Phân tích đa dạng di truyền một số mẫu nấm Corynespora cassiicola (Berk và Curt.) Wei gây bệnh trên cây cao su (Hevea brasiliensis Muell. Arg.) bằng phương pháp rflp – pcr

MỤC LỤC PHẦN TRANG Trang tựa Lời cảm tạ i Tóm tắt ii Mục lục iii Danh sách các chữ viết tắt . .vi Danh sách các hình .v ii Danh sách các bảng .v ii 1. MỞ ĐẦU 1 1.1. Đặt vấn đề 1 1.2. Mục đích – Yêu cầu .2 1.2.1.Mục đích .2 1.2.2.Yêu cầu .2 2. TỔNG QUAN TÀI LIỆU .3 2.1. Sơ lược về cây cao su Hevea brasiliensis Muell. Arg. 2.2. Sơ lược về nấm C. cassiicola (Berk. & Curt.) Wei .4 2.2.1.Lịch sử phát hiện .4 2.2.2.Phạm vi phân bố 4 2.2.3.Phạm vi ký chủ và khả năng gây bệnh .5 2.2.4.Đặc tính sinh học của C. cassiicola .5 2.3. Nấm C. cassiicola (Berk. & Curt.) Wei trên cây cao su Hevea brasiliensis Muell. Arg . 6 2.3.1.Sự xuất hiện của nấm C. cassiicola (Berk. & Curt.) Wei trên cây cao su Hevea brasiliensis 6 2.3.2.Tình hình bệnh do C. cassiicola gây ra trên cây cao su tại một số nước trồng cao su 6 2.3.3.Đặc tính sinh học của nấm C. cassiicola trên cây cao su .9 2.4. Triệu chứng bệnh của cây cao su bị nhiễm bệnh do C. cassiicola .9 2.5. Kỹ thuật polymerase chain reaction (PCR) 10 2.5.1.Nguyên tắc của phản ứng PCR . 10 2.5.2.Các yếu tố ảnh hưởng đến phản ứng PCR 12 2.6. Enzyme cắt giới hạn (restriction endonuclease – RE) . 14 2.6.1.Giới thiệu 16 2.6.2.Định danh các enzyme . 15 2.6.3.Trình tự nhận biết của các enzyme cắt giới hạn . 16 2.6.4.Sử dụng các enzyme cắt giới hạn trong phân tích DNA 16 2.6.5.Phân tích kết quả của các phản ứng cắt bằng RE . 18 2.6.6.Bản đồ giới hạn . 19 2.7. Vùng ITS và vai trò của nó trong phân tích đa dạng di truyền 19 2.8. Những nghiên cứu về C. cassiicola trong và ngoài nước 21 2.8.1.Những nghiên cứu về C. cassiicola ngoài nước .21 2.8.2.Những nghiên cứu về C. cassiicola trong nước .23 3. VẬT LIỆU VÀ PHưƠNG PHÁP TIẾN HÀNH 24 3.1. Thời gian và địa điểm tiến hành . 24 3.1.1.Thời gian .24 3.1.2.Địa điểm . .24 3.1.3.Đối tượng nghiên cứu .24 3.2. Nội dung nghiên cứu 24 3.2.1.Phân lập nấm nguồn nấm C. cassiicola .24 3.2.1.1. Hóa chất và dụng cụ 24 3.2.1.2. Phương pháp lấy mẫu 25 3.2.1.3. Phương pháp phân lập .25 3.2.2.Khuếch đại vùng ITS bằng kỹ thuật PCR .26 3.2.2.1. Chuẩn bị DNA khuôn mẫu cho phản ứng PCR .26 3.2.2.2. Thực hiện phản ứng PCR 28 3.2.2.3. Đọc kết quả của phản ứng PCR . 30 3.2.3.Phân tích sản phẩm PCR bằng các enzyme cắt giới hạn (RE) .30 3.2.3.1. Hóa chất và dụng cụ .31 3.2.3.2. Thành phần hóa chất của phản ứng RFLP 31 4. KẾT QUẢ VÀ THẢO LUẬN .32 4.1. Về tác nhân gây bệnh rụng lá Corynespora 32 4.2. Kết quả ly trích DNA nấm C. cassiicola 37 4.3. Kết quả PCR vùng ITS của nấm C. cassiicola 37 4.4. Kết quả phân tích RFLP sản phẩm PCR vùng ITS .40 5. KẾT LUẬN VÀ ĐỀ NGHỊ .46 5.1. Kết luận 46 5.2. Đề nghị .46 6. TÀI LIỆU THAM KHẢO 48 7. PHỤ LỤC .52 PHÂN TÍCH ĐA DẠNG DI TRUYỀN MỘT SỐ MẪU NẤM Corynespora cassiicola (Berk. & Curt.) Wei GÂY BỆNH TRÊN CÂY CAO SU (Hevea brasiliensis Muell. Arg.) BẰNG PHƯƠNG PHÁP RFLP – PCR

pdf66 trang | Chia sẻ: lvcdongnoi | Ngày: 04/06/2013 | Lượt xem: 1734 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Phân tích đa dạng di truyền một số mẫu nấm Corynespora cassiicola (Berk và Curt.) Wei gây bệnh trên cây cao su (Hevea brasiliensis Muell. Arg.) bằng phương pháp rflp – pcr, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
những thao tác đối với số lượng và kích thước của sản phẩm tạo thành khó khăn hơn nhiều. Điều này được giải quyết vào đầu những năm 1970 khi kỹ thuật điện di được phát triển (Desmond và Nicholl, 1994). 2.5.5.1. Tách các phân tử bằng điện di trên gel Do phân tử DNA tích điện âm nên khi đặt phân tử DNA trong một điện trường phân tử DNA sẽ di chuyển về phía điện cực dương. Tốc độ di chuyển của phân tử DNA tùy thuộc vào hình dạng và tỉ lệ điện tích/ khối lượng của chúng. Tuy nhiên, hầu hết các phân tử DNA đều có hình dạng giống nhau và tỉ lệ điện tích/khối lượng gần như nhau nên không thể tách các phân tử DNA bằng kỹ thuật điện di chuẩn. Tuy nhiên, phân tử DNA có kích thước khác nhau có thể được phân biệt khi điện di trên gel agarose hoặc gel polyacrylamide. Gel là một mạng lưới lỗ mà phân tử DNA cần phải vượt qua để đi đến cực dương. Do vậy, phân tử nào có kích thước 20 nhỏ hơn sẽ di chuyển nhanh hơn và ngược lại. Tùy theo thành phần của gel mà các phân tử DNA có kích thước khác nhau có thể được phân tách khi điện di trên gel đó (Desmond và Nicholl, 1994). 2.5.5.2. Quan sát các phân tử DNA trên gel Nhuộm bằng hóa chất Cách đơn giản nhất để xem kết quả điện di là nhuộm gel bằng hóa chất có thể làm cho phân tử DNA thấy được. Hóa chất thường được sử dụng để nhuộm gel là ethidium bromide. Các băng DNA có kích thước khác nhau phân tách trên gel sẽ được quan sát dễ dàng dưới ánh sáng của tia tử ngoại (Desmond và Nicholl, 1994). Ảnh phóng xạ tự ghi của những phân tử DNA đƣợc đánh dấu phóng xạ Một hạn chế của phương pháp nhuộm ethidium bromide là độ nhạy bị hạn chế. Lượng DNA của một băng nếu ít hơn 25 ng sẽ không thể hiển thị khi nhuộm gel với ethidium bromide. Một phương pháp khác là sử dụng các dấu hiệu có hoạt tính phóng xạ để đánh dấu các phân tử DNA. Khi đó, DNA có thể được quan sát khi đặt lên bản gel một tấm phim nhạy cảm với tia X. Phân tử DNA cũng có thể được đánh dấu bằng cách gắn các nucleotide có mang đồng vị Phospho phóng xạ P32. Ngoài ra, một số phương pháp khác cũng cho phép đánh dấu các phân tử DNA (Desmond và Nicholl, 1994). 2.5.6. Bản đồ giới hạn Hầu hết các đoạn DNA đều có trình tự nhận biết đối với những enzyme khác nhau. Điều này có lợi vì nó cho biết vị trí tương đối của những vị trí cắt này. Kỹ thuật thu nhận những thông tin như vậy được gọi là lập bản đồ giới hạn (restriction mapping). Việc này liên quan đến việc sử dụng enzyme cắt riêng lẻ và sau đó cắt kết hợp bằng nhiều enzyme, các đoạn được tạo thành được chạy điện di trên gel agarose để kiểm tra kích thước. Từ những dữ liệu thu được ta có thể lập được bản đồ giới hạn (Desmond và Nicholl, 1994). 2.6. Vùng ITS (internal transcribed spacer) và vai trò của nó trong nghiên cứu đa dạng di truyền Hiện nay, vùng ITS có lẽ là vùng DNA được giải trình tự rộng rãi nhất ở loài nấm. Nó là một công cụ hữu dụng nhất cho hệ thống phân tử ở cấp độ loài (species) và trong cùng loài (within species), ví dụ như xác định các nòi địa lý. Do mức độ biến dị của nó 21 cao hơn các vùng khác của rDNA, sự biến dị giữa các đoạn lặp rDNA riêng biệt có thể được quan sát ở cả trong vùng ITS và vùng IGS (intergenic spacer region) ( Hình 2.3: Sơ đồ vùng ITS ở nấm. Ghi chú: LSU: large subunit SSU: small subunit IGS: intergenic spacer Nguồn: Hình 2.4: Lƣợc đồ các primer trên vùng ITS. Nguồn: 22 Hiện nay, có nhiều primer được thiết kế để khuếch đại vùng ITS và một số primer đã được phát triển nhằm khuếch đại chọn lọc hơn trình tự vùng ITS ở nấm. Bảng 2.3: Một số primer và trình tự của nó dùng trong nghiên cứu vùng ITS của nấm Tên primer Trình tự 5’ – 3’ Tác giả ITS1 TCCGTAGGTGAACCTGCGG White et al, 1990 ITS 2 GCTGCGTTCTTCATCGATGC White et al, 1990 ITS 3 GCATCGATGAAGAAAACGCAGC White et al, 1990 ITS 4 TCCTCCGCTTATTGATATGC White et al, 1990 ITS 5 GGAAGTAAAAGTCGTAACAAGG White et al, 1990 ITS1-F CTTGGTCATTTAGAGGAAGTAA Gardes & Bruns, 1993 ITS4-B CAGGAGACTTGTACACGGTCCAG Gardes & Bruns, 1993 5,8S CGCTGCGTTCTTATCG Vilgalys lab. 5,8SR TCGATGAAGAACGCAGCG Vilgalys lab. Nguồn: 2.7. Tình hình nghiên cứu về C. cassiicola trong và ngoài nƣớc 2.7.1. Những nghiên cứu về C. cassiicola ngoài nƣớc C. cassiicola đã được nghiên cứu khá nhiều ở nhiều nước trên thế giới, do C. cassiicola có phổ ký chủ rộng (gây hại trên nhiều loại cây trồng khác nhau). Ngoài những nghiên cứu về tình hình và khả năng gây hại của C. cassiicola ở các khu vực khác nhau, C. cassiicola trên các ký chủ khác nhau cũng đã được nghiên cứu và so sánh mức độ khác biệt về di truyền và tìm hiểu khả năng nhận biết các dòng C. cassiicola, cũng như mức độ và khả năng gây độc của C. cassiicola. Kết quả của những nghiên cứu này cho thấy, tính độc của C. cassiicola ngày càng phát triển đa dạng và rất biến thiên, khả năng gây độc của C. cassiicola trên các dvt cao su khác nhau, tùy theo giai đoạn sinh trưởng. C. cassiicola có khả năng tổng hợp các enzyme phân giải pectin và enzyme phân giải cellulose ngoài cơ chế biến dưỡng độc tố (C.K. Jayashinge, 2000). 23 Nghiên cứu biến dị di truyền của 42 isolates nấm C. cassiicola trên các ký chủ khác nhau bằng phương pháp RAPD – PCR của Silva và các cộng sự (1995) cho thấy, có 5 nhóm di truyền đã được xác định, điều này có nghĩa là có sự khác biệt di truyền đáng kể giữa các isolates nấm C. cassiicola thu thập từ các ký chủ khác nhau. Những kết quả nghiên cứu này làm cho việc nghiên cứu tạo các dvt cao su kháng bệnh trở nên dễ dàng hơn (Silva và cộng sự, 2003). Những khác biệt về di truyền của nấm bệnh C. cassiicola trên ký chủ khác nhau đã được nghiên cứu bằng phân tích đa hình RFLP trên vùng ITS (internal transcribed spacer) của ribosome DNA và đa hình các đoạn DNA được khuếch đại từ DNA tổng số. Các chủng C. cassiicola có thể được phân biệt với các loài lân cận thuộc giống Helminthosporum dựa trên kích thước của vùng ITS được khuếch đại, nhưng không thể phân biệt rõ ràng vì vùng ITS của các isolates có kích thước giống nhau và phân cắt bằng các enzyme cắt giới hạn cũng cho những kết quả giống nhau. Tuy nhiên, kỹ thuật RAPD đã phát hiện được khác biệt đáng kể giữa một số isolates C. cassiicola. Phân tích theo nhóm các đoạn DNA được khuếch đại cho thấy 5 isolates được xếp vào 3 nhóm di truyền khác nhau tương ứng với nguồn gốc ký chủ và đặc điểm hình thái. Các kỹ thuật này có thể được mở rộng để nghiên cứu biến dị trong cùng isolates C. cassiicola trên cây cao su ở Sri Lanka, nơi mà các chủng C. cassiicola độc tính cao đã xuất hiện đe dọa nghiêm trọng cho ngành công nghiệp cao su thiên nhiên của nước này (Silva và cộng sự, 2002). Safiah Atan và Noor Hisham Hamid (2003) đã sử dụng kỹ thuật RAPD và khuếch đại vùng ITS để phân tích 9 isolates nấm C. cassiicola từ Hevea brasiliensis. Kỹ thuật RAPD với các primer ngắn đã cho phép phân biệt được 2 nhóm isolates, là isolates gây nhiễm cho các dvt RRIM 2020 và nhóm isolates gây nhiễm cho các dvt RRIM 600 và các dvt cao su khác. Kỹ thuật khuếch đại vùng ITS cho thấy 8/9 isolates là đơn hình khi phân tích sản phẩm khuếch đại bằng các enzyme cắt giới hạn. Silva và cộng sự (1998) kết hợp nghiên cứu đặc điểm hình thái, độc tính và đặc điểm phân tử của nấm C. cassiicola thu nhận từ các đồn điền cao su ở Sri Lanka. 32 isolates C. cassiicola được thu nhận từ phổ ký chủ rộng và địa điểm khác nhau đã được phân tích RFLP trên vùng ITS được khuếch đại và kỹ thuật RAPD khuếch đại hệ gen C. cassiicola bằng các primer ngẫu nhiên. Vùng ITS cho kết quả giống nhau 24 ở tất cả các isolates khi phân tích bằng các enzyme cắt giới hạn. Tuy nhiên, kỹ thuật RAPD đã phát hiện sự đa hình rất lớn giữa các isolates, phân tích các dữ liêu thu thập được từ việc sử dụng 15 oligonuceotide primer đã xác định được có 7 nhóm RAPD khác nhau, các isolates có sự tương quan rất lớn giữa nhóm RAPD và vị trí phân lập cũng như kiểu gen của cây trồng ký chủ mà từ đó các isolates được phân lập. Ngoài ra, cũng có mối tương quan giữa nhóm RAPD với tỷ lệ tăng trưởng của isolate và tính độc trên các cây trồng ký chủ khác nhau. 2.7.2. Những nghiên cứu về C. cassiicola trong nƣớc Bệnh rụng lá Corynespora được phát hiện lần đầu tiên ở nước ta vào tháng 09/1999 tại Trạm Thực Nghiệm Cao Su Lai Khê, Viện Nghiên Cứu Cao Su Việt Nam. Do bệnh là đối tượng kiểm dịch loại 2, nên khi vừa phát hiện, Viện Nghiên Cứu Cao Su Việt Nam, cùng với Chi Cục Bảo Vệ Thực Vật Vùng II và Tổng Công Ty Cao Su Việt Nam đã thống nhất loại bỏ tất cả những dvt mẫn cảm nhằm dập tắt nguồn bệnh ngay từ ban đầu (Tổng Công Ty Cao Su Việt Nam, 2004). Những nghiên cứu về bệnh rụng lá Corynespora ở Việt Nam hiện nay mới chỉ dừng lại ở việc quan sát đánh giá tình hình bệnh, kiểm tra tính kháng của một số dvt cao su. Việc ứng dụng các kỹ thuật sinh học phân tử để nghiên cứu về C. cassiicola chưa nhiều. 25 PHẦN III VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 3.1. Thời gian và địa điểm tiến hành 3.1.1. Thời gian Thí nghiệm được thực hiện từ tháng 03/2005 đến tháng 08/2005. 3.1.2. Địa điểm - Thu thập một số mẫu trên đồng ruộng, tiến hành tại Bến Cát, Bình Dương và An Lộc, Đồng Nai. - Tiến hành phân lập C. cassiicola tại phòng thí nghiệm Bộ Môn Bảo Vệ Thực Vật,Viện Nghiên Cứu Cao Su Việt Nam - Lai Khê, Bến Cát, Bình Dương. - Tiến hành phân tích RFLP - PCR tại Phòng Thí Nghiệm Công Nghệ Sinh Học Bảo Vệ Thực Vật – Trung Tâm Phân Tích Và Thí Nghiệm Hoá Sinh Đại Học Nông Lâm Tp. HCM. 3.1.3. Đối tƣợng nghiên cứu Một số mẫu lá cao su thuộc các dvt cao su khác nhau có biểu hiện các triệu chứng đặc trưng và không đặc trưng của bệnh rụng lá Corynespora. 3.2. Nội dung và phƣơng pháp nghiên cứu 3.2.1. Phân lập nguồn nấm C. cassiicola 3.2.2.1. Hóa chất và dụng cụ Bình tam giác, ống nghiệm, đĩa petri, que cấy, đèn cồn, pence, lame, lamelle, giá đỡ ống nghiệm, becher, kính hiển vi quang học, nồi hấp Tommy, tủ sấy, hộp đựng mẫu, giấy thấm nước, bút lông… Môi trường PSA hoặc PDA (tự pha chế theo công thức do Chee đề xuất năm 1988). Thuốc nhuộm Methylene blue. Thành phần môi trƣờng PSA: Khoai tây 100 g 26 Đường sucrose 10 g Agar 15 g Nước cất vừa đủ 1000 ml Thành phần môi trƣờng PDA: Khoai tây 200 g Đường glucose 2 0 g Agar 15 g Nước cất vừa đủ 1000 ml Cách nấu môi trƣờng PSA: Khoai tây gọt vỏ rửa sạch, cân đủ 100g, thái nhỏ hạt lựu, thêm 500 ml nước cất 2 lần đun sôi trong 30 phút. Lọc lấy nước trong. Thêm 15g agar và 500 ml nước cất vào dung dịch đã lọc. Bổ sung thêm nước cất cho đủ 1000 ml và thêm 10g đường sucrose. Đun sôi trong 30 phút, khuấy đều trong lúc nấu. Phân vào các ống nghiệm (10 ml/ ống) và đem hấp khử trùng ở 121 C/ 15 phút. Môi trường PDA được thực hiện tương tự như môi trường PSA. 3.2.2.2.Phƣơng pháp lấy mẫu Mẫu được lấy vào buổi sáng sớm khi độ ẩm không khí còn cao, bào tử còn nằm trên lá và chưa phát tán vào không khí. Thông thường, mẫu được lấy trước 8h sáng. Mẫu được ghi rõ tên dvt lấy mẫu, địa điểm lấy mẫu, lá non hay lá già, vết bệnh đặc trưng hay không đặc trưng. Mẫu lá bệnh được đặt vào hộp có đặt giấy thấm nước để giữ ẩm. 3.2.2.3.Phƣơng pháp phân lập Mẫu nấm được phân lập từ vết bệnh đặc trưng hoặc không đặc trưng của bệnh rụng lá Corynespora. Cách thực hiện như sau: Lấy lá bệnh đưa về phòng thí nghiệm, rửa bằng nước cất vô trùng 3 lần, dùng que cấy nấm đã khử trùng ướt và khô, sau đó đốt trên ngọn lửa đèn cồn, để nguội lấy trực tiếp bào tử ngay trên vết bệnh cấy vào đĩa môi trường (5 điểm/đĩa). Phương pháp phân lập từ một bào tử, sau hai ngày những khuẩn lạc nghi ngờ là nấm C. cassiicola được cấy sang đĩa môi trường 27 mới (môi trường PDA) và đặt dưới ánh sáng đèn huỳnh quang 12h/ngày ở điều kiện nhiệt độ phòng (26 - 30ºC). Khi nấm phát triển, tiến hành cấy chuyền sang môi trường mới cho đến khi thu được nguồn nấm thuần chủng. Trong phân lập nấm C. cassiicola thường lấy bào tử ở mặt dưới của phiến lá. Bề mặt dưới của phiến lá là nơi thuận lợi cho sự phát triển của nấm hơn bề mặt trên của lá. Tầng cutin mỏng giúp nấm xâm nhập vào mô lá dễ dàng hơn, nấm ít chịu ảnh hưởng của các điều kiện môi trường, đặc biệt là tia tử ngoại của ánh sáng mặt trời. Sử dụng phương pháp phân lập như trên có thể thu nhận được nguồn nấm C. cassiicola đơn bào tử. Tuy nhiên, cần lưu ý là phương pháp này chỉ thực hiện được đối với nấm C. cassiicola do kích thước của bào tử nấm C. cassiicola tương đối lớn. Với phương pháp phân lập như trên, sau khi phân lập các mẫu nấm cần phải được kiểm tra lại bằng cách quan sát hình thái sợi nấm và bào tử của nấm C. cassiicola dưới kính hiển vi. Nấm C. cassiicola rất khó tạo bào tử trên môi trường nhân tạo, để tạo được bào tử C. cassiicola trên môi trường nhân tạo có thể tiến hành theo phương pháp sau. Phƣơng pháp tạo bào tử nấm C. cassiicola nấm trên môi trƣờng PSA Các mẫu nấm sau khi thuần được cấy vào đĩa Petri có chứa 10 ml môi trường PSA. Nuôi cấy trong điều kiện tối liên tục 24/24h ở điều kiện nhiệt độ phòng trong 5 ngày. Sau 5 ngày nuôi cấy sử dụng một tấm lame vô trùng cạo nhẹ trên bề mặt khuẩn lạc để kích thích sợi nấm tạo bào tử. Tiếp tục nuôi cấy ở điều kiện chiếu sáng hoàn toàn 24/24h ở nhiệt độ phòng trong 3 ngày. Sau thời gian trên tiến hành kiểm tra lại nguồn nấm bằng cách soi bào tử dưới kính hiển vi (đặt bào tử trong giọt nước cất hoặc giọt dung dịch methylene blue). Hình dạng bào tử được so sánh với những mô tả của Ellis và Holiday (1971). Các nguồn nấm được xác định chính xác là nấm C. cassiicola sẽ được sử dụng vào những phân tích tiếp theo. 3.2.2. Khuếch đại vùng ITS bằng kỹ thuật PCR 3.2.2.1. Chuẩn bị DNA khuôn mẫu cho phản ứng PCR 28 Các dòng nấm C. cassiicola sau khi đã phân lập thuần đƣợc chuyển sang môi trƣờng lỏng, tiến hành nuôi cấy trên máy lắc (160 vòng/phút), điều kiện nhiệt độ 26 - 30 C. Sau 4 ngày tiến hành thu sinh khối sợi nấm. Cần lƣu ý là sợi nấm phải khô và nên giữ nguồn sợi nấm ở -70 C. Hóa chất và dụng cụ ly trích - Becher, phễu lọc, giấy thấm, nitơ lỏng, phenol, chloroform, isoamyl alcohol, lysis buffer, isopropanol, TE 1X, ethanol 100%, ethanol 70%. - Cối và chày để nghiền mẫu, eppendorf, micropipette và các loại đầu tip, bồn ủ nhiệt Memmert, máy vortex. Phương pháp ly trích Khuôn mẫu cho phản ứng PCR là DNA của sợi nấm của các mẫu phân lập được. Phương pháp ly trích DNA được thực hiện theo quy trình của Lee & Taylor (1990). Quy trình ly trích DNA tổng số nấm C. cassiicola 1) Nuôi trong môi trường lỏng. 2) Giữ sợi nấm ở - 70 C. 3) Lấy 1g sợi nấm khô kiệt vào cối và nghiền trong dung dịch nitơ lỏng. 4) Chuyển phần bột nấm vào ống eppendorf. Ở bước này, cố gắng giữ cho bột nấm được nghiền không tan. 5) Thêm 400 l lysis buffer, trộn đều hỗn hợp. 6) Ủ ở 65 C trong 1 giờ. 7) Di chuyển ống nghiệm ra khỏi dung dịch nước ấm (ra khỏi bồn ủ nhiệt). 8) Thêm vào 300 l phenol: chlorophorm và isoamyl alcohol (25:24:1), lắc nhẹ (lúc này dung dịch có màu trắng đục). Ly tâm 14 000 vòng trong 1 phút ở 28 C. 9) Chuyển phần trên ống eppendorf sang một eppendorf khác với thể tích 300 l và kết tủa DNA bằng cách thêm vào ½ thể tích isopropanol, trộn nhẹ và cẩn thận. DNA sẽ kết tủa dạng sợi màu trắng đục. 29 10) Ly tâm 14 000 vòng trong 1 phút ở 28 C. 11) Cẩn thận đổ bỏ phần dịch lỏng. Dùng ethanol 70 % rửa sạch nhiều lần DNA. 12) Làm khô DNA, hoà tan trong dung dịch TE 1X và tồn trữ ở 4 C hay – 20 C cho đến khi sử dụng 3.2.2.2 Thực hiện phản ứng PCR Hóa chất và dụng cụ Các primer: 2 primer được sử dụng trong nghiên cứu là ITS A và ITS B được mô tả bởi Silva và cộng sự (1998), hai primer này được thiết kế để khuếch đại một đoạn DNA có kích thước 540 nằm trong vùng ITS 1 và ITS 2 của nấm C. cassiicola. Trình tự của các primer ITS A và ITS B như sau: Primer Trình tự 5’- 3’ ITS A GGGAATTCTCCGTAGGTGAACCTGCGG ITS B GCAAGCTTTCCTCCGCTTATTGATATGC Hoá chất, các enzyme và dung dịch dùng trong phản ứng PCR và điện di: Taq DNA polymerase (Biorad). PCR buffer(Biorad). dNTP’s (dATP, dTTP, dCTP, dGTP) (Biorad). MgCl2 (Biorad). DNA ladder. (Biorad). Ethidium bromide. Dịch đệm TAE 0,5X. Loading buffer 6X, gel agarose. Dụng cụ thí nghiệm: Eppendorf các loại: 0.2ml, 0.5 ml, 1.5ml. Micropippette và các đầu típ. Lò vi sóng. Cân kỹ thuật 4 số. Máy điện di (electrophoresis) (Mini-Subgel, Biorad). UV transilluminator (Biorad). 30 Máy chụp ảnh (DNA photography equipment) (Biorad). Máy thermal cycle (thực hiện phản ứng PCR). Thành phần hoá chất và chu kỳ phản ứng PCR Thành phần hóa chất của phản ứng PCR: Thành phần hóa chất (bảng 2.2): dNTP, 10X PCR buffer, MgCl2, primers, Taq polymerase. Nước cất: thêm vào cho đủ một phản ứng PCR (25 l). Khuôn mẫu DNA: sử dụng 1 l DNA cho phản ứng PCR 25 l. Bảng 3.1: Thành phần hóa chất cho phản ứng PCR. Thành phần Liều lượng phản ứng ( l) Nồng độ đầu Nồng độ cuối dNTP 0,5 10 mM 0,2 mM 10X PCR buffer 2,5 10 X 1 X MgCl2 1 25mM 1 mM ITS A 1 25pM/ l 25pM ITS B 1 25 M 0,5 M Taq polymerase 0,1 5U Khuôn mẫu 1 Nước cất vừa đủ phản ứng 25 l Phản ứng PCR được thực hiện theo quy trình của Silva và cộng sự năm 1998. Chu kỳ của phản ứng PCR: tổng cộng có 41 chu kỳ (Siva và cộng sự, 1998) - Chu kỳ 1: Biến tính: 94 C 3phút. Bắt cặp: 51 C 1 phút. Kéo dài: 72 C 1 phút. - 39 chu kỳ tiếp theo. Biến tính: 94 C 3 phút. Bắt cặp: 51 C 1 phút. 31 Kéo dài: 72 C 1 phút - 1 chu kỳ cuối: Biến tính: 94 C 1phút. Bắt cặp: 51 C 1 phút. Kéo dài: 72 C 9 phút. Tùy theo sản phẩm PCR thu đƣợc, các điều kiện của phản ứng PCR sẽ đƣợc điều chỉnh để thu đƣợc sản phẩm PCR tối ƣu nhất dùng trong các phân tích tiếp theo. 94 C 94 C 94 C 72 C 72 C 72 C 54 C 54 C 54 C (1X) (39X) (1X) Hình 3.1: Hình minh họa chu trình nhiệt của phản ứng PCR dùng trong thí nghiệm. 3.2.2.4. Đọc kết quả phản ứng PCR Sản phẩm PCR sẽ được kiểm tra bằng cách điện di trên gel agarose. - Cho 0,15g agarose vào 15 ml dung dịch TAE 0,5X (nồng độ 1%). - Đun sôi khoảng 1- 2 phút trong lò vi sóng. - Để nguội đến 40 – 50 C ở nhiệt độ phòng. - Đổ gel vào bể điện di (đặt lược vào giếng trước khi đổ gel), chú ý không để bọt khí trên gel. - Để nguội khoảng 30 phút, cho gel đông cứng, rút lược khỏi gel, đặt bản gel vào bể điện di sao cho gel ngập trong dung dịch TAE từ 1 – 1,5 cm. 32 - Trộn 3 l sản phẩm PCR với 1,5 l loading dye 6X trên mặt giấy parafin. Cho hỗn hợp vào giếng của gel, bao gồm giếng thang chuẩn, giếng đối chứng và giếng chứa mẫu. - Vận hành máy điện di ở hiệu điện thế 50V. Sau khi hoàn tất quá trình điện di, bản gel được lấy ra khỏi bồn điện di và nhuộm trong dung dịch ethidium bromide trong khoảng 15 – 20 phút và chụp ảnh gel bằng máy chụp gel (Biorad). 3.2.3. Phân tích sản phẩm PCR bằng các enzyme cắt giới hạn (RE) Sản phẩm PCR thu được sẽ được phân tích bằng các enzyme cắt giới hạn để xem xét có sự khác biệt về di truyền giữa các mẫu phân tích hay không. 3.2.3.1. Hóa chất và dụng cụ dùng trong phân tích RFLP sản phẩm PCR - Các enzyme cắt giới hạn EcoRI, MspI, CfoI, HaeIII, Sau3A, RsaI (Roche, Germany). - Sản phẩm PCR vùng ITS của nấm C. cassiicola. - Bồn ủ nhiệt, gel agarose, máy điện di (Biorad), máy chụp gel (Biorad). - Dung dịch ethidium bromide . - Đầu tip 10 l, 100 l, eppendorf 0,2 ml. 3.2.3.2. Thành phần hóa chất của phản ứng RFLP Sản phẩm PCR sẽ được phân cắt riêng rẽ bằng các enzyme EcoRI, MspI, CfoI, HaeIII, RsaI, Sau3AI (Roche, Germany). Thành phần của một phản ứng RFLP như sau (xem thêm bảng 3.3). - Enzyme : 1 đơn vị enzyme. - Enzyme buffer: 2,5 l. - Sản phẩm PCR: 8 l. - Nước: thêm vào cho đủ một phản ứng (25 l). Bảng 3.2: Thành phần hóa chất của phản ứng RFLP. Thành phần Liều lượng phản ứng ( l) Nồng độ đầu Nồng độ cuối Enzyme Buffer enzyme Sản phẩm PCR Nước 0,1 2,5 8 10 U/ l 10 X 1U 1X 33 vừa đủ phản ứng 25 l Phản ứng cắt của enzyme được thực hiện bằng cách ủ mẫu với các thành phần như trên trong bồn ủ nhiệt, điều kiện nhiệt độ 37 C trong thời gian 3-14 giờ, sau đó tiến hành bất hoạt enzyme ở nhiệt độ 65 C trong thời gian 15 phút (tùy theo mỗi enzyme mà có hay không có bước này). Sự khác biệt về di truyền giữa các mẫu nghiên cứu được thể hiện khi kích thước của sản phẩm sau phản ứng khác nhau ở các mẫu. Kiểm tra sự khác biệt về kích thước của sản phẩm cắt bằng cách điện di trên gel agarose 2% - 3%(w/v) và quan sát kích thước của các đoạn DNA tạo thành bằng cách nhuộm gel bằng ethidium bromide và chụp ảnh DNA bằng máy chụp gel (Biorad). 34 PHẦN IV KẾT QUẢ VÀ THẢO LUẬN 4.1. Về tác nhân gây bệnh rụng lá Corynespora Bệnh rụng lá Corynespora trên cây cao su do nấm C. cassiicola gây ra là một bệnh mới ở Việt Nam. Đây là một bệnh rất nguy hiểm, một khi xảy ra dịch bệnh sẽ gây ảnh hưởng rất lớn đến năng suất mủ cao su. Bệnh này gây rụng lá toàn bộ đối với cây cao su bị nhiễm bệnh nặng. Bệnh rụng lá Corynespora đã xảy ra ở nhiều nước trên thế giới và gây thiệt hại kinh tế rất đáng kể, nhất là các nước sản xuất cao su thiên nhiên (Jayashinghe, 1997). Những nghiên cứu trước đây trên thế giới cho thấy khả năng gây hại của nấm rất lớn, đã có 6 chủng nấm C. cassiicola (Berk. & Curt.) Wei được ghi nhận là gây hại cho cao su tại Malaysia và 7 chủng tại Ấn Độ (Sabu và cộng sự, 2000). C. cassiicola rất dễ hình thành nòi mới khi có điều kiện thích hợp và độ ẩm lớn hơn 90%, phát tán và lây lan mạnh chủ yếu dựa vào tính mẫn cảm của dvt, điều kiện môi trường và tính độc hại của tác nhân gây bệnh. Đây là ba yếu tố chính dẫn đến sự phát sinh, phát triển bệnh cũng như quyết định mức độ bệnh (Jayashinghe và Silva, 1996; Jayashinghe, 2000). Nói chung, tính đặc thù của nấm là khả năng biến đổi nhanh chóng với ký chủ mới. Về mức độ ảnh hưởng không giống các bệnh về lá khác hiện có tại Việt Nam bởi tác hại của bệnh rất lớn và ảnh hưởng nghiêm trọng đến cây cao su, phạm vi gây hại rộng từ lá non, lá già, cuống lá, chồi và từ vườn ương, vườn kiến thiết cơ bản đến vườn cây khai thác. Ở Việt Nam, bệnh này chưa bùng phát mạnh nhờ hiệu quả của công tác quản lý dịch bệnh. Những dvt mẫn cảm với bệnh này đều bị loại bỏ và được khuyến cáo không trồng. Khi phát hiện vườn cây có bệnh, tiến hành cưa bỏ toàn bộ, đốt cháy để hạn chế sự phát tán mầm bệnh. Những khu vực phát hiện bệnh này là Miền Đông Nam Bộ (Bình Dương, Đồng Nai), miền Bắc (Hà Tây, Nghệ An). Những đợt điều tra bệnh lá trên cây cao su gần đây ở tỉnh Tây Ninh và khu vực Tây Nguyên chưa phát hiện thấy có bệnh này. Về địa điểm lấy mẫu: mẫu bệnh rụng lá Corynespora được thu thập ở hai địa điểm là Vườn Dự Án Giống và Vườn Lưu Trữ Giống thuộc Bộ Môn Giống – VNCCSVN (Bình Dương), và vườn kiểm định bệnh An Lộc (Đồng Nai). Chúng tôi tiến hành thu 35 thập mẫu bệnh trên nhiều dvt khác nhau (bảng 4.1), sau đó tiến hành phân lập nấm C. cassiicola từ các mẫu bệnh. Bảng 4.1: Các dvt cao su đƣợc lấy mẫu và đặc điểm triệu chứng của bệnh (đặc trƣng/ không đặc trƣng). Số thứ tự Dvt cao su được lấy mẫu bệnh Đặc điểm triệu chứng bệnh Nơi lấy mẫu 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 20 21 22 23 24 25 26 27 28 29 30 31 32 RRIV 2 RRIV4 MT/C/5 MT/C/4 AC/B/18 AC/B/17 LH 97/164 LH 96/347 RRIC 121 MTIT 14 MTIT 16 RO/CM/10 FX 2840 AC 88 PB 255 PB 260 MTI2 ROT5 LH 97/167 LH 82/008 LH 83/152 VM 515 VE2 LH 82/104 LH 82/183 RRIC 100 RRIC 102 GU 969 IAN 6323 LH 82/156 LH 83/161 Không đặc trưng Không đặc trưng Đặc trưng Đặc trưng Không đặc trưng Không đặc trưng Không đặc trưng Không đặc trưng Không đặc trưng Đặc trưng Đặc trưng Đặc trưng Không đặc trưng Đặc trưng Không đặc trưng Không đặc trưng Không đặc trưng Không đặc trưng Không đặc trưng Đặc trưng Đặc trưng Đặc trưng Đặc trưng Đặc trưng Đặc trưng Đặc trưng Đặc trưng Đặc trưng Đặc trưng Đặc trưng Đặc trưng Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương An Lộc, Đồng Nai An Lộc, Đồng Nai An Lộc, Đồng Nai An Lộc, Đồng Nai An Lộc, Đồng Nai An Lộc, Đồng Nai An Lộc, Đồng Nai An Lộc, Đồng Nai An Lộc, Đồng Nai An Lộc, Đồng Nai An Lộc, Đồng Nai An Lộc, Đồng Nai Trong quá trình thu thập mẫu trên đồng ruộng, chúng tôi nhận thấy bệnh Corynespora có biểu hiện triệu chứng rất khác nhau, thay đổi tùy theo tính mẫn cảm 36 của dvt đối với nấm bệnh. Ngoài triệu chứng điển hình (hình 4.1), bệnh còn biểu hiện ở những vết bệnh tròn, tâm đen có quầng màu vàng bao quanh (hình 4.2), triệu chứng này có thể gây nhầm lẫn giữa bệnh rụng lá Corynespora với bệnh héo đen đầu lá do nấm Colletotrichum gloeosporioidies gây ra trên lá trưởng thành nhưng không u lồi mà trơn láng khi dùng tay vuốt nhẹ (hình 4.3). Hình 4.1: Triệu chứng đặc trƣng của bệnh rụng lá Corynespora – vết bệnh hình xƣơng cá (fish bone). Nguồn: Bộ môn BVTV/VNCCSVN. Hình 4.2: Triệu chứng biến thiên của bệnh rụng lá Corynespora. Dấu mũi tên chỉ vị trí vết bệnh. Vết bệnh phóng lớn (góc trái). 37 Hình 4.3: Triệu chứng của bệnh héo đen đầu lá do Colletotrichum gloeosporioidies gây ra trên cây cao su. Nguồn: Bộ môn BVTV/VNCCSVN a) b) Hình 4.4: Bào tử của nấm C. cassiicola dạng đơn dƣới kính hiển vi quang học (a, b) và bào tử nấm Colletotrichum gloeosporioidies (c). Nguồn: Bộ môn BVTV/VNCCSVN 38 Sau khi phân lập, các mẫu nấm được kiểm tra lại bằng cách làm tiêu bản và quan sát bào tử dưới kính hiển vi, kết quả cho thấy, có 7 mẫu lá phân lập được nấm C. cassiicola, phần lớn các mẫu nấm là nấm Colletotrichum gloeosporioidies, phân biệt rất dễ dàng bằng bào tử (hình 4.4) Qua tiến trình phân lập chúng tôi thu nhận được 7 mẫu nấm C. cassiicola từ 7 dòng vô tính cao su khác nhau, đại diện cho các biểu hiện triệu chứng và địa điểm khác nhau (bảng 4.2). Bảng 4.2: Một số dòng vô tính cao su phân lập đƣợc nấm C. cassiicola Số thứ tự Dòng vô tính phân lập được C. cassiicola Đặc điểm triệu chứng Địa điểm lấy mẫu 1 2 3 4 5 6 7 RRIV 2 RRIV4 AC 88 RO/CM/10 MT/C/5 LH 82/008 LH 83/152 Không đặc trưng Không đặc trưng Đặc trưng Đặc trưng Đặc trưng Đặc trưng Đặc trưng Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương Lai Khê, Bình Dương An Lộc, Đồng Nai An Lộc, Đồng Nai Để dễ dàng trong việc phân tích, mẫu nấm được phân lập từ dòng vô tính cao su nào sẽ được gọi tên theo dòng vô tính cao su đó. Đặc điểm chung của các mẫu nấm phân lập từ các dvt cao su khác nhau là khuẩn lạc có màu xám, sợi nấm mọc thành những đường tròn đồng tâm. Khuẩn lạc mọc dầy và tụ lại. Khi quan sát bằng cách lật ngược đĩa petri có thể nhận thấy những đường tròn đồng tâm, nấm nuôi cấy lâu ngày sẽ tạo sắc tố màu đen. Ở điều kiện nuôi cấy bình thường, nấm C. cassiicola rất khó hình thành bào tử. Hình 4.5: Khuẩn lạc nấm C. cassiicola trên môi trƣờng PDA. 39 4.2. Kết quả ly trích DNA từ các mẫu nấm Các mẫu nấm được xác định là nấm C. cassiicola được chuyển sang nuôi cấy trên môi trường potato dextrose broth (môi trường PDA không có agar), thu sinh khối sợi nấm và tiến hành ly trích DNA. Từ hình 4.5 cho thấy, các nguồn nấm đều cho kết quả ly trích DNA rất tốt. Ngoài DNA tổng số còn có phần tạp (là RNA) có thể loại bỏ phần tạp này bằng cách sử dụng enzyme RNase. Tuy nhiên, nguồn DNA này sau đó có thể sử dụng làm DNA khuôn mẫu để thực hiện phản ứng PCR mà không cần phải tiến hành tinh sạch. Hình 4.6: Kết quả ly trích DNA nấm C. cassiicola từ các nguồn khác nhau. 4.3. Kết quả PCR vùng ITS của nấm C. cassiicola Những trình tự DNA mã hóa cho rRNA đã được sử dụng rộng rãi trong nghiên cứu mối quan hệ về mặt phân loại và biến dị di truyền của các loài nấm. Những nhóm gen mã hóa cho rRNA được tìm thấy ở cả nhân và ti thể, bao gồm những vùng bảo tồn và có khả năng biến dị, vùng này gồm những gen mã hóa cho tiểu đơn vị nhỏ rRNA 5,8S và tiểu đơn vị lớn của rRNA (Bridge P.D. và Arora. D.K., 2000). Vùng nằm giữa các tiểu đơn vị gọi là vùng internal transcribed spacers (ITS) và vùng nằm giữa các nhóm gen gọi là intergenic spacers (IGS), hai vùng này có khả năng biến dị nhiều hơn là những trình tự mã hóa cho các tiểu đơn vị rRNA và được sử dụng rộng rãi hơn trong những nghiên cứu về mối quan hệ giữa các loài trong cùng một giống (Bridge P.D. và Arora. D.K., 2000). Vùng ITS bao gồm hai vùng có khả năng biến dị nhưng không có chức năng mã hóa, là những vùng trong các rDNA lặp lại, giữa tiểu đơn vị có tính bảo tồn cao (tiểu DNA tổng số Phần tạp 40 540 bp sản phẩm PCR 1000 bp 500 bp 100 bp Sản phẩm phụ của phản ứng PCR đơn vị 5,8S) và các gen mã hóa cho tiểu đơn vị lớn rRNA. Vùng ITS rất hữu ích cho những nghiên cứu về đặc điểm phân tử của nấm (Bridge P.D. và Arora. D.K., 2000). Cặp primer ITS A và ITS B được thiết kế dựa trên vùng bảo tồn của sinh vật eukaryote có khả năng khuếch đại vùng DNA có khả năng biến đổi nằm giữa đầu 3’ của rDNA 18S và đầu 5’ của rDNA 28S, vùng này bao gồm cả gen rDNA 5,8S được nằm chồng qua bởi hai vùng ITS (ITS 1 và ITS 2) (Silva và cộng sự, 1998). Những primer này khuếch đại hữu hiệu một đoạn DNA duy nhất từ DNA hệ gen của nấm. Kích thước của đoạn DNA khuếch đại được là 540 bp (hình 4.7). Hình 4.7: Kết quả điện di sản phẩm PCR một số mẫu nấm C. cassiicola. Ghi chú: L1: DNA ladder L2: MT/C/5. L3: RRIV 2 L4: RRIV4 L5: AC 88 L6: LH 83/152 Phản ứng PCR được thực hiện theo quy trình của Silva và các cộng sự (1998). Hình 4.7 cho thấy, sử dụng quy trình trên đã cho phép khuếch đại được vùng ITS mong muốn. Tuy nhiên, kết quả điện di trên gel agarose cũng cho thấy ngoài sản phẩm chính còn có các sản phẩm phụ không mong muốn. Sản phẩm PCR có sản phẩm phụ có thể là do một số nguyên nhân như primer quá nhiều, thời gian của bước kéo dài kéo dài hơn mức cần thiết, lượng DNA khuôn mẫu sử dụng nhiều cũng làm xuất hiện sản 41 phẩm phụ, và phản ứng có quá nhiều chu kỳ. Trong điều kiện cho phép chúng tôi đã thay đổi lượng primer sử dụng và đã thu nhận được sản phẩm PCR đặc hiệu hơn như hình 4.8. Tuy nhiên, ngoài yếu tố primer chúng tôi cũng đã kiểm tra các yếu tố khác có ảnh hưởng như thế nào đến sự khuếch đại một đoạn DNA trong vùng ITS của nấm C. cassiicola. Kết quả cho thấy các yếu tố khác không tạo ra sự ảnh hưởng đáng kể nào lên sản phẩm PCR tạo thành và chúng tôi không đưa ra thảo luận ở đây. Hình 4.8: Sản phẩm PCR thu nhận đƣợc sau khi giảm lƣợng primer dùng trong phản ứng PCR. L1: MT/C/5. L2: RRIV 2 L3: RRIV4 L4: AC 88 L5: LH 83/152 L6: LH 82/008 L7: LH 83/152. Sản phẩm PCR của 7 mẫu phân lập được kiểm tra kích thước và so sánh với các đối chứng dương khác (sử dụng quy trình tương tự để khuếch đại vùng ITS của nấm Beauveria bassiana và Metarhizum anisopliae) (hình 4.9). Qua hình 4.9, chúng tôi nhận thấy, phản ứng PCR với cặp primer ITS A và ITS B cũng có khả năng khuếch đại được vùng ITS của nấm Beauveria bassiana và Metarhizum anisopliae. Điều này là hợp lý vì cặp primer này được thiết kế cho vùng bảo tồn ITS, và hầu hết các nấm đều có vùng này. Theo chúng tôi, nếu sử dụng kỹ thuật này để chẩn đoán bệnh rụng lá Corynespora do nấm C. cassiicola gây ra dựa trên sản phẩm khuếch đại của vùng ITS 1, ITS 2 bằng cặp primer ITS A và ITS B là không hiệu quả, vì sản phẩm PCR thu được có kích 42 thước giống nhau (540 bp) ở các loài nấm khác, điều này không cho phép nhận dạng nấm C. cassiicola dựa trên sản phẩm khuếch đại của vùng ITS1, ITS2. Hình 4.9: Kiểm tra kích thƣớc sản phẩm PCR của nấm C. cassiicola và so sánh với sản phẩm PCR của nấm Beauveria bassiana và Metarhizum anisopliae . L1: DNA ladder L2: MT/C/5 L3: RRIV2 L4: RRIV4 L5: AC 88 L6: RO/CM/10 L7: LH 82/152 L8: LH 82/008 L9: Beauveria bassiana L10: Metarhizum anisopliae L11: Đối chứng âm Ghi chú: Hai nguồn nấm Beauveria bassiana và Metarhizum anisopliae do Bộ môn BVTV – Khoa Nông Học, Đại học Nông Lâm TP.HCM cung cấp. Kết quả này cũng cho thấy cần phải tìm ra một vị trí khác trên DNA hệ gen đặc trưng hơn cho C. cassiicola, để việc chẩn đoán bệnh do C. cassiicola gây ra nhanh chóng và chính xác hơn. Việc nghiên cứu về gen mã hóa cho protein độc tố cassiicoline có thể giúp giải quyết được vấn đề này. Đây có thể là hướng đi sẽ được nhiều phòng thí nghiệm lựa chọn trong tương lai. 4.4 Phân tích đa dạng vùng ITS của nấm C. cassiicola RFLP là một kỹ thuật mới được ứng dụng rộng rãi trong phân tích đa dạng di truyền. Trong kỹ thuật này chủ yếu ứng dụng các enzyme cắt giới hạn nhằm phân cắt một đoạn DNA hoặc cả hệ gen của một sinh vật nào đó. Nếu hai sinh vật có sự giống nhau về mặt di truyền khi phân cắt bằng RE sẽ tạo thành những đoạn DNA có kích thước giống nhau, số đoạn DNA tạo thành cũng giống nhau. Phương pháp RFLP 500 bp 540 bp 43 nguyên bản đòi hỏi phải trải qua giai đoạn Southern blot. Do vậy, trong phân tích đa dạng di truyền của các loài nấm, đặc biệt là phân tích đa dạng di truyền trong cùng loài, phương pháp RFLP – PCR được ứng dụng phổ biến hơn. Kỹ thuật này có nghĩa là sử dụng các RE để phân cắt sản phẩm PCR một đoạn gen hay một đoạn DNA nào đó, không trải qua giai đoạn southern blot. Sau khi phân cắt bằng các RE, sản phẩm sẽ được phân tích bằng cách điện di trên gel để xem xét có hay không có sự đa hình kích thước của các đoạn DNA tạo thành. Kỹ thuật này đơn giản hơn kỹ thuật RFLP thông thường. Hiện nay, RFLP – PCR được ứng dụng nhiều trong phân loại, nhất là phân loại ở mức độ dưới loài (đã ứng dụng thành công đối với nấm Verticilium, Rhizoctonia và Fusarium) (Bridge P.D. và Arora. D.K., 2000). Do sản phẩm PCR tương đối đặc hiệu nên được sử dụng trực tiếp vào phân tích RFLP mà không cần phải tinh sạch. Sản phẩm PCR của nấm C. cassiicola được phân cắt riêng rẽ bằng các enzyme cắt giới hạn CfoI, EcoRI, MspI, HaeIII, RsaI, Sau3AI. Sản phẩm tạo thành được phân tích bằng cách điện di trên gel agarose. Chúng tôi nhận thấy mỗi enzyme đều tạo ra các sản phẩm giống nhau ở tất cả các mẫu khảo sát (hình 4.10, hình 4.11, hình 4.12, hình 4.13, hình 4.14, hình 4.15). Hình 4.10: Phân cắt sản phẩm PCR bằng enzyme EcoRI. L1: DNA ladder L5: AC 88 L2: MT/C/5 L6: RO/CM/10 L3: RRIV2 L7: LH 82/152 L4: RRIV4 L8: LH 82/008 300 bp 200 bp 44 Hình 4.11: Phân cắt sản phẩm PCR bằng enzyme MspI. Ghi chú: L1: DNA ladder L2: MT/C/5 L3: RRIV2 L4: RRIV4 L5: AC 88 L6: RO/CM/10 L7: LH 82/152 L8: LH 82/008 Hình 4.12: Phân cắt sản phẩm PCR bởi enzyme CfoI. Ghi chú L1: DNA ladder L2: MT/C/5 L3: RRIV2 L4: RRIV4 L5: AC 88 L6: RO/CM/10 L7: LH 82/152 L8: LH 82/008 300 bp 100 bp Sản phẩm PCR cắt không hoàn toàn 400 bp 100 bp 45 Hình 4.13: Phân cắt sản phẩm PCR bằng enzyme RsaI. Ghi chú: L1: DNA ladder L2: MT/C/5 L3: RRIV2 L4: RRIV4 L5: AC 88 L6: RO/CM/10 L7: LH 82/152 L8: LH 82/008 L9: sản phẩm PCR trƣớc khi cắt. Hình 4.14: Phân cắt sản phẩm PCR bằng enzyme HaeIII. L1: DNA ladder L2: MT/C/5 L3: RRIV2 L4: RRIV4 L5: AC 88 L6: RO/CM/10 L7: LH 82/152 L8: LH 82/008 400 bp 100 bp 400 bp 100 bp Hình 4.15: Phân cắt sản phẩm PCR bằng enzyme Sau3AI. Ghi chú: L1: DNA ladder L2: MT/C/5 L3: RRIV2 L4: RRIV4 L5: AC 88 L6: RO/CM/10 L7: LH 82/152 L8: LH 82/008 L9: Sản phẩm PCR khi chƣa cắt 300 bp 100 bp Kết quả nghiên cứu cho thấy, khi cắt bằng enzyme EcoRI, chúng tôi thu được hai đoạn DNA có kích thước khoảng 240 bp và 300 bp. Sự phân cắt bằng enzyme HaeIII tạo thành hai đoạn DNA có kích thước khoảng 390 bp và 160 bp. Những kết quả này phù hợp với những nghiên cứu trước đây của Silva và cộng sự (1998), Safiah và cộng sự (2003). Sự phân cắt bằng RE khi điện di trên gel agarose cho phép ước lượng kích thước của những đoạn DNA tạo thành dựa vào thang DNA chuẩn. Tuy nhiên, chúng tôi không thể so sánh những kết quả mà chúng tôi thu nhận được khi cắt sản phẩm PCR bằng những enzyme khác với những kết quả nghiên cứu trước đây trên thế giới do không có số liệu và những nghiên cứu ở mức độ phân tử của nấm C. cassiicola hiện nay chưa nhiều. Trong thí nghiệm của chúng tôi, hầu hết các RE được sử dụng chỉ tìm thấy một vị trí cắt ngoại trừ enzyme CfoI có thể có đến 3 vị trí cắt khác nhau. Kết quả điện di cho thấy, khi cắt bằng CfoI chỉ thu nhận được 2 đoạn DNA, một đoạn có kích thước khoảng 300 bp, một đoạn có kích thước khoảng 100 bp. Điều đó có nghĩa là ngoài 2 đoạn DNA đó còn có những đoạn DNA khác không thể quan sát được, có thể do nguyên nhân sau: lượng DNA quá ít, nhuộm bằng ethidium bromide không cho phép nhận biết sự có mặt của đoạn DNA này. Ngoài enzyme CfoI, khi phân cắt bằng enzyme Sau3AI, các đoạn DNA vừa tạo thành có tổng kích thước không bằng kích thước của sản phẩm PCR, điều này được giải thích tương tự như trường hợp xảy ra với enzyme CfoI. Mặc dù các mẫu phân tích có biểu hiện triệu chứng khác nhau trên lá cao su, nhưng khi phân tích đa hình vùng ITS bằng các enzyme cắt giới hạn không nhận thấy bất cứ sự khác biệt nào ở vị trí cắt của các enzyme đã sử dụng. Các mẫu thu nhận ở 2 khu vực khác nhau cũng cho kết quả giống nhau khi phân cắt bằng các enzyme cắt giới hạn. Tuy nhiên, số lượng mẫu phân tích còn ít nên chưa thể đánh giá có hay không có sự đa dạng di truyền trong quần thể nấm C. cassiicola trên các dvt cao su ở Việt Nam. Mặt khác, có thể những mẫu trên có thể có sự khác biệt trong trình tự nucleotide, nhưng những khác biệt này không xảy ra ngay vị trí cắt của các enzyme cắt, phân tích bằng các enzyme cắt không phát hiện được sự sai khác. Kết quả phân tích vùng ITS bằng 6 RE đều không phát hiện bất cứ sự khác biệt nào. Các mẫu nấm mà chúng tôi phân tích có thể cùng thuộc một chủng nấm C. cassiicola và đây có thể là chủng nấm C. cassiicola duy nhất gây bệnh trên cây cao su ở Việt Nam hiện nay. Tuy nhiên, để có thể đi đến những kết luận chính xác hơn cần phải nghiên cứu trên số lượng lớn các mẫu nấm C. cassiicola. PHẦN V KẾT LUẬN VÀ ĐỀ NGHỊ 5.1. Kết luận Bệnh rụng lá Corynespora trên cây cao su hiện nay có biểu hiện triệu chứng bệnh rất khác nhau, mức độ bệnh tùy theo tính mẫn cảm của từng dvt cao su khác nhau. Việc này làm cho việc kiểm soát tình hình bệnh trở nên khó khăn. Việc nghiên cứu về tác nhân gây bệnh C. cassiicola phần nào giúp cho chiến lược quản lý tình hình bệnh trở nên dễ dàng hơn. Qua nghiên cứu về một số mẫu bệnh do tác nhân C. cassiicola gây ra chúng tôi đưa ra một số kết luận như sau. Quy trình thực hiện phản ứng PCR nhằm khuếch đại vùng ITS của nấm C. cassiicola đã được ứng dụng ở nhiều phòng thí nghiệm trên thế giới có thể được sử dụng để nghiên cứu nấm C. cassiicola ở Việt Nam. Việc ứng dụng kỹ thuật PCR để chẩn đoán bệnh rụng lá Corynespora trên cây cao su với cặp primer ITS A và ITS B là không hiệu quả do kích thước của đoạn DNA khuếch đại được không đặc hiệu so với các nấm khác. Phân tích sản phẩm khuếch đại vùng ITS của các mẫu nấm trên các dvt cao su khác nhau, có triệu chứng bệnh khác nhau bằng các enzyme cắt giới hạn không nhận thấy bất cứ sự khác biệt nào ở kích thước của đoạn DNA tạo thành. Các mẫu nấm là giống nhau khi phân tích RFLP sản phẩm PCR vùng ITS. Các mẫu nấm nghiên cứu có thể cùng thuộc một chủng và đây có thể là chủng C. cassiicola duy nhất gây bệnh cho cây cao su ở Việt Nam hiện nay. 5.2. Đề nghị Những dvt cao su mới lai tạo ở Việt Nam biểu hiện mức độ bệnh rất khác nhau (Nguyễn Ngọc Mai, 2005). Những nghiên cứu khác trên thế giới cho thấy giữa các dòng nấm C. cassiicola trên cây cao su có sự phân hóa di truyền (Safia và cộng sự, 2003 ). Do vậy, chúng tôi đưa ra một số đề xuất sau. Tăng số lượng mẫu kiểm tra để kết quả phân tích mang tính khái quát hơn. Cần có những nghiên cứu cụ thể hơn về đặc điểm sinh trưởng, phát triển cũng như tính độc của nấm C. cassiicola trên cây cao su kết hợp với ứng dụng kỹ thuật RAPD – PCR để nghiên cứu sự đa dạng di truyền của nấm C. cassiicola trên cây cao su ở Việt Nam, đồng thời xác định mối quan hệ giữa tính kháng của các dvt cao su lai tạo trong nước với những khác biệt về di truyền của nấm C. cassiicola. Điều này sẽ có lợi cho công tác tạo giống kháng và công tác quản lý bệnh. Tiến tới giải trình tự vùng ITS để xác định mức độ biến dị trong vùng ITS của nấm C. cassiicola Việt Nam so với các dòng nấm C. cassiicola khác đã giải trình tự trên thế giới, xác định vị trí phân loại C. cassiicola Việt Nam trong cây phân loại nấm C. cassiicola. Để hướng tới tạo giống cao su kháng bệnh rụng lá Corynespora cần nghiên cứu đa hình gen kháng C. cassiicola trên cây cao su, việc này giúp chọn nhanh dvt có khả năng kháng C. cassiicola và cũng là cơ sở để thực hiện lai tạo những dvt mới có khả năng kháng bệnh. PHẦN VI TÀI LIỆU THAM KHẢO Tài liệu Tiếng Việt 1. Bùi Chí Bửu – Nguyễn Thị Lang, 1999. Di truyền phân tử. Quyển II, Những nguyên tắc cơ bản trong chọn giống cây trồng. NXB Nông nghiệp. 45-60. 2. Cục Bảo Vệ Thực Vật. 2000. Báo cáo đề tài: Điều tra phân bố và mức độ phổ biến của nấm Corynespora cassiicola (Berk. & Curt.) Wei trên cây cao su và một số cây trồng khác ở một số vùng trọng điểm miền Bắc Việt Nam. 3. Phan Thành Dũng, 2004. Kỹ thuật bảo vệ thực vật cây cao su. Nhà xuất bản Nông Nghiệp.124 trang. 4. Hồ Huỳnh Thùy Dương. 2000. Sinh học phân tử. Nhà xuất bản Đại Học Quốc Gia. 5. Trần Văn Lợt. Giáo trình cây công nghiệp. Học phần Cây Cao Su. Tài liệu học tập, Đại Học Nông Lâm Thành Phố Hồ Chí Minh 2005. 70 trang. 6. Nguyễn Ngọc Mai. Điều tra và đánh giá tính kháng bệnh rụng lá Corynespora trên một số dvt cao su lai tạo trong nước. LVTN Đại Học Nông Lâm Thành Phố Hồ Chí Minh. 2005. 7. Tổng Công Ty Cao Su Việt Nam. 2004. Báo cáo tổng kết hoạt động kinh doanh năm 2003. 8. Đặng Văn Vinh. 2000. Một trăm năm cao su ở Việt Nam. Nhà xuất bản Nông Nghiệp TP. HCM. 11-38. Tài liệu tiếng nƣớc ngoài 9. Begho, E.R.,2000. The status of Corynespora leaf spot disease of Para Rubber in Nigeria: Preliminary investigations. Presented at workshop on Corynespora leaf fall disease of Hevea brassiliensis, Kuala Lumpur, Malaysia and Medan, Indonesia, 6 – 15, June, 2000. 10. Bridge, P. D., Arora D.K., Reddy C.A. and Elander R.P., 1998. Application of PCR in mycology. CABI publishing. UK. 1 - 21. 11. Brown, T.A.,1997. Chapter 4: Manipulation of purified DNA. Gene cloning - an introduction. Third edition. Published by Chapman and Hall. London, UK. 12. Chee, K.H., 1987. Corynespora leaf spot. Rubber Research Institute of Malaysia. Planters’ Bulletin, No 194: 3 – 7. 13. Desmond S.T, Nicholl, 1994. An introduction to genetic engineering. Cambridge University Press. 166p. 14. Dũng, P.T and Hoan, N.T., 2000. Current status of corynespora leaf fall in Vietnam. Presented at workshop on Corynespora leaf fall disease of Hevea brassiliensis, Kuala Lumpur, Malaysia and Medan, Indonesia, 6 – 15, June, 2000. 15. Dũng, P.T., 1995. Studies on C. cassiicola (Berk. & Curt.) Wei on rubber. Masters’ thesis. University Pertanian Malaysia. 16. Ellis, M.B and Holiday, 1971. Corynespora cassiicola. C.M.I Description of Pathogenic Fungi and Bacteria. No. 303. 1-2. 17. Ismail, H., N.Z. Radzia and K. Silvadadyan, 1996. Management stragies of Corynespora leaf fall with fungicides and cultural practices. Presented at workshop on Corynespora leaf fall disease of Hevea brassiliensis, Medan, Indonesia 16 – 17, Dec, 1996. 18. Jayashinge, C.K. and W.P.K, Silva and Wettasinghe D. S., 2000. Corynespora cassiicola: a fungal pathogen with diverse symptoms on Hevea rubber. Bulletin of the Rubber Research Institute of Sri Lanka. 39, 1-5. 19. Jayashinge, C.K. and W.P.K, Silva.1996. Current status of Corynespora leaf fall in Sri Lanka. Presented at workshop on Corynespora leaf fall disease of Hevea brassiliensis, Medan, Indonesia 16 – 17, Dec, 1996. 20. Jayashinge, C.K..2000. Current status of Corynespora leaf fall in Sri Lanka. Presented at workshop on Corynespora leaf fall disease of Hevea brassiliensis, Kuala Lumpur, Malaysia and Medan, Indonesia, 6 – 15, June, 2000. 21. Jayasinghe, C.K., 1997. Leaf fall disease: a threat to world NR industry. Rubber Asia. 55 - 56. 22. Kurt Weising, Hilde Nybom, Kirsten Wolff, Wieland Meyer, 1995. DNA fingerprinting in plants and fungi. CRC Press. 322p. 23. Liyanage, AdeS, Jayasinghe, C.K., Liyanage, N.S.I and Jayaratne, R., 1986. Corynespora leaf spot disease of (Hevea brasiliensis): a new record. Journal of rubber research institute of Sri Lanka. 65. 47 - 50. 24. McPherson M.J., Moller S.G., 2001. PCR. BIOS Scientific Publisher Limited, UK. 276p. 25. Narisa Chanruang, 2000. Current status of Corynespora leaf fall in Thailand. Presented at workshop on Corynespora leaf fall disease of Hevea brassiliensis, Kuala Lumpur, Malaysia and Medan, Indonesia, 6 – 15, June, 2000. 26. Sabu, P.I., 2000. Current status of Corynespora leaf fall in India. Presented at workshop on Corynespora leaf fall disease of Hevea brassiliensis, Kuala Lumpur, Malaysia and Medan, Indonesia, 6 – 15, June, 2000. 27. Safiah A. and Noor H.H., 2003. Differentiating races of C. cassiicola using RAPD and ITS markers. Journal of Rubber Research. 6(1). 59 – 64. 28. Shukhor S.K. and Hidir S.M., 1996. Current status of Corynespora leaf fall in Malaysia. Presented at workshop on Corynespora leaf fall disease of Hevea brassiliensis, Medan, Indonesia 16 – 17, Dec, 1996. 29. Silva, W.P.K, Deverall, B.J & Lyon, B.R., 1995. RFLP and RAPD analyses in the identification and differentiation of isolates of the leaf spot fungus C. cassiicola. Aust. J. Bot., 43, 609 – 618. 30. Silva, W.P.K, Deverall, B.J & Lyon, B.R., 1998. Molecular, physiological and pathological characterization of Corynespora leaf spot fungi from rubber plantations in Sri Lanka. Plant pathology, 47 (3), 267-277. 31. Silva, W.P.K, Eric H. Karunanayake, Ravi L.C. Wijesundera and Uhanowita M.S. Priyanka., 2003. Genetic variation in Corynespora cassiicola: a possible relation between host and virulence. Mycol Res. 2003 May;107(Pt 5):567-71. 32. Sinulinga W., Suwanto and Soepena H., 1996. Current status of Corynespora leaf fall in Indonesia. Presented at workshop on Corynespora leaf fall disease of Hevea brassiliensis, Medan, Indonesia 16 – 17, Dec, 1996. 33. Sujanto and Irwan Suhendry., 2000. Corynespora leaf fall disease on Hevea rubber in Indonesia.Presented at workshop on Corynespora leaf fall disease of Hevea brassiliensis, Kuala Lumpur, Malaysia and Medan, Indonesia, 6 – 15, June, 2000. 34. Tan A.M, Loo T.P, Gangadara Vadivel, Mohd Rosli Bachik and K.F. Yoon, 1992. Survey of Corynespora leaf disease of rubber in Peninsular Malaysia. Planters' Bulletin Rubber Research of Malaysia. No 211. 51- 62. 35. Tan A.M. 1990. Survey on Corynespora leaf fall disease. Planters’ Bulletin Rubber Research of Malaysia. No.194. 55 – 60. 36. The International Natural Rubber Organization, 1999. Improvement of management strategy in combating Corynespora leaf fall disease (CLFD) in Hevea brasiliensis. 50 Tài liệu internet 37. 38. Conserved primer sequences for PCR amplification and sequencing from nuclear ribosomal RNA 39. Database: Corynespora cassiicola. 40. st_uids=12884953&dopt=Abstract Genetic variation in Corynespora cassiicola: a possible relation between host and virulence 41. Annual report 42. 5,8S Primer Map. 43. Primer Map. PHỤ LỤC CÁCH THỨC PHA MỘT SỐ HÓA CHẤT CẦN THIẾT 1. Pha lysis buffer Lysis buffer có các thành phần cụ thể như sau: Tris HCl 50mM, EDTA 50mM, SDS 3%, - mercaptoethanol 1%. - Cho vào becher một thể tích nước siêu sạch gần bằng với thể tích dung dich buffer mong muốn. - Lần lượt cho các thành phần khác: Tris HCl, EDTA và SDS vào dung dịch với một lượng sao cho đảm bảo nồng độ cuối cùng như mong muốn. - Khuấy đều cho hỗn hợp hòa tan, sau đó cho - mercaptoethanol vào. - Khuấy đều và chuẩn độ cho dung dịch lysis buffer đạt pH 8. Nếu sau khi chuẩn độ thể tích cuối cùng chưa đạt như mong muốn cần thêm nước siêu sạch vào cho đạt thể tích mong muốn. 2. Pha Phenol - Hòa tan 100g phenol (tinh thể) đặt trong bồn ủ nhiệt ở 650C (phải bịt kín dụng cụ đựng phenol khi hòa tan). - Sau khi phenol đã tan hoàn toàn, thêm vào 100ml dung dịch Tris bazơ 0.5 M, pH8. - Khuấy từ 10 phút, để yên ở nhiệt độ phòng cho đến khi hỗn hợp tách thành hai pha, hút bỏ phần dung dịch bên trên một cách cẩn thận. Lưu ý các thao tác này nên thực hiện ở trong tủ hood và phải luôn giữ phenol trong tối để tránh oxy hóa và nguy hiểm đến sức khỏe. - Tiếp tục cho vào 100ml dung dịch Tris HCl 0.5 M, pH 8. - Khuấy từ 10 phút, để yên ở nhiệt độ phòng cho đến khi dung dịch tách làm hai pha, hút bỏ phần dung dịch bên trên. - Lập lại chu kỳ này một lần nữa. Sau đó phủ lên trên dung dịch phenol thu được một lớp TE 1X (50ml). -Lưu ý là phải bảo quản dung dịch phenol trong tối (dùng bình đựng có màu tối hoặc bịt kín bình bằng giấy bạc). 3. Pha dung dịch TE 1X Thành phần gồm: 10mM Tris HCl, 1mM EDTA, pH8 Trước hết pha dung dịch Tris HCl stock, pH8. Cho dung dịch Tris HCl và EDTA vào nước tinh sạch. Khuấy đều và chuẩn độ pH đến 8.

Các file đính kèm theo tài liệu này:

  • pdfKHOA LUAN-VU THI QUYNH CHI.pdf
Luận văn liên quan