhân gây bệnh Theo Youfu Zhao (2000), đối với bệnh đốm lá họ thập tự do vi khuẩn thuộc giống Xanthomonas, việc ly trích vi khuẩn tốt nhất từ các đốm lá mới bị nhiễm bệnh. Sát trùng bề mặt bằng sodium hypochlorite 0,25% trong 30 giây, đốm bệnh đƣợc cắt nhỏ trong giọt nƣớc tiệt trùng và cấy zích zắc dịch khuẩn lên môi trƣờng nutrient agar (NA). Đĩa cấy ủ trong 28oC, sau 3 – 5 ngày đem quan sát khuẩn lạc. Chọn các khuẩn lạc màu vàng, mọc tách rời để nghiên cứu. Theo CPC (2001), vi khuẩn gây bệnh thực vật giống Xanthomonas có thể đƣợc phân lập từ rìa vết bệnh (phần tiếp giáp giữa mô bệnh và mô khỏe ). Vi khuẩn đƣợc cấy trên môi trƣờng Yeast dextrose calcium carbonate (YDC), Beef peptone agar + 5% water soluble starch. 9 Theo Shaad, N.W. (1988), vi khuẩn Xanthomonas campestris pv. campestris có thể đƣợc phát hiện bằng cách nuôi cấy trên môi trƣờng bán chọn lọc (semiselective media). Các loại môi trƣờng bán chọn lọc chuyên biệt đƣợc sử dụng là SX agar, SM agar, NSCAA, BSCAA. Các môi trƣờng này thƣờng dùng phân lập vi khuẩn Xanthomonas campestris pv. Campestris trong đất và hạt giống. 2.1.7. Những nghiên cứu về phát hiện và dịnh danh tác nhân gây bệnh bằng phƣơng pháp sinh học phân tử Để đánh giá sự đa dạng di truyền các dòng vi khuẩn Xanthomonas campestris gây bệnh đốm lá trên cây họ thập tự, Youfu Zhao và ctv (2000) đã sử dụng kỹ thuật rep-PCR với BOX primer BOXAIR [5’ – ca m p estris ca ro ta e T ra n slu cen s p h a seo li p ru n i vesica to ria o ryza e m a lva cea ru m M a n ih o tis B eg o n ia e p ela m g o n ii fra g a ria M ô i trƣ ờ n g + – – V – V – – – – – + – + S X + – – – V – – V – + V + S M + V – + V – + V – V – V – + + + B S C A A V + (+ ) V + V – V + – V + – (+ ) V + M X P – – – V – + V – – – V V V X P S a + + + + V + – + + (+ ) + + X C S V – + V + (+ ) V N D V V + V M D – 5 + V + (+ ) + + N D + V + + + T w een B ả n g 1 .1 S ự p h á t triển củ a m ộ t số lo à i v i k h u ẩ n X a n th o m o n a s trên m ô i trƣ ờ n g b á n ch o n lọ c 10 CTACGGCAAGGCGACGCTGACG – 3’]. Phản ứng rep – PCR trên các mẫu nghiên cứu tạo sản phẩm là các đoạn DNA có kích thƣớc từ 0,3 – 4 kb cho phép đánh giá sự tƣơng quan về mặt kiểu gen giữa các loài. Hình 2.1 Sản phẩm rep – PCR trong nghiên cứu của Youfu Zhao và ctv. Goncalves, E.R., và Rosato, Y.B (2002), trong nghiên cứu của mình về sự phát sinh loài vi khuẩn Xanthomonas campestris đã dùng kỹ thuật PCR sử dụng cặp primer Xan 1330 5’ – GTT CCC GGG CCT TGT ACA CAC – 3’ Xan 322 5’ – GGT TCT TTT CAC CTT TCC CTC – 3’ thiết kế dựa trên vùng rDNA 16S và 23S để khuếch đại vùng 16S – 23S rDNA ITS có kích thƣớc 1,1 kb. 11 Hình 2.2 Cấu trúc vùng 16S – 23S rDNA ITS của vi khuẩn Xanthomonas. Said M.S. Massomo và ctv (2003) đã thực hiện nghiên cứu định danh vi khuẩn Xanthomonas campestris pv. campestris trên cải bắp ở Tanzania bằng phƣơng pháp chủng bệnh, phân tích methyl este acit béo, ELISA gián tiếp và rep – PCR. Vi khuẩn sau khi phân lập đƣợc tiến hành phân tích sinh hóa; chủng bệnh bằng phƣơng pháp châm kim tạo vết thƣơng, lây nhiễm trên lá mầm, phun dịch khuẩn trên cây trƣởng thành. Acit béo đƣợc methyl hóa, ly trích và phân tích bằng máy sắc ký khí. Vi khuẩn đƣợc xác định bằng kỹ thuật ELISA gián tiếp sử dụng kháng thể đơn dòng đặc hiệu. Các dòng vi khuẩn sau khi xác định đƣợc tiến hành phân tích genomic fingerprinting bằng kỹ thuật rep – PCR với primer BOXAIR (5’ – CTACggCAAggCgACgCTgACg – 3’) và REP – PCR dùng cặp primer: REP 1R (5’ – IIIICgICgICATCIggC – 3’) REP 2I (5’ – ICgICTTATggCCTAC – 3’). Young Jin Park và ctv (2004) đã thực hiện nghiên cứu phát hiện vi khuẩn Xanthomonas campestris pv. campestris bằng kỹ thuật PCR dựa trên cặp primer XCF (5’ – CGATTCGGCCATGAATGACT – 3’) và XCR (5’ – CTGTTGATGGTGGTCTGCAA – 3’) đƣợc thiết kế từ gen hrpF của vi khuẩn Xanthomonas campestris pv. campestris để khuếch đại đoạn DNA có 12 kích thƣớc 535 bp. Nhóm nghiên cứu đã tiến hành thực nghiệm chứng minh tính chuyên biệt và đặc hiệu của primer XCR, XCF bằng cách thực hiện phản ứng PCR với nhiều thành phần hóa chất mà máy luân nhiệt khác nhau. Ngoài ra, kỹ thuật DNA dot – blot cũng đƣợc thực hiện nhằm kiểm chứng sự hiện diện của gen hrpF trong vi khuẩn, qua đó rút ra kết luận về sự bảo toàn của gen này. 2.2. Tổng quan nghiên cứu trong nƣớc Cho đến nay, những nghiên cứu về bệnh đốm lá họ thập tự nói chung và cây cải ngọt nói riêng còn khá ít. Theo Lê Lƣơng Tề và Vũ Triệu Mân (1999), bệnh đốm lá súp lơ là do vi khuẩn Pseudomonas syringae pv. maculicola gây nên. Bệnh đƣợc phát hiện lần đầu tiên ở Mỹ vào năm 1911. Triệu chứng bệnh trên các lá thật thƣờng là các đốm nhỏ, tròn, góc cạnh, màu nâu tím hoặc đen. Trên lá mầm xuất hiện các đốm trong giọt dầu, mép lá uốn cong. Đƣờng kính vết bệnh từ 1 – 3 mm. Vi khuẩn gây bệnh hình gậy, hai đầu tròn, kích thƣớc khoảng 1,5 – 3 x 0,5 – 1 μm, chuyển động nhờ vài ba lông roi ở một đầu. Khuẩn lạc trắng kem, tròn nhẵn, rìa gợn sóng. Vi khuẩn có khả năng phát huỳnh quang, tạo NH3, khử nitrate, không phân giải đƣờng thành axít, khí, không làm đông váng sữa, phân giải gelatin rất yếu, khả năng yếu tạo H2S và indol. Nhiệt độ thích hợp cho vi khuẩn sinh trƣởng là 24 – 25oC, nhiệt độ tối đa là 29oC, nhiệt độ gây chết là 47oC, nhạy cảm với tác động của ánh sáng mặt trời và khô hạn. Vi khuẩn xâm nhiễm qua lỗ khí khổng, vết thƣơng. Thời kỳ ủ bệnh là khoảng 4 – 6 ngày. Bệnh phát triển thuận lợi trong điều kiện ẩm độ cao (90%), nhiệt độ 17 – 25oC. Bệnh có thể lan truyền qua bọ nhảy. Ở trên cây cải bông và một số rau ăn lá nhƣ cải thìa, cải xanh, cải ngọt, bệnh đốm lá do vi khuẩn Xanthomonas spp. gây nên thƣờng xuất hiện trong vụ đông xuân. Trên cải bông, bệnh xuất hiện nhiều hơn so với các giống cải khác (Trần Thanh Tùng, 1997). Theo Phạm Văn Biên và Mai Thị Vinh (1998, 2000), bệnh đốm lá cải bông vùng trồng rau thành phố HCM do vi khuẩn Pseudomonas spp. gây nên. Bệnh thƣờng xuất hiện trên cải bông trồng trong vụ đông xuân. Bệnh phát sinh gây hại nặng vào những năm có thời tiết nóng ẩm. Giống Xanthomonas spp. thƣờng gây bệnh cháy lá chữ V 13 trên cải bắp, cải bông vùng Củ Chi, Hóc Môn, Bình Chánh. Bệnh cũng thƣờng xuất hiện trong vụ đông – xuân, khoảng từ tháng 11 – 2. Trong giống Xanthomonas spp. có một loài gây bệnh đốm lá cải bông đƣợc phát hiện trong năm 1998 ở vùng rau Vĩnh Lộc B, Bình Chánh, Tp. HCM. Triệu chứng bệnh ban đầu là các đốm nhỏ vàng sáng ở các lá thấp gần mặt đất, các đốm này trông gần giống với đốm do bọ nhảy gây hại. Bệnh thƣờng nặng hơn vào giai đoạn cuối vụ. Tỷ lệ bệnh giai đoạn phát triển thân lá khoảng 21%, nhƣng ở giai đoạn ra bông , bệnh có thể lên tới 50% (Mai Thị Vinh, 1998). Nhìn chung, số công trình nghiên cứu về tác nhân cũng nhƣ các đặc tính sinh học, sinh lý, sinh hóa, dịch tễ học của bệnh đốm lá cải ngọt nói riêng và bệnh đốm lá cây họ thập tự nói chung ở Việt Nam còn khá ít. 2.3. Vùng 16S – 23S rDNA ITS (rDNA intergenic spacer) và gen hrpF (hypersensitive reaction and pathogenicity) 2.3.1. Gen hrpF (hypersensitive reaction and pathogenicity) Để xâm nhập và gây bệnh trên cây kí chủ, các loài vi khuẩn thƣờng có hệ thống riêng tiết ra các loại enzyme (pectinases, cellulases, proteases) và các chất độc (Beattie và Lindow, 1994). Ngoài ra còn có sự tham gia của hệ thống các gen hrp. Gen này hiện diện trong hầu hết các loài vi khuẩn Gram âm ngoại trừ Agrobacterium (Lindgren, 1986). Gen này tạo cho vi khuẩn khả năng xâm nhập và nhân sinh khối trong cây nhiễm (susceptible plant), đồng thời tạo phản ứng siêu nhạy cảm (hypersensitive reaction) ở cây kháng (resistant plant). Phản ứng siêu nhạy cảm là một đáp ứng phòng vệ của cây kí chủ, thể hiện bằng sự hoại tử ở mô bị nhiễm (Klement, 1982). Tổ hợp gen này bao gồm 21 gen và 2 gen điều tiết là hrpX, hrpG nằm bên ngoài. Các gen hrp mã hóa các protein hrp. Các protein này là thành phần của hệ thống phóng tiết loại III (type III secretion system) cho phép tiết ra các loại protein gây độc (Van Gijsegem, 1993 và Van den Ackerveken, 1996). 2. 3.2. Ribosome DNA (rDNA) rDNA là nhóm gen mã hóa rRNA của ribosom, đóng vai trò quan trọng trong các nghiên cứu quan hệ phát sinh loài. rDNA đƣợc quan tâm nghiên cứu vì nó là một gen có nhiều bản sao và đặc biệt không mã hóa cho protein nào. Các bản sao của gen nằm liên tiếp trên một locus và liên quan mật thiết tới quá trình tiến hóa. Hơn nữa, ribosom 14 hầu nhƣ tồn tại trong mọi sinh vật và có cùng nguồn gốc tiến hóa. Phần lớn phân tử rDNA tƣơng đối bảo tồn nên đƣợc xem là cơ sở để tìm ra sự tƣơng đồng và các khác biệt khi so sánh các sinh vật khác nhau. Các primer thiết kế dựa trên những oligonucleotide có tính bảo tồn cao đƣợc sử dụng cho tất cả sinh vật nhằm khuếch đại các vùng tƣơng đƣơng dùng trong so sánh. Ngoài ra, nhiều primer và probe cũng đƣợc thiết kế dựa trên các vùng không bảo tồn dùng trong phát hiện và định danh vi sinh vật (Van de Peer và ctv, 1996). Theo Goncalves, E.R., và Rosato, Y.B (2002), rDNA 16S và 23S có tính bảo toàn cao. Ngƣợc lại, vùng ITS tiến hóa nhanh hơn và có nhiều biến động. Do đó, các primer đƣợc thiết kế dựa trên trình tự các vùng bảo toàn để khuếch vùng ITS, dùng trong các nghiên cứu về sự đa dạng di truyền, nguồn gốc phát sinh cũng nhƣ quan hệ giữa các loài. Ngoài ra, vùng ITS còn đƣợc sử dụng giải trình tự, đối chiếu với dữ liệu trên ngân hàng gen để định danh sinh vật. 15 Chƣơng 3. VẬT LIỆU VÀ PHƢƠNG PHÁP 3.1. Thời gian và địa điểm 3.1.1.Thời gian Đề tài đƣợc thực hiện trong thời gian từ ngày 06/02/2006 đến 30/07/2006 3.1.2. Địa điểm - Tiến hành lấy mẫu bệnh tại các vùng trồng rau trọng điểm ở Tp HCM: Củ Chi, Hóc Môn, quận 12. - Phân lập vi sinh vật từ mẫu bệnh tại Phòng Nghiên Cứu Bảo Vệ Thực Vật, Viện Khoa Học Kỹ Thuật Nông Nghiệp Miền Nam (IAS). - Chủng bệnh trên cây rau cải ngọt trong nhà lƣới thuộc Bộ môn Bảo Vệ Thực Vật, ĐH Nông Lâm Tp HCM. - Ly trích DNA và tiến hành phản ứng PCR, đọc trình tự tại Trung Tâm Phân Phân Tích Thí Nghiệm Hóa Sinh, ĐH Nông Lâm Tp HCM. 3.2. Vật liệu Mẫu bệnh phẩm thu thập từ các vùng trồng rau trọng điểm ở Tp HCM: Củ Chi, Hóc Môn, quận 12. Đề tài sử dụng dòng vi khuẩn đối chứng Xanthomonas axonopodis pv. citri gây bệnh ung thƣ trên cây bƣởi. 3.3. Hóa chất Các hoá chất đƣợc sử dụng trong đề tài này đƣợc sản xuất bởi Công ty Sigma, Merk, Amersham Biosence và Bio Rad. 3.3.1. Các hoá chất dùng để ly trích DNA từ vi khuẩn Phenol Chloroform Isoamyl Isopropanol Ethanol 100% Ethanol 70% RNAse 1mg/ml Hỗn hợp Phenol: Chloroform: Isoamyl (25:24:1). Dung dịch TE 1X vô trùng: 10mM Tris HCl, 1mM EDTA, pH 8,0 16 – Dung dịch đệm ly trích DNA Tris (trisma bazơ): chất đệm, giữ ổn định pH tránh tổn hại DNA EDTA: tạo phức Mg++, gây bất hoạt enzyme phân hủy DNA trong quá trình tách chiết SDS: 20 % : phá vỡ và tẩy sạch màng tế bào, màng nhân để phóng thích DNA. - Dung dịch CTAB: dùng để kết tủa polysaccharide và tạp chất khác. 10 g CTAB. 100 ml NaCl 0,5 M. 3.3.2. Các hoá chất dùng trong điện di Gel agarose, thƣờng sử dụng gel có nồng độ 1% agarose. Đệm TAE 0,5X dùng để pha gel agarose và làm dung dịch đệm trong chạy điện di với thành phần nhƣ sau: Tris HCl 4,48 g Na2EDTA 0,5M (pH8,0) 2ml Glacial acetic acid 1,14 ml Nƣớc cất vừa đủ 1 lít Dung dịch nhuộm gel là Ethidium bromide 1%. Ladder 1 kp. Ladder 1,5 kb. DNA loading buffer. 3.3.3. Hoá chất cho phản ứng PCR (do công ty Bio - Rad cung cấp) Taq DNA polymerase nồng độ 5UI/µl. Dung dịch đệm 10X: đi kèm với Taq. dNTPs 10 mM. MgCl2 50 mM. Primer: đƣợc tổng hợp bởi công ty IDT (Mỹ). Xan 1330 5’ – GTT CCC GGG CCT TGT ACA CAC – 3’ Xan 322 5’ – GGT TCT TTT CAC CTT TCC CTC – 3’ (nguồn: Young Jin Park và ctv, 2004) XCF 5’ – CGATTCGGCCATGAATGACT – 3’ XCR 5’ – CTGTTGATGGTGGTCTGCAA – 3’ 17 (nguồn: Goncalves, E.R và Rosato, Y.B, 2002) 3.3.4. Môi trƣờng Môi trƣờng PDA. Môi trƣờng YGC. Môi trƣờng lỏng LB. ( thành phần và cách chuẩn bị môi trƣờng: xem phụ lục) 3.4. Dụng cụ, thiết bị Các dụng cụ và thiết bị cần thiết cho một phòng thí nghiệm sinh học phân tử. Kính lúp. Kính hiển vi và kính hiển vi soi nổi. Que cấy, đèn cồn. Tủ mát. Tủ lạnh -20oC. Máy đo pH. Tủ cấy vô trùng. Tủ ủ nhiệt. Máy lắc. Máy ly tâm lạnh. Máy khuấy từ. Bộ điện di. Máy PCR. Máy vortex. Máy chụp hình gel (Bio –Rad). Máy đọc trình tự ABI PRISM 3100. 3.5. Phƣơng pháp 3.5.1. Phƣơng pháp thu thập mẫu bệnh Mẫu bệnh đƣợc thu thập tại các vùng trồng rau ở Củ Chi, Hóc Môn và quận 12. Quan sát trên các ruộng rau cải ngọt, khi phát hiện các lá có triệu chứng bệnh (xuất hiện các đốm nhỏ có kích thƣớc 1 – 2 mm màu nâu đen, phân biệt với vết đốm tròn do bọ nhảy gây nên), tiến hành lấy mẫu lá, rửa kỹ bằng nƣớc sạch, bọc trong giấy thấm, cho vào bao ni lông. Mỗi ruộng lấy từ 3 – 4 lá. Mẫu lá lấy từ các ruộng khác nhau đƣợc kí hiệu riêng và đƣợc coi là một dòng bệnh. Mẫu sau khi thu thập đƣợc ủ ẩm tạo ẩm độ thích hợp cho vi sinh vật phát triển trƣớc khi đem phân lập. 3.5.2. Phƣơng pháp phân lập vi sinh vật từ mẫu bệnh Mẫu lá đƣợc rửa sạch đất cát bằng nƣớc vòi, thấm khô bằng giấy lọc. Các vết bệnh mới xuất hiện, còn nhỏ đƣợc chọn để phân lập. Mỗi mẫu bệnh cắt 1 đốm mới xuất hiện 18 triệu chứng (kích thƣớc nhỏ, vết bệnh có màu xanh giọt dầu). Khử trùng bề mặt bằng NaCLO 0,3% và cồn 70% để loại bỏ các sinh vật biểu sinh, sau đó dùng dao mổ cắt nhỏ vết bệnh ngâm vào nƣớc cất vô trùng. Để 5 – 10 phút sau cho vi khuẩn đi từ mô lá vào trong nƣớc cất. * Cấy vi khuẩn: Hút 1 ml dịch khuẩn ở trên nhỏ vào đĩa petri, cấy trang trên môi trƣờng bằng trang cấy thủy tinh chữ L. Mỗi đốm bệnh đƣợc cấy 3 lần lặp lại (9 đĩa). Đem các đĩa đã cấy đặt vào tủ định ôn ở 28oC trong 24 – 48 giờ. Sau thời gian nuôi cấy, lấy ra quan sát và chọn các khuẩn lạc. Phân loại khuẩn lạc bằng hình dạng, màu sắc và kiểu mọc. Chọn các khuẩn lạc màu vàng, lồi, bóng, nhầy mọc riêng rẽ để cấy ria lên môi trƣờng YGC 3.5.3. Phƣơng pháp chủng bệnh trên rau cải trồng trong nhà lƣới 3.5.3.1. Phƣơng pháp trồng cây kí chủ Để chủng bệnh, phải trồng cải ngọt sạch bệnh trong nhà lƣới. Giống cải ngọt để trồng đƣợc mua từ các công ty giống cây trồng bao gồm 3 giống: Số 4, Hai mũi tên đỏ và H&V. Giá thể trồng: vật liệu làm giá thể trồng bao gồm xơ dừa, rơm rạ hoai mục, tro trấu. Các thành phần trộn theo tỷ lệ 1:1:1, hỗn hợp này sau đó trộn với đất trồng theo tỷ lệ 1:1 tạo giá thể hoàn chỉnh. Toàn bộ giá thể đƣợc hấp khử trùng ở nhiệt độ 121oC. Xử lý hạt giống: trƣớc khi gieo, ngâm hạt trong nƣớc ấm 50oC sau đó đem gieo vào khay gieo sạch. Khay gieo có kích thƣớc 50 cm x 30 cm, chứa khoảng 200 lỗ. Cây con sau khi mọc 10 ngày đem trồng ra khay xốp với kích thƣớc lỗ lớn. Khi cây cải 20 ngày tuổi có khoảng 3 – 4 lá thật thì tiến hành chủng bệnh. 3.5.3.2. Chủng bệnh Để xác định dòng vi khuẩn gây bệnh, chủng bệnh tiến hành theo phƣơng pháp châm kim tạo vết thƣơng trên bề mặt lá. Trên mỗi lá châm thành hàng ở phần thịt lá dọc hai bên gân chính, mỗi bên châm khoảng 5 – 7 vết. Một bên sẽ đƣợc chủng vi khuẩn, bên kia không chủng để làm đối chứng so sánh. Các dòng vi khuẩn chọn chủng đƣợc cấy trên môi trƣờng PDA để thu sinh khối. Dùng tăm bông khử trùng lấy sinh khối vi khuẩn từ khuẩn lạc trên đĩa chấm vào vết thƣơng để lây nhiễm vi khuẩn vào mô lá. 19 Khay cải sau chủng đƣợc ủ ẩm bằng cách bọc trong túi ni lông có miệng để tạo độ ẩm thích hợp cho sự phát triển của vi khuẩn và tránh sự lẫn tạp các dòng với nhau. Sau 3 – 4 ngày, quan sát triệu chứng và ghi nhận kết quả. Lá nhiễm bệnh khi xung quanh vết châm có sự hoại tử mô tế bào (khác biệt với vết châm đối chứng ở đối diện gân lá). Để quan sát triệu chứng, hình thái và phản ứng của tế bào lá sau khi chủng. Chúng tôi tiến hành nhuộm lá bằng dung dịch Alcohollic lactophenol (thành phần và cách pha dung dịch: xem phần phụ lục). Phƣơng pháp nhuộm lá đƣợc mô tả nhƣ sau: - Cho lá cải cần nhuộm vào ống nghiệm, mỗi ống 2 lá. - Rót dung dịch Alcohollic lactophenol vào ống nghiệm đến khi ngập lá. - Đƣa ống nghiệm vào nồi nƣớc đang sôi, đến khi thấy bọt khí nổi lên thì lấy ra. - Để ống nghiệm ở nhiệt độ phòng cho đến khi bọt khí ngừng nổi. - Đổ bỏ dung dịch và rửa lá bằng nƣớc cất. - Mẫu lá sau đó đƣợc để khô tự nhiên. - Lƣu mẫu ở 4oC. Mẫu lá xác định có nhiễm bệnh đƣợc đem phân lập vi khuẩn gây bệnh. Các bƣớc phận lập đƣợc tiến hành nhƣ phƣơng pháp đƣợc trình bày ở mục 3.5.2. 3.5.4. Phƣơng pháp ly trích DNA từ vi khuẩn Vi khuẩn đƣợc nhân sinh khối trong môi trƣờng LB lỏng. Sau 48 giờ nuôi cấy, thu sinh khối và tiến hành ly trích. Ly trích DNA theo phƣơng pháp sử dụng CTAB: 1. Thu sinh khối vi khuẩn bằng cách ly tâm 10 000 vòng/ 5 phút/ 4oC. Rửa sinh khối vi khuẩn đƣợc với 1 ml nƣớc cất 2 lần vô trùng, đánh tan bằng vortex (rửa 2 – 3 lần). Ly tâm 10 000 vòng/ 5 phút/ 4oC. 2. Hòa tan sinh khối vi khuẩn thu đƣợc trong 567 µl dung dịch TE, đánh tan bằng vortex, thêm 30 µl dung dịch SDS 10%, trộn đều bằng vortex. Sau đó ủ ở 37oC khoảng 1 – 2 h. 3. Cho thêm vào 100 µl dung dịch NaCl 5M, hòa tan thật kỹ bằng vortex. 4. Thêm 80 µl dung dịch CTAB/NaCl (1/10 thể tích), pha trộn (đánh tan bằng vortex), ủ 65oC trong 10 phút. 20 5. Chiết xuất dung dịch DNA với 500 µl dung dịch phenol / chloroform / isoamyl alcohol (25:24:1). Trộn đều bằng cách lắc tay, ly tâm 14 000 vòng/ 10 phút/ 4oC. 6. Thu hết dung dịch bên trên cho vào ống ly tâm mới . 7. Thêm 780 µl dung dịch hỗn hợp chloroform / isoamyl alcohol (24:1).Hòa lẫn đều bằng lắc tay, ly tâm 12 000 vòng/10 phút/4 oC. 8. Thu lấy dịch bên trên cho vào ống ly tâm mới. Kết tủa DNA với isopropanol (2/3 thể tích dung dịch thu đƣợc), ủ ở - 20 oC/ 30 phút. Sau đó ly tâm 12 000 vòng/ 10 phút/4 oC. Lấy kết tủa sau ly tâm. 9. Rửa kết tủa bằng ethanol 70% ở -20 oC, ly tâm 13 000 vòng/10 phút/4 oC. Đổ cồn ra hết, làm khô bằng cách cho cồn bay hơi. 10. Hòa tan kết tủa trong 40 µl dung dịch TE, đem giữ mẫu ở tủ mát 4 oC trong suốt thời gian tiến hành đề tài. 3.5.5. Phƣơng pháp PCR 3.5.5.1. Khuếch đại vùng 16S – 23S rDNA ITS của vi khuẩn Phản ứng tiến hành với cặp mồi không chuyên biệt đƣợc thiết kế nhằm khuếch đại trình tự vùng ITS (intergenic spacer sequence) nằm giữa vùng rDNA 16S và 23S (Goncalves và Rosato, 2002): - Xan 1330 5’ – GTT CCC GGG CCT TGT ACA CAC – 3’ - Xan 322 5’ – GGT TCT TTT CAC CTT TCC CTC – 3’ Thành phần của phản ứng đƣợc thiết lập bao gồm: Bảng 3.1 Thành phần phản ứng PCR Thành phần Nồng độ Nồng độ sau cùng Thể tích ( l) PCR buffer 10X 1X 2,5 dNTP 1 mM 100 M 0,5 MgCl2 25 mM 1,5 mM 0,75 Primer 5 M 0,25 M 2 DNA 25 ng / l 1,25 ng / l 1 Taq polymerase 5 unit / l 0,1 unit / l 0,2 H2O 18,05 Tổng cộng 25 21 Chu kỳ nhiệt của phản ứng đƣợc thiết lập theo bảng sau: Bảng 3.2 Chu trình nhiệt phản ứng PCR với cặp mồi Xan1330 và Xan322 Giai đoạn Nhiệt độ (0C) Thời gian Số chu kỳ Biến tính 94 5 phút 1 Biến tính Bắt cặp Kéo dài 94 58 72 1 phút 45 giây 1 phút 30 Hoàn thành 72 10 phút 1 Giữ mẫu 4 30 phút 1 3.5.5.2. Khuếch đại đọan DNA trong gen hrpF Với thành phần nhƣ trên, phản ứng PCR đƣợc thực hiện với cặp mồi chuyên biệt, đƣợc thiết kế dựa vào trình tự gen hrpF (Young Jin Park và ctv, 2004). - XCF 5’ CGATTCGGCCATGAATGACT 3’ - XCR 5’ CTGTTGATGGTGGTCTGCAA 3’ Quy trình nhiệt của phản ứng nhƣ sau: Bảng 3.3 Quy trình nhiệt phản ứng PCR với cặp mồi XCF và XCR 3.5.6. Phƣơng pháp điện di và đọc kết quả 3.5.6.1. Điện di trên gel agarose Cho 0,125 gram agarose vào 12,5 ml dung dịch 0,5X TAE Giai đoạn Nhiệt độ (0C) Thời gian Số chu kỳ Biến tính 94 5 phút 1 Biến tính Bắt cặp Kéo dài 94 58 72 15 giây 15 giây 30 giây 35 Hoàn thành 72 5 phút 1 Giữ mẫu 4 30 phút 1 22 Đun sôi hỗn hợp trên khoảng 2 phút trong lò viba (đun 2 lần, mỗi lần 1 phút) Để nguội đến nhiệt độ khoảng 500C. Đổ gel vào bể điện di (đặt lƣợc tạo giếng trƣớc khi đổ gel), chú ý tránh bọt khí trên gel. Để nguội ở nhiệt độ phòng khoảng 30 phút, cẩn thận rút lƣợc ra khỏi gel, cho dung dịch 0,5X TAE vào bể đi

Các file đính kèm theo tài liệu này:

  • pdfTRAN VAN KY - 02131053.pdf