Phát hiện một số gen độc lực của escherichia coli trên thịt bò, heo và trong phân bò, heo bằng kỹ thuật

E. coli là một trong những vi khuẩn thường trực trong đường ruột người và động vật. Người ta chia E. coli thành nhiều nhóm. Nhóm STEC (Shiga toxin producing E. coli) mang nhiều gen độc lực như gen eae chịu trách nhiệm sản sinh intimin giúp vi khuẩn bám dính vào niêm mạc ruột và gây hư hại vi nhung mao ruột; gen hly sản sinh độc tố gây dung giải hồng cầu; gen stx1, stx2 sản sinh các độc tố Shiga gây hội chứng viêm kết tràng xuất huyết (HC = hemorrhagic colitis) và hội chứng huyết niệu (HUS = hemolytic uremic syndrome) ở người; gen stx2e sản sinh độc tố vero gây bệnh phù thũng và tiêu chảy ở heo cai sữa. Trong khi đó nhóm ETEC (Enterotoxigenic E. coli) mang gen lt-I sản sinh độc tố ruột kém chịu nhiệt (heat labile toxin = LT) và gen st sản sinh độc tố ruột chịu nhiệt (heat stable toxin = ST), đó là hai loại độc tố gây tiêu chảy trên người và vật nuôi. Nhóm EPEC (Enteropathogenic E. coli) mang gen eae sản sinh protein intimin. Mục tiêu của bài báo là xác định tần số các gen độc lực của E. coli trên thịt bò và heo, trong phân bò và heo để nâng cao hiểu biết về E. coli gây bệnh cho vật nuôi và gây ngộ độc thực phẩm cho người tiêu dùng.

pdf7 trang | Chia sẻ: lvcdongnoi | Ngày: 05/06/2013 | Lượt xem: 1854 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Phát hiện một số gen độc lực của escherichia coli trên thịt bò, heo và trong phân bò, heo bằng kỹ thuật, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
NGHIEÂN CÖÙU KHOA HOÏC KYÕ THUAÄT Ñaïi hoïc Noâng Laâm Tp. HCM Taïp chí KHKT Noâng Laâm nghieäp, soá 3/2007 53 ABSTRACT On 20 samples of feces from clinically healthy cattle (10 animals) and pigs (10); 8 samples of beef meat and 23 pork to determine total Escherichia coli (E. coli) according to FAO (1992) and to detect their virulence genes. On 161 samples include 32 samples of feces taken from scour calves (10 animals), scour piglets (6), scour weaner pigs (16); 46 samples of feces from clinically healthy cattle (21 animals), pigs (25), and 34 samples of beef meat and 49 pork meat to isolate E. coli and detect their virulence genes. E. coli was isolated on MAC/CT- SMAC (Mac Conkey/Cefixime tellurite sorbitol-MAC) agar at 370C for 24 hours. For each sample, 4-10 typical colonies of E. coli were collected for extraction of DNA by heat. Multiplex-PCR was used to detect gene eae, hly, stx1 and stx2 (PCR1), and gene stx2e, sta, stb, lt-I (PCR2) of isolated E. coli. Total E. coli on cattle feces were lower than pig (9.5*106 vs 102*106 MPN/1gam), in beef meat was higher than pork (14.8*104 vs 0.4*104 MPN/ 1gam). The prevalence of the virulence genes in E. coli isolates from animal species and feces conditions was determined. In scour calves the frequency of E. coli isolates possessing stx1, hly, eae, stx2 and stb was 40%, 30%, 30%, 20% and 20%, respectively. With scour weaner pigs the prevalence of gene stb, stx2, stx2e, sta, eae and hly in E. coli isolates was 81.3%, 50%, 31.3%, 25%, 12.5% and 6.3%, respectively. In clinically healthy cattle E. coli isolates carrying gene stx2, stx1, hly and stb were 42.9%, 38.1%, 19% and 14.3%. For clinically healthy pig, the detected genes were stb, stx2e, hly, eae and stx2 at the rate of 28%, 16%, 8%, 8% and 4%. On beef meat, E. coli isolates carrying gene stx1, stx2, eae, hly and stb were 50%, 32.4% , 23.5% , 26.5% and 2.9%, respectively. On pork meat, the detected genes were stx2, eae, hly at the rate of 22.5%, 4.1% and 4.1%. In general, E. coli possessing virulence gene was present in healthy cattle and swine feces, in feces of scour calves and pigglets, also on beef and pork meat, specially E. coli had the genes Shiga toxin producing (stx1, stx2 and stx2e). The risk of E. coli with virulence genes to public health should PHAÙT HIEÄN MOÄT SOÁ GEN ÑOÄC LÖÏC CUÛA ESCHERICHIA COLI TREÂN THÒT BOØ, HEO VAØ TRONG PHAÂN BOØ, HEO BAÈNG KYÕ THUAÄT MULTIPLEX-PCR DETECTING SOME VIRULENCE GENES OF ESCHERICHIA COLI IN CATTLE AND SWINE FAECES, ON BEEF AND PORK MEAT BY MULTIPLEX-PCR Traàn Thanh Phong, Nguyeãn Ngoïc Tuaân, Buøi Thò Thu Trang vaø Leâ Thò Mai Khanh Khoa Chaên nuoâi Thuù y, Ñaïi hoïc Noâng Laâm Tp. Hoà Chí Minh be raised due to its high occurence in animal feces and on beef meat. ÑAËT VAÁN ÑEÀ E. coli laø moät trong nhöõng vi khuaån thöôøng tröïc trong ñöôøng ruoät ngöôøi vaø ñoäng vaät. Ngöôøi ta chia E. coli thaønh nhieàu nhoùm. Nhoùm STEC (Shiga toxin producing E. coli) mang nhieàu gen ñoäc löïc nhö gen eae chòu traùch nhieäm saûn sinh intimin giuùp vi khuaån baùm dính vaøo nieâm maïc ruoät vaø gaây hö haïi vi nhung mao ruoät; gen hly saûn sinh ñoäc toá gaây dung giaûi hoàng caàu; gen stx1, stx2 saûn sinh caùc ñoäc toá Shiga gaây hoäi chöùng vieâm keát traøng xuaát huyeát (HC = hemorrhagic colitis) vaø hoäi chöùng huyeát nieäu (HUS = hemolytic uremic syndrome) ôû ngöôøi; gen stx2e saûn sinh ñoäc toá vero gaây beänh phuø thuõng vaø tieâu chaûy ôû heo cai söõa. Trong khi ñoù nhoùm ETEC (Enterotoxigenic E. coli) mang gen lt-I saûn sinh ñoäc toá ruoät keùm chòu nhieät (heat labile toxin = LT) vaø gen st saûn sinh ñoäc toá ruoät chòu nhieät (heat stable toxin = ST), ñoù laø hai loaïi ñoäc toá gaây tieâu chaûy treân ngöôøi vaø vaät nuoâi. Nhoùm EPEC (Enteropathogenic E. coli) mang gen eae saûn sinh protein intimin. Muïc tieâu cuûa baøi baùo laø xaùc ñònh taàn soá caùc gen ñoäc löïc cuûa E. coli treân thòt boø vaø heo, trong phaân boø vaø heo ñeå naâng cao hieåu bieát veà E. coli gaây beänh cho vaät nuoâi vaø gaây ngoä ñoäc thöïc phaåm cho ngöôøi tieâu duøng. VAÄT LIEÄU VAØ PHÖÔNG PHAÙP Laáy maãu Thòt heo vaø thòt boø ñöôïc laáy töø cô sôû gieát moå ôû cao ñieåm haï thòt baèng caùch söû duïng gaïc thaám öôùt nöôùc muoái sinh lyù 0,9% tieät truøng ñeå chaø xaùt maïnh treân beà maët thòt (200 cm2). Thu thaäp maãu phaân boø, heo töø caùc cô sôû chaên nuoâi baèng caùch duøng muoãng voâ truøng laáy phaàn giöõa cuïc phaân ñaëc (khoaûng 25 g) hoaëc taêm boâng ngoaùy vaøo tröïc traøng beâ, heo tieâu chaûy cho vaøo moâi tröôøng Carry Blair, baûo quaûn ôû 8-100C, chuyeån nhanh veà phoøng thí nghieäm. NGHIEÂN CÖÙU KHOA HOÏC KYÕ THUAÄT Taïp chí KHKT Noâng Laâm nghieäp, soá 3/2007 Ñaïi hoïc Noâng Laâm Tp. HCM 54 Ñònh löôïng vaø ñònh tính E. coli Ñònh löôïng E. coli theo qui trình cuûa FAO (1992): maãu ñöôïc pha loaõng thích hôïp vaø caáy chuyeån vaøo moâi tröôøng LTB (Lauryl tryptone broth) ôû 350C/24 giôø. Choïn nhöõng oáng döông tính chuyeån sang EC (enrichment coli) uû 44,50C/24-48 giôø vaø sau ñoù ria treân thaïch EMB, uû 370C/24 giôø. Choïn khuaån laïc ñieån hình, giöõ goác treân thaïch NA ñeå thöû IMViC. Tính toång soá E. coli baèng caùch tra baûng MPN. Song song ñoù, choïn 4-10 khuaån laïc ñieån hình cuûa E. coli ñeå ly trích DNA nhaèm phaùt hieän caùc gen ñoäc löïc töø caùc maãu ñònh löôïng. Maãu ñònh tính (phaùt hieän gen ñoäc löïc) ñöôïc caáy ria tröïc tieáp treân thaïch MAC/CT-SMAC (Mac Conkey/cefexime tellurite sorbitol-MAC), uû 370C trong 24 giôø. Khuaån laïc ñieån hình E. coli treân MAC coù maøu ñoû hoàng, troøn vaø loài, treân CT-SMAC choïn khuaån laïc hoàng laãn traéng. Ly trích DNA Moãi maãu choïn ñaïi dieän khoaûng 4-10 khuaån laïc ñieån hình E. coli cho vaøo eppendorf chöùa saün 0,5ml nöôùc caát hai laàn voâ truøng, ñun soâi 10 phuùt, tröõ ôû - 700C trong 10 phuùt. Sau khi raõ ñoâng, ly taâm 13000 voøng/ phuùt trong 3 phuùt, laáy phaàn dòch phía treân laø DNA xeùt nghieäm. Phaùt hieän caùc gen ñoäc löïc Phaùt hieän taùm gen ñoäc löïc cuûa E. coli baèng hai phaûn öùng multiplex-PCR: PCR1 phaùt hieän caùc gen stx1, stx2, eae vaø hly vôùi ñoái chöùng döông laø EDL 933; PCR2 phaùt hieän caùc gen stx2e, sta, stb, lt-I vôùi ñoái chöùng döông laø H44. PCR1 phaùt hieän caùc gen stx1, stx2, eae, hly Trình töï caùc ñoaïn moài söû duïng trong multiplex – PCR1 (Theo Paton vaø Paton, 1998) Hoãn hôïp phaûn öùng 50 µl, goàm caùc thaønh phaàn sau (Paton vaø Paton, 1998): PCR buffer 1X (75 mM tris-HCl ôû pH=8.8, 20 mM NH4(SO4)2); MgCl2 2mM; moãi loaïi dNTP 200µM; moãi ñoaïn moài 250mM; Taq 0,5UI (ABgene); DNA xeùt nghieäm 1 µl vaø nöôùc caát 2 laàn vöøa ñuû 50 µl. Phaûn öùng PCR coù 35 chu kyø nhieät. Moãi chu kyø goàm bieán tính 1 phuùt ôû 95-0C; uû baét caëp 2 phuùt ôû 650C trong 10 chu kyø ñaàu vaø sau ñoù giaûm daàn ñeán Ñoaïn moài Trình töï oligonucleotide (5’3’) Kích côõ (bp) Eae – F Eae – R GACCCGGCACAAGCATAAGC CCACCTGCAGCAACAAGAGG 384 Hly – F Hly –R GCATCATCAAGCGTACGTTCC AATGAGCCAAGCTGGTTAAGCT 534 Stx1 – F Stx1 – R ATAAATCGCCATTCGTTGACTAC AGAACGCCCACTGAGATCATC 180 Stx2 – F Stx2 – R GGCACTGTCTGAAACTGCTCC TCGCCAGTTATCTGACATTCTG 255 1 2 EDL 4 5 6 993 384 bp (eae) 180 bp (stx1) 534 bp (hly) 255 bp (stx2) Hình 1. Ñieän di saûn phaåm multiplex–PCR ñeå phaùt hieän gen eae, hly, stx1, stx2 EDL933 laø maãu ñoái chöùng döông (stx1, stx2, eae, hly) vaø 1, 2, 4, 5,6 laø caùc maãu xeùt nghieäm NGHIEÂN CÖÙU KHOA HOÏC KYÕ THUAÄT Ñaïi hoïc Noâng Laâm Tp. HCM Taïp chí KHKT Noâng Laâm nghieäp, soá 3/2007 55 600C vaøo chu kyø 16 cho ñeán chu kyø cuoái; vaø keùo duoãi 1,5 phuùt ô’ 720C vaø taêng daàn leân 2,5 phuùt töø chu kyø 25 ñeán 35. Sau khi khueách ñaïi, saûn phaåm PCR ñöôïc ñieän di treân gel agarose 1%, moãi gieáng chöùa 10 µl saûn phaåm khueách ñaïi troän vôùi 2 µl loading dye. Thôøi gian ñieän di 35 phuùt, 100 V, 250 mA. Gel ñöôïc ngaâm vôùi TBE coù 0,1% ethidium bromide trong 30 phuùt. Keát quaû ñöôïc ñoïc döôùi ñeøn UV, ethidium bromide lieân keát vôùi DNA seõ phaùt saùng vaø caùc baêng DNA ñöôïc xaùc ñònh baèng caùch so saùnh vôùi maãu ñoái chöùng döông EDL 933. PCR2 phaùt hieän caùc gen stx2e, sta, stb, lt-I (Daãn lieäu cuûa Blanco vaø ctv, 1997) Hoãn hôïp phaûn öùng 50µl goàm PCR buffer 1X (75 mM tris-HCl ôû pH=8.8, 20 mM NH4(SO4)2); MgCl2 1,5 mM; moãi loaïi dNTP 200 µM, moài Stx2e 225 ng, LT-I 150 ng, STa 150 ng, STb 45 ng, Taq – polymerase 0,5 UI (ABgene), DNA xeùt nghieäm 3 µl vaø nöôùc caát 2 laàn vöøa ñuû 50 µl. Quy trình nhieät goàm: tieàn bieán tính ôû 940C/5 phuùt, 25 chu kyø nhieät (bieán tính 940C/45 giaây, uû baét caëp 520C/45 giaây vaø keùo duoãi ôû 720C/1 phuùt), vaø keùo daøi chuoãi 720C/10 phuùt (Nguyeãn Ngoïc Haûi, 2002). Sau khi khueách ñaïi, saûn phaåm PCR ñöôïc ñieän di treân gel agarose 1%, moãi gieáng chöùa 10 µl saûn phaåm khueách ñaïi troän vôùi 2 µl loading dye. Thôøi gian ñieän di 35 phuùt, 100 V, 250 mA. Gel ñöôïc ngaâm trong TBE coù 0,1% ethidium bromide trong 30 phuùt. Keát quaû ñöôïc ñoïc döôùi ñeøn UV, ethidium bromide lieân keát vôùi DNA seõ phaùt saùng vaø caùc baêng DNA ñöôïc xaùc ñònh baèng caùch so saùnh vôùi maãu ñoái chöùng döông H44 vaø thang DNA chuaån (ladder).44 L 4 5 6 Ñoaïn moài Trình töï oligonucleotide (5’3’) Kích côõ (bp) Stx2e - F Stx2e - R CCTTAACTAAAAGGAATATA CTGGTGGTGTATGATTAATA 230 LT-I - F LT-I - R GGCGACAGATTATACCGTGC CCGAATTCTGTTATATATGTC 696 STa - F STa - R TTAATAGCACCCGGTACAAGCAGG CTTGACTCTTCAAAAGAGAAAATTAC 147 STb - F STb - R ATCGCATTTCTTCTTGCATC GGGCGCCAAAGCATGCTCC 172 1 H44 L 4 5 6 500 bp 230 bp (stx2e) 696 bp (lt-I) 172 bp (stb) Hình 2. Keát quaû ñieän di saûn phaåm PCR ñeå phaùt hieän gen stx2e, lt-I, sta vaø stb H44: ñoái chöùng döông (lt-I, stb, stx2e); Lad: thang chuaån; 1, 4, 5, 6 maãu xeùt nghieäm NGHIEÂN CÖÙU KHOA HOÏC KYÕ THUAÄT Taïp chí KHKT Noâng Laâm nghieäp, soá 3/2007 Ñaïi hoïc Noâng Laâm Tp. HCM 56 KEÁT QUAÛ VAØ THAÛO LUAÄN Toång soá vi khuaån E. coli vaø keát quaû phaùt hieän caùc gen ñoäc löïc cuûa E. coli phaân laäp ñöôïc töø phaân vaø thòt boø, heo baèng qui trình ñònh löôïng Keát quaû xaùc ñònh toång soá E. coli cuûa 10 maãu phaân boø bình thöôøng, 10 maãu phaân heo bình thöôøng, 8 maãu thòt boø vaø 23 maãu thòt heo theo qui trình ñònh löôïng ñöôïc trình baøy ôû baûng 1. Keát quaû ôû baûng 1 cho thaáy E. coli trong phaân boø töông ñoái thaáp hôn phaân heo, thòt boø cao hôn thòt heo. TCVN 7046 – 2002 qui ñònh E. coli treân 1 gam thòt töôi khoâng quaù 100 vi khuaån, nhö vaäy 8 maãu thòt boø ñeàu khoâng ñaït, 6/23 maãu thòt heo ñaït tieâu chuaån (26,1%). Toång soá E. coli trung bình treân 1 gam thòt heo töông ñoái thaáp hôn treân thòt boø maëc duø E. coli trung bình treân 1 gam phaân heo cao hôn treân phaân boø. Ñieàu naøy coù theå do söï khaùc nhau trong caùch gieát moå, vaän chuyeån vaø baøy baùn. Boø ñöôïc gieát moå thuû coâng, khoâng söû duïng nöôùc trong quaù trình haï thòt, ñöôïc pha loïc taïi loø moå vaø vaän chuyeån ñeán chôï leû baèng caùc phöông tieän thoâ sô. Trong khi gieát moå heo, quaøy thòt ñöôïc röûa saïch baèng nöôùc, vaän chuyeån ñeán chôï leû roài môùi pha loïc, ngoaøi ra ngöôøi baùn thòt cuõng thöôøng caïo saïch beà maët thòt tröôùc khi pha loïc, do ñoù thòt heo ít vaáy nhieãm hôn. Maëc duø soá löôïng E. coli trong caùc maãu phaân boø, heo raát cao, keå caû E. coli treân thòt boø, heo. Tuy nhieân trong 51 maãu E. coli phaân laäp ñöôïc töø phaân vaø thòt theo qui trình ñònh löôïng ñeàu khoâng phaùt hieän ñöôïc gen ñoäc löïc baèng kyõ thuaät multiplex - PCR. Nhieàu nghieân cöùu cho thaáy raèng ôû nhieät ñoä cao (≥ 440C) nhöõng doøng E. coli gaây beänh phaùt trieån yeáu daàn, trong khi E. coli coäng sinh (flora) phaùt trieån nhanh hôn. Hill vaø Carlisle coøn ghi nhaän raèng neáu taêng sinh trong moâi tröôøng ôû 44,50C coù theå laøm maát plasmid maõ hoùa nhöõng yeáu toá ñoäc löïc vaø laøm giaûm soá löôïng nhöõng doøng E. coli gaây beänh coù trong thöïc phaåm (daãn lieäu cuûa Doyle vaø Padhye, 1989). Nhö vaäy taêng sinh theo qui trình cuûa FAO (1992) khoâng thích hôïp cho vieäc phaùt hieän caùc gen ñoäc löïc cuûa nhöõng doøng E. coli gaây beänh. Töø nhöõng lyù do treân, chuùng toâi cho raèng öu ñieåm cuûa phöông phaùp ñònh löôïng laø xaùc ñònh ñöôïc toång soá vi khuaån E. coli nhöng khoâng bao goàm nhöõng doøng E. coli mang gen ñoäc löïc, ñaëc bieät laø nhoùm STEC maø tieâu bieåu laø O157:H7 taùc nhaân gaây ngoä ñoäc thöïc phaåm ñöôïc quan taâm haøng ñaàu. Do vaäy, toång soá E. coli xaùc ñònh ñöôïc baèng qui trình ñònh löôïng chæ phaûn aùnh möùc ñoä oâ nhieãm phaân vaøo thöïc phaåm nhöng khoâng thích hôïp cho vieäc phaùt hieän caùc gen ñoäc löïc. Keát quaû phaùt hieän moät soá gen ñoäc löïc stx2e, sta, stb, lt-I, stx1, stx2, eae, vaø hlyA Toång soá 161 maãu khaûo saùt goàm 10 phaân beâ tieâu chaûy, 22 phaân heo con tieâu chaûy, 21 phaân boø bình thöôøng, 25 phaân heo bình thöôøng, 34 beà maët thòt boø, vaø 49 beà maët thòt heo. Ñoái vôùi maãu phaân, ria tröïc tieáp treân thaïch MAC, nuoâi caáy ôû 370C. Maãu thòt ñöôïc caáy chuyeån töø moâi tröôøng loûng CVP qua thaïch CT-SMAC. Muïc tieâu cuûa khaûo saùt naøy laø taàm soaùt söï hieän dieän cuûa vi khuaån E. coli mang gen ñoäc löïc. Do vaäy, chuùng toâi khoâng tieán haønh PCR cho töøng khuaån laïc rieâng leû maø choïn 4-10 khuaån laïc ñieån hình E. coli ñaïi ñieän cho maãu roài chuyeån vaøo cuøng moät eppendorf ñeå taùch chieát DNA. Quy trình m-PCR1 ñeå phaùt hieän gen stx2e, sta, stb, lt- I vaø qui trình m-PCR2 ñeå phaùt hieän gen stx1, stx2, eae, vaø hlyA. Keát quaû PCR ñöôïc ghi nhaän ôû baûng 2. Gen ñoäc löïc cuûa E. coli phaân laäp ñöôïc töø phaân beâ tieâu chaûy vaø phaân boø bình thöôøng Keát quaû ôû baûng 2 cho thaáy tæ leä maãu phaân beâ tieâu chaûy coù E. coli mang gen ñoäc löïc stx1, stx2, eae, hly, vaø stb ñöôïc phaùt hieän laàn löôït laø 40%, 20%, 30%, 30% vaø 20%. Khoâng phaùt hieän ñöôïc gen stx2e, sta vaø lt-I. Nhö vaäy coù 7/10 (70%) maãu phaân mang moät trong taùm gen ñoäc löïc, haàu heát chuùng thuoäc nhoùm STEC (5/10 maãu), chæ coù 2/10 maãu mang gen saûn sinh ñoäc toá ruoät chòu nhieät (ETEC). Trong 21 maãu phaân boø bình thöôøng, coù 13 maãu (61,9%) phaùt hieän ñöôïc moät trong taùm gen ñoäc löïc cuûa E. coli, trong ñoù coù 12/21 (57,1%) maãu mang caùc gen thuoäc nhoùm STEC vaø 4/21 (19,0%) maãu mang gen saûn sinh ñoäc toá chòu nhieät thuoäc nhoùm ETEC. Gen stx2 vaø stx1 ñöôïc phaùt hieän vôùi tæ leä cao nhaát (42,9% vaø 38,1%), keá ñeán laø caùc gen hly Loaïi maãu Soá maãu Toång soá E. coli (X ± SE) (MPN/g) Keát quaû phaùt hieän gen ñoäc löïc cuûa E. coli Phaân boø 10 9,5*106 ± 7,4*106 Khoâng phaùt hieän Phaân Phaân heo 10 102*106 ± 46,3*106 Khoâng phaùt hieän Thòt boø 8 14,8*104 ± 4,2*104 Khoâng phaùt hieän Thòt Thòt heo 23 0,4*104 ± 1,1*104 Khoâng phaùt hieän Baûng 1. Toång soá vi khuaån E. coli trong phaân vaø thòt cuûa boø, heo NGHIEÂN CÖÙU KHOA HOÏC KYÕ THUAÄT Ñaïi hoïc Noâng Laâm Tp. HCM Taïp chí KHKT Noâng Laâm nghieäp, soá 3/2007 57 vaø stb (19,0% vaø 14,3%), thaáp nhaát laø caùc gen eae, sta (4,8%), chöa phaùt hieän ñöôïc gen lt-I. Gen ñoäc löïc cuûa E. coli phaân laäp ñöôïc töø phaân heo con tieâu chaûy/phaân bình thöôøng Tæ leä maãu phaân heo cai söõa tieâu chaûy coù E. coli mang gen ñoäc löïc stx1, stx2, eae, hly, stx2e, sta vaø stb laàn löôït laø 0%; 50%; 12,5%; 6,3%; 31,3%; 25%; vaø 81,3%. Coù 14/16 (87,5%) maãu mang moät trong taùm gen ñoäc löïc, trong ñoù coù 10/16 maãu (62,5%) mang gen saûn sinh ñoäc toá shiga (STEC) vaø 13/16 maãu (81,3%) mang gen sinh ñoäc toá ruoät chòu nhieät (ETEC). Trong khi ñoù, phaân heo con tieâu chaûy chæ phaùt hieän ñöôïc gen stx1, stx2e vaø stb vôùi tæ leä baèng nhau 33,3%. Ñoái vôùi phaân heo bình thöôøng, trong 25 maãu coù 10 maãu mang ít nhaát moät trong taùm gen ñoäc löïc (chieám 40%), trong ñoù coù 5/25 maãu (20%) mang gen saûn sinh ñoäc toá Shiga (STEC) vaø 7/25 maãu (28,0%) mang gen sinh ñoäc toá ruoät chòu nhieät (ETEC). Gen stb ñöôïc phaùt hieän vôùi tæ leä cao nhaát (28%), keá ñeán laø gen stx2e (16%) vaø gen eae, hly vaø stx2 laàn löôït laø 8%, 8% vaø 4%. Chöa phaùt hieän ñöôïc gen stx1, sta vaø lt-I. Gen ñoäc löïc cuûa E. coli phaân laäp ñöôïc töø beà maët thòt boø vaø heo Ñeå taêng khaû naêng phaùt trieån cuûa nhoùm E. coli mang gen ñoäc löïc STEC (Shiga toxin E. coli) treân thòt, chuùng toâi söû duïng moâi tröôøng MAC boå sung theâm ñöôøng sorbitol, khaùng sinh cefixime vaø tellurite. Treân CT-SMAC, E. coli O157H7, vaø khoaûng 6% caùc serotype non-O157H7 cuûa STEC taïo khuaån laïc khoâng maøu hoaëc maøu xaùm vôùi taâm ñuïc, caùc E. coli khaùc cho khuaån laïc maøu hoàng gioáng nhö treân MAC. Treân thòt boø, 21/34 (61,8%) maãu nhieãm E. coli mang gen ñoäc löïc. Taàn soá phaùt hieän ñöôïc gen stx1, stx2, eae, hly vaø stb laàn löôït laø 32,4% ; 50% ; 23,5% ; 26,5% vaø 2,9%, chöa phaùt hieän ñöôïc gen sta vaø lt-1 (Baûng 2). Gen stx2e gaây beänh phuø thuõng treân heo cai söõa ñöôïc phaùt hieän trong 3 maãu thòt boø, coù theå do söï nhieãm phaân heo thòt mang truøng trong quaù trình haï thòt. Töông töï, 12/49 (24,5%) maãu thòt heo nhieãm E. coli mang gen ñoäc löïc. Phaùt hieän ñöôïc 11/49 (22,5%) maãu mang gen stx2, 2/49 (4,1%) maãu mang gen eae vaø hly, khoâng phaùt hieän ñöôïc gen stx1 vaø caùc gen cuûa nhoùm ETEC. Toùm laïi E. coli mang gen ñoäc löïc phaùt hieän ñöôïc treân thòt heo thaáp hôn thòt boø (24,5% so vôùi 61,8%). THAÛO LUAÄN Keát quaû khaûo saùt cho thaáy tæ leä maãu phaân coù E. coli mang gen saûn sinh ñoäc toá Shiga (STEC) ôû phaân boø bình thöôøng vaø phaân beâ tieâu chaûy laàn löôït laø Gen ñoäc löïc Soá maãu coù gen ñoäc löïc m-PCR1 m-PCR2 Maãu Soá maãu STEC ETEC Chung stx2e sta stb lt-I stx1 stx2 eae hlyA Phaân beâ tieâu chaûy 10 5 50,0% 2 20,0% 7 70,0% 0 0 0 0 2 20,0 0 4 40,0 2 20,0 3 30,0 3 30,0 Phaân boø bình thöôøng 21 12 57,1% 4 19,0% 13 61,9% 0 0 1 4,8 3 14,3 0 8 38,1 9 42,9 1 4,8 4 19,0 Beà maët thòt boø 34 19 55,9% 1 2.9% 21 61,8% 3 8,8 0 0 1 2,9 0 11 32,4 17 50,0 8 23,5 9 26,5 Toång coäng 65 36 55,4 7 10,8 41 63,1 3 4,6 1 1,5 6 9,2 0 23 35,4 28 43,1 12 18,5 16 24,6 Phaân heo con tieâu chaûy 06 2 33,3% 3 50,0% 3 50,0% 2 33,3 0 0 2 33,3 0 0 2 33,3 0 0 0 0 0 0 Phaân heo cai söõa tieâu chaûy 16 10 62,5% 13 81,3% 14 87,5% 5 31,3 4 25,0 13 81,3 0 0 0 0 8 50,0 2 12,5 1 6,3 Phaân heo bình thöôøng 25 5 20% 7 28% 10 40,0% 4 16,0 0 7 28,0 0 0 0 0 1 4,0 2 8,0 2 8,0 Beà maët thòt heo 49 12 24,5% 0 0% 12 24,5% 0 0 0 0 0 0 0 0 0 0 11 22,5 2 4,1 2 4,1 Toång coäng 96 29 30,2% 23 23,9% 39 40,6% 11 11,5 4 4,2 23 24,0 0 0 0 0 22 22,9 6 6,3 5 5,2 Baûng 2. Keát quaû phaùt hieän gen ñoäc löïc stx2e, sta, stb, lt-I, stx1, stx2, eae, vaø hlyA NGHIEÂN CÖÙU KHOA HOÏC KYÕ THUAÄT Taïp chí KHKT Noâng Laâm nghieäp, soá 3/2007 Ñaïi hoïc Noâng Laâm Tp. HCM 58 57,1% vaø 50%. Trong khi ñoù, coù 20% maãu phaân heo bình thöôøng mang gen saûn sinh ñoäc toá Shiga. Ngöôïc laïi, trong phaân heo cai söõa tieâu chaûy, tæ leä naøy laø 62,5%. Ngoaøi ra, E. coli mang gen ñoäc löïc phaùt hieän ñöôïc treân thòt heo thaáp hôn thòt boø (24,5% so vôùi 61,8%).Nhö vaäy STEC hieän dieän khaù phoå bieán trong phaân boø bình thöôøng, phaân beâ tieâu chaûy, phaân heo cai söaõ tieâu chaûy vaø treân thòt boø gieát moå thuû coâng hoaëc xuaát hieän khoâng thöôøng xuyeân trong phaân heo bình thöôøng vaø treân thòt heo. Keát quaû cuûa chuùng toâi töông töï nhö nhaän ñònh cuûa Beutin vaø ctv (1995). Hoï ñaõ cho raèng nhöõng doøng STEC toàn taïi trong phaân bình thöôøng cuûa thuù nuoâi khoûe maïnh, nhaát laø trong phaân thuù thuoäc loaøi nhai laïi. Ngöôøi tieâu duøng caûm nhieãm STEC do aên phaûi thöùc aên bò nhieãm hoaëc tieáp xuùc tröïc tieáp vôùi STEC töø ñoäng vaät. Ngöôøi nhieãm STEC coù theå tieâu chaûy hoaëc traàm troïng hôn thì vieâm keát traøng xuaát huyeát (HC) hoaëc hoäi chöùng huyeát nieäu (HUS) ñe doïa ñeán tính maïng cuûa ngöôøi vaø ñoäng vaät (Karmali, 1989); treû em coù theå töû vong do tieâu chaûy vaø toån thöông thaän caáp (Nataro vaø Kaper, 1998). Do ñoù, veä sinh toát cho thuù haï thòt, veä sinh trong luùc haï thòt vaø phaân phoái laø bieän phaùp haøng ñaàu ngaên ngöøa vaáy nhieãm STEC töø phaân ñeán thòt nhaèm ñaûm baûo veä sinh an toaøn thöïc phaåm cho ngöôøi tieâu duøng. Gen stx2e chòu traùch nhieäm saûn sinh ñoäc toá vero chæ ñöôïc phaùt hieän ôû E. coli trong phaân heo con theo meï tieâu chaûy (33%), phaân heo cai söaõ tieâu chaûy (31,3%) vaø phaân heo bình thöôøng (16%). Ñieàu naøy phuø hôïp vôùi keát luaän cuûa Beutin vaø ctv (1993), stx2e laø moät bieán chuûng cuûa stx2, bieán chuûng naøy chæ hieän dieän ôû E. coli trong phaân heo. Keát quaû khaûo saùt naøy cho thaáy trong phaân heo bình thöôøng vaãn hieän dieän caùc doøng E. coli sinh ñoäc toá vero gaây beänh tieâu chaûy vaø phuø thuõng cho heo con, ñaëc bieät laø treân heo sau cai söõa. Do ñoù, veä sinh toát taïi chuoàng nuoâi heo con, quaûn lyù “cuøng vaøo, cuøng ra” vaø quaûn lyù dinh döôõng hôïp lyù laø bieän phaùp phoøng ngöaø tieâu chaûy vaø phuø thuõng cho heo con. Ngoaøi ra, caùc gen sinh ñoäc toá ruoät cuûa E. coli thuoäc nhoùm ETEC, ñaëc bieät laø gen stb hieän dieän khaù phoå bieán trong E. coli ôû phaân heo cai söõa tieâu chaûy (81,3%), phaân heo con theo meï tieâu chaûy (33,3%), trong phaân boø vaø heo bình thöôøng thì tæ leä naøy thaáp hôn. Theo Blanco vaø ctv (1997), gen stb xuaát hieän vôùi tæ leä cao nhaát 78,4% (58/74 maãu) so vôùi caùc gen ñoäc löïc khaùc cuûa E. coli phaân laäp töø phaân heo con tieâu chaûy. OÂng keát luaän raèng ñoäc toá STb goùp phaàn ñaùng keå trong hoäi chöùng tieâu chaûy ôû heo. Nhaän ñònh naøy cuõng phuø hôïp vôùi keát quaû nghieân cöùu cuûa Handl vaø ctv (1992), Harel vaø ctv (1991). KEÁT LUAÄN Toång soá E. coli ñöôïc xaùc ñònh baèng qui trình ñònh löôïng chæ phaûn aùnh möùc ñoä oâ nhieãm phaân cuûa thöïc phaåm nhöng khoâng thích hôïp cho vieäc phaùt hieän caùc gen ñoäc löïc cuûa nhoùm STEC vaø ETEC. Trong taùm gen ñoäc löïc cuûa E. coli trong caùc loaïi maãu phaân tích, stx1 hieän dieän nhieàu nhaát trong phaân boø bình thöôøng, phaân beâ tieâu chaûy vaø treân thòt boø gieát moå thuû coâng; gen stx2 hieän dieän nhieàu trong phaân boø bình thöôøng, phaân heo con tieâu chaûy, treân thòt boø gieát moå thuû coâng vaø hieän dieän ôû möùc trung bình treân thòt heo; gen stb vaø stx2e hieän dieän nhieàu trong phaân heo cai söõa tieâu chaûy. Gen hly hieän dieän ôû möùc trung bình trong phaân boø, beâ tieâu chaûy vaø thòt boø nhöng khaù thaáp trong phaân heo vaø thòt heo. Nhö vaäy, phaân boø vaø beâ coù theå laø nguoàn löu cöõu chính cuûa STEC. TAØI LIEÄU THAM KHAÛO Beutin L., Geier D., Steinruck H., Zimmermann S., and Scheutz F., 1993. Prevalence and some properties of verotoxin (Shiga – like toxin) – producing Escherichia coli in seven different species of healthy domestic animals. J. Clin. Microbiol. 31:2483 – 2488. Beutin L., Geier D., Zimmermann S., and Karch H., 1995. Virulence markers of Shiga - like toxin producing Escherichia coli strains originating from healthy domestic animals of difference species. J. Clin. Microbiol. 33:631–635. Blanco M., Blanco J.E, Gonzales E.A., Mora A., Jasen W., Gomes T.A.T., Zerbini L.F., Yano T., de Castro A.F.P., and Blanco J., 1997. Genes coding for enterotoxins and verotoxins in porcine Escherichia coli strains belonging to different O:K:H serotypes: Relationship with phenotype. J. Cli. Mircobiol. 35:2958-2963. Doyle M.P. and Padhye V.V., 1989. Escherichia coli. In Foodborne bacterial pathogens (Ed: M.P. Doyle). Marcel Decker Inc. NY. pp235-281. FAO, 1992. Microgiological analysis in the food control laboratory. Handl C.E., Olsson E., and Flock J.I., 1992. Evaluation of three different STb assays and comparision of enterotoxin pattern over a five-year period in Swedish porcine Escherichia coli. Diagn. Microbiol. Infect. Dis. 15:505-510. Harel J., Lapointe H., Fallara A., Lorrtie A., Bigras-Poulin M., Lariviere S., and Fairbrother J.M., 1991. Detection of genes for fimbrial antigens and enterotoxins associated with Escherichia coli NGHIEÂN CÖÙU KHOA HOÏC KYÕ THUAÄT Ñaïi hoïc Noâng Laâm Tp. HCM Taïp chí KHKT Noâng Laâm nghieäp, soá 3/2007 59 serogroups isolated from pig with diarrhea. J. Clin. Microbiol. 29:745-752 Karmali M. A., 1989. Infection by verocytotoxin – producing Escherichia coli . J. Clin. Microbiol. Rev. 2:15–38. Nataro J. P., and Kaper J. B., 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Reviews. 11:142–201. Nguyen Ngoc Hai, 2002. Maladie de l’edemedu porc au Vietnam: carateuørisation des sou ches Escherichia coli responsables, facteurs de pathogenicite et vaccination. PhD Thesis. Universite de Toulouse, France. Paton A. W. and Paton J. C., 1998. Detection and characterization of Shiga toxigenic. Escherichia coli by using multiplex – PCR assays for stx1, stx2, eaeA, enterohemorrhagic Escherichia coli hlyA, rfb O111, and rfb O157. J. Clin. Microbiol. 36:598–602.

Các file đính kèm theo tài liệu này:

  • pdfPhát hiện một số gen độc lực của escherichia coli trên thịt bò, heo và trong phân bò, heo bằng kỹ thuật.pdf
Luận văn liên quan