Tạo dòng và biểu hiện gen chitinase từ nấm trichoderma

MỤC LỤC Trang phụ bìa Lời cam đoan Lời cảm ơn Mục Lục Danh mục các kí hiệu, các chữ viết tắt Danh mục các bảng Danh mục các hình vẽ, đồ thị Mở đầu Chương 1. Tổng quan 1.1. Tổng quan về chitinase 1.1.1. Giới thiệu chitinase 1.1.2. Tình hình nghiên cứu chitinase 1.1.3. Khả năng kiểm soát nấm bệnh và côn trùng gây hại thực vật của chitinase. 1.2. Tổng quan về nấm Trichoderma 1.2.1 Tình hình nghiên cứu nấm Trichoderma 1.2.2. Một số yếu tố ảnh hưởng đến sự phát triển của nấm Trichoderma 1.2.3. Khả năng kiểm soát các tác nhân gây bệnh cây trồng và cơ chế tác động của nấm đối kháng Trichoderma 1.2.3.1. Hiệu quả đối kháng của nấm Trichoderma đối với nấm gây bệnh cây trồng 1.2.3.2. Cơ chế tác động của nấm Trichoderma lên các tác nhân gây bệnh cây trồng 1.3. Tổng quan về công nghệ DNA tái tổ hợp 1.3.1. Giới thiệu chung 1.3.2. Ứng dụng công nghệ DNA tái tổ hợp trong sản xuất enzyme 1.4. Tình hình nghiên cứu về chitinase tái tổ hợp 1.5. Tạo dòng và biểu hiện gene trong E.coli 1.6. Tạo dòng và biểu hiện gen trong nấm men Chương 2. Đối tượng và phương pháp nghiên cứu 2.1. Đối tượng nghiên cứu 2.2. Phương pháp nghiên cứu 2.2.1.Xác định chủng Trichoderma sinh chitinase ngoại bào mạnh 2.2.2. Xác định hoạt tính chitinase 2.2.3. Tách chiết chitinase 2.2.4. Xác định khối lượng phân tử của chitinase 2.2.5. Định danh chủng nấm Trichoderma 2.2.5.1. Tách chiết genomic DNA 2.2.5.2. Tạo dòng trình tự ITS 2.2.5.3. Tạo dòng và biểu hiện gen chitinase 2.2.6. Các phương pháp thống kê sinh học Chương 3. Kết quả và thảo luận 3.1. Tuyển chọn các chủng nấm Trichoderma tiết chitinase ngoại bào mạnh 3.2. Xác định hoạt độ chitinase bằng phương pháp quang phổ 3.3. Xác định khối lượng phân tử của enzyme chtinase 3.4. Định danh chủng nấm 3.5. Tạo dòng và biểu hiện gen chitinase Chương 4. Kết luận TÀI LIỆU THAM KHẢO PHỤ LỤC

pdf59 trang | Chia sẻ: lvcdongnoi | Ngày: 26/01/2013 | Lượt xem: 2313 | Lượt tải: 16download
Bạn đang xem nội dung tài liệu Tạo dòng và biểu hiện gen chitinase từ nấm trichoderma, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
thai nhi. GRA2 của Toxoplasma gondii gây đáp ứng miễn dịch ở người và chuột làm tăng lượng kháng thể sản sinh ra để chống lại sự phát triển của loài kí sinh trùng này. Majid Golkar và cs (2004) đã nghiên cứu tạo ra được protein GRA2 tái tổ hợp trong chủng E. coli BL21 pLysS. Sau khi phân tích sự biểu hiện của protein này bằng Western blot và xem khả năng gây đáp ứng miễn dịch ở chuột bằng thử nghiệm in vivo trên chuột, kết quả cho thấy lượng kháng thể thuộc loại IgG2a và IgG1 đều tăng lên, có tác dụng chống lại sự có mặt của TRX-GRA2 [52]. 1.6. TẠO DÒNG VÀ BIỂU HIỆN GEN TRONG NẤM MEN Trong việc tạo dòng và biểu hiện gen vào một đối tượng khác thì vật chủ là một yếu tố quyết định đến sự thành công cũng như hiệu suất của quá trình. Bên cạnh những ưu điểm của E. coli như vòng đời ngắn, khả năng sinh trưởng và phát triển mạnh, nó cũng có nhược điểm như không có quá trình hậu dịch mã. Từ đó, việc biểu hiện các gen được phân lập từ sinh vật nhân chuẩn sẽ gặp nhiều khó khăn. Để khắc phục nhược điểm này người ta đã chọn những vật chủ khác có nguồn gốc là sinh vật nhân chuẩn làm vật chủ biểu hiện như nấm men S. cerevisiae hay Pichia pastoris [43]. 29 Một nghiên cứu của Rashed và cs (2010) đã biểu hiện endochitinase, cht2 của Trichoderma virens UKM1 và nấm men Pichia pastoris, gen cht2 và trình tự cDNA của nó được tạo dòng và giải trình tự, kết quả có thể gen cht2 dài 1169 bp, mã hóa cho protein dài 321 amino acid, sau đó trình tự cDNA được tạo dòng vào vector biểu hiện pPICZαC và biến nạp vào nấm men P. pastoris X33 sử dụng promoter cảm ứng methanol, protein tái tổ hợp được sản xuất ra có khối lượng phân tử 35 kDa khi cảm ứng 0,5% methanol. Để phân tích xem enzyme tái tổ hợp có chức năng sinh học hay không, Rashed đã thử hoạt tính phân giải colloidal chitin của enzym này, kết quả cho thấy hoạt độ riêng của enzyme đạt 1,34 U/mg, enzyme hoạt động tốt nhất ở pH 6.0 và nhiệt độ 350C và ổn định trong khoảng pH 5.0 đến 7.0 và nhiệt độ 30 đến 550C [57]. Baccatin III, một chất trung gian của quá trình sinh tổng hợp Taxol, là một tiền chất hữu ích để bán tổng hợp thuốc chống ung thư, được sản xuất từ những loài thủy tùng, thông qua một chuổi của 15 bước xúc tác nhờ enzyme trong quá trình trao đổi chất sơ cấp. Mười gen mã hóa cho những enzyme tham gia vào quá trình này đã được mô tả, từ đó cho phép thiết kế lại các giai đoạn sớm của quá trình trao đổi chất taxane diterpenoid (taxoid) trong vật chủ S. cerevisiae. Tám trong số các gen taxoid này được biểu hiện chức năng trong nấm men từ các vector episome chứa 1 hoặc nhiều cassett liên kết chặt chẽ với với các đuôi epitope khác nhau cho phép giám sát và phân biệt protein của những enzyme có cùng kích thước. Cả tám loại protein tái tổ hợp được phát hiện bằng kĩ thuật immunoblotting sử dụng những kháng thể đơn dòng đặc hiệu và mỗi protein biểu hiện được xác định có chức năng bằng phân tích enzyme in vitro, hoạt độ có sự khác nhau đáng kể giữa các loại enzyme. Các bước phân tích chỉ ra rằng, những tiền chất isoprenoid từ nấm men có thể được sử dụng trong con đường cấu thành lại bởi vì các sản phẩm tích lũy từ 2 30 giai đoạn đầu của quá trình thiết kế (dẫn đến việc chuyển thành taxadiene trung gian) [40]. Gen mã hóa Isoamylase (iso) của Pseudomonas amyloderamosa được khuếch đại bằng PCR và được tạo dòng vào vector S. cerevisiae dưới sự điều khiển của gen mã hóa alcohol dehydrogenase và promoter glyceraldehyde-3- phosphate dehydrogenase. Trình tự tín hiệu của gen iso cũng được thay thế bằng gen mã hóa α-amylase Schwanniomyces occidentalis. Hoạt độ isoamylase ngoại bào của S. cerevisiae đạt đến 86 U/ml sau khi nuôi 4 ngày. Nghiên cứu này mô tả cấu trúc của plasmid chứa gen iso từ Pseudomonas amyloderamosa và sự biểu hiện chức năng của isoamylase trong S. Cerevisiae [55]. Hiện nay, có nhu cầu về việc tiêu thụ rượu chứa độ cồn và các chất bảo quản hóa học thấp. Trong nghiên cứu này, các tác giả biểu hiện gen mã hóa 1 glucose oxidase (GOX; β-D-glucose: oxygen oxidoreductase, EC 1.1.3.4) của A. niger trong S. cerevisiae và đánh giá khả năng sản xuất rượu có nồng độ cồn thấp và sự ức chế các sinh vật làm hỏng rượu của chủng biến nạp. Gen cấu trúc GOX được tạo dòng vào vector Yip5 chứa trình tự tín hiệu MFa1S, promoter phosphoglycerate-kinase-1(PGK1P) và terminator PGK1T. Cassette PGK1P-MFa1S-gox-PGK1T có ở chủng S. cerevisiae S1278. Các kết quả phân tích cho thấy, glucose oxidase tái tổ hợp có hoạt tính và được sản suất sớm và ổn định ở pha sinh trưởng. Nấm men biến nạp cũng cho hoạt tính kháng vi sinh vật và rượu chứa lượng cồn thấp hơn 1,8–2,0% [53]. Sự dung hợp giữa gen cấu trúc a-factor trong nấm men và gen mã hóa protein tương tự ở người đã được thiết kế. Những protein lai bao gồm 89 amino acid đầu tiên của tiền chất a-factor, hoạt động dung hợp với protein ngoại lai có khối lượng nhỏ (j8-endorphin, 31 amino acids) hoặc protein lai có khối lượng lớn (a-interferon,166 amino acids). Promoter a-factor được sử dụng để điều khiển sự phiên mã gen dung hợp trong S. cerevisiae, protein 31 ngoại lai được tiết ra môi trường nuôi cấy một cách có hiệu quả. Sự phân cắt protein liên quan đến sự trưởng thành của những peptide a-factor từ tiền chất hoạt động cũng xuất hiện chính xác trong protein lai. Sự phân cắt xuất hiện ở vị trí carboxyl của 2 lysine nằm trong peptide 6-endorphin [19]. Gen mã hóa xylanase (xynA) của Aureobasidium pullulans được biểu hiện trong S. cerevisiae và sản phẩm của nó được tiết vào trong môi trường. Khung đọc mở của xynA được tạo dòng trong S. cerevisiae, bao gồm phần mã hóa peptide tín hiệu. Sản phẩm biểu hiện có hoạt độ xylanase 6,7 U/ml trong phân đoạn liên kết tế bào và 26,2 U/ml trong môi trường nuôi cấy sau 4h cảm ứng với galactose. Kết quả cho thấy rằng, peptide tín hiệu xynA hỗ trợ cho quá trình hậu dịch mã của sản phẩm xynA và xylase hoạt động từ nấm men tiết một cách hiệu quả vào môi trường nuôi cấy (gấp 3 lần so với A. pullulans) [71]. Gen mã hóa chitinase ech42 được lấy từ T. aureoviride M và được khuếch đại bằng PCR, sau đó được phân tích trình tự. Kết quả cho thấy, khung đọc mở của ech42 có kích thước 1.447 bp, mã hóa cho 421 amino acid và có 3 vùng intron được tìm thấy trong trình tự. Vector tạo dòng pMD18-T và vật chủ E. coli DH5α được sử dụng để tạo thành DH5α/ech42 . Gen ech42 được chèn vào pYES2, kết quả tạo ra vector tái tổ hợp pYES2/ech42. Chitinase biểu hiện bởi pYES2/ech42 được cảm ứng bằng galactose trong môi trường lên men lỏng, sau 36 giờ có hoạt độ cao nhất là 0,5 U/ml [63]. 32 Chƣơng 2. ĐỐI TƢỢNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1. ĐỐI TƢỢNG NGHIÊN CỨU - Gen chitinase của các chủng nấm đối kháng Trichoderma được phân lập từ đất ở Quảng Điền, Thừa Thiên Huế và Cam Lộ, Quảng Trị 2.2. PHƢƠNG PHÁP NGHIÊN CỨU 2.2.1. Xác định chủng Trichoderma sinh chitinase ngoại bào mạnh Chủng Trichoderma sinh chitinase ngoại bào mạnh được tuyển chọn bằng phương pháp khếch tán đĩa thạch. Cấy nấm Trichoderma vào đĩa petri chứa môi trường Czapeck-Dox với glucose được thay bằng colloidal chitin 1% (w/v) để cảm ứng tổng hợp chitinase, ủ ở nhiệt độ 28oC trong 36 giờ, sau đó nhuộm màu với thuốc thử lugol và đo đường kính vòng phân giải (Orpin, 1977). 2.2.2. Xác định hoạt tính chitinase Hoạt độ của chitinase được xác định dựa theo phương pháp của Tsuijbo và Hatano (1998) với para-nitrophenyl-β-N-acetylglucosaminidase (pNp- GlcNAc) làm cơ chất. Cho 70 µL enzyme thô vào 140 µL dung dịch pNp- GlcNAc 2,5 mM trong đệm acetate 50 mM (pH 5), phản ứng được tiến hành ở 50 0C trong 30 phút. Sau đó ngừng phản ứng bằng 1,4 ml Na2CO3 0,2 M. Do độ hấp phụ màu của sản phẩm tạo thành ở bước sóng 420 nm. Hoạt độ chitinase được định nghĩa là lượng enzyme có khả năng xúc tác chuyển hóa 1 nmol cơ chất pNp-GlcNAc thành p-nitrophenyl trong thời gian 1 phút. Tính toán hàm lượng p-nitrophenyl theo đường chuẩn y = 0,673x (R2 = 0,99) với x là OD, y là nồng độ p-nitrophenyl. 33 Protein hòa tan tổng số được đo bằng phương pháp Bradford đo ở bước sóng 595 nm. Hoạt độ riêng của enzyme chitinase được tính bằng cách chia hoạt độ chung (U/ ml) cho protein tổng số (mg/ ml) [48]. 2.2.3. Tách chiết chitinase Bào tử nấm Trichoderma được thu từ đĩa petri bằng nước cất vô trùng và cấy trong môi trường lỏng Czapeck-Dox, pha loãng mẫu đến 107 bào tử/ml, cấy 2 ml dịch bào tử nấm Trichoderma vào 100 ml môi trường lỏng Czapeck- Dox. Mẫu được nuôi ở 28oC trong 96 giờ với tốc độ lắc 180 vòng/phút. Sợi nấm được rửa sạch bằng MgCl2 và nước cất vô trùng. Sau đó, nuôi trong môi trường Czapeck-Dox bổ sung 1% colloidal chitin (không có glucose) ở 280C trong 48 giờ với tốc độ lắc 100 vòng/phút. Dịch nổi được kết tủa bằng (NH4)2SO4 70% bảo hòa ở 4 0 C trong 2 giờ. Hòa tan kết tủa bằng đệm acetate 0,1 M (pH 5).Thẩm tích và làm sạch dịch chiết chitinase trong đệm acetate 0,05 M (pH 5). 2.2.4. Xác định khối lƣợng phân tử của chitinase Protein ngoại bào tổng số sau khi tách chiết được phân tách trên điện di trên gel polyacrylamide (SDS-PAGE) theo phương pháp của Laemmli (1970) với separating gel 12 % và stacking gel 5 %. Khối lượng phân tử của chitinase được xác định bằng phương pháp điện di không biến tính trên gel polyacrylamide có bổ sung colloidal chitin với nồng độ 0,1%, điện di được tiến hành ở 40C trong 3 giờ, sau đó ủ trong đệm acetate 100 mM ở 370C trong 2 giờ có bổ sung 1% (v/v) Triton X-100 (Trudel, Asselin, 1989). Gel cơ chất được nhuộm bằng dung dịch lugol. 34 2.2.5. Định danh chủng nấm Trichoderma 2.2.5.1. Tách chiết genomic DNA DNA tổng số của các chủng nấm có hoạt độ chitinase cao được tách chiết theo phương pháp sử dụng phenol-chloroform (Siddiquee và cs. 2007). Sợi nấm sau khi nuôi trên đĩa môi trương 1/5 PDA được cấy chuyển sang môi trường lỏng 1/5 PDA, nuôi 2 ngày ở 280C, sinh khối sợi nấm được thu và rửa 3 lần với nước cất sau đó sử dụng để tách chiết DNA. 1 g sinh khối sợi nấm được đồng nhất trong 500 µL DNA extration buffer 0,2 M có bổ sung 10% SDS và ủ ở 650C trong 2 giờ, sử dụng hỗn hợp phenol : chloroform : isoamylalcohol để kết tủa các thành phần không phải DNA. Dịch nổi chứa DNA được kết tủa bằng ethanol 100% lạnh và rửa lại bằng ethanol 70%. Quá trình tinh sạch sử dụng máy ly tâm với tốc độ 10.000 vòng/phút ở 40C. 2.2.5.2. Tạo dòng trình tự ITS Cặp mồi ITS1F (5’TCCGTAGGTGAACCTGCGG3’) và ITS4R (5’TCCTCCGCTTATTGATATGC3’) được sử dụng để khuếch đại vùng trình tự ITS của rRNA gen (White và CS, 1990). Hỗn hợp phản ứng PCR bao gồm 10 pmol mồi xuôi, 10 pmol mồi ngược, 4 mM MgCl2, 0,2 mM dNTP mỗi loại, 0,625 đơn vị Taq DNA polymerase (PCR Master Mix 2×, Fermentas, Canada), 25 ng DNA khuôn mẫu với tổng thể tích phản ứng là 25 µL. Quy trình khuếch đại PCR bao gồm: biến tính 950C/5 phút; 30 chu kỳ: 95 0 C/1 phút, 55 0 C/ 1 phút, 72 0C/2 phút và cuối cùng là 720C/10 phút. Sản phẩm PCR được điện di trên agarose gel 0,8% và nhuộm bằng Ethidium bromide 0,05 %. Hình ảnh điện di được thu nhận bằng hệ thống thu nhận hình ảnh Gel Documentation và phân tích bằng phần mềm Quantity one 4.5 (Bio- Rad, Mỹ). 35 Sản phẩm PCR được tinh sạch bằng kit tinh sạch (Wizard SV Gel and PCR Clean-Up System) của hãng Promega. Sau đó, được gắn vào vector pCR ® 2.1 trong 10 µL thể tích phản ứng gồm: 10 ng sản phẩm PCR, 50 ng vector, 1 µL T4 ligase và 1 µL đệm phản ứng 10× T4 ligase. Phản ứng được thực hiện ở 140C qua đêm. Vector pCR® 2.1 mang gen chitinase được biến nạp vào chủng E. coli TOP10 bằng phương pháp shock nhiệt. Trình tự các đoạn ITS được xác định bằng máy giải trình tự tự động (Sequencing Office, First BASE Laboratories, Singapore). So sánh các trình tự này với dữ liệu trên ngân hàng gen bằng công cụ blast trên NCBI ( 2.2.5.3. Tạo dòng và biểu hiện gen chitinase Trình tự mồi C42F (5’GGATCCATGTTGGGCTTCCTCGAAAATCC3’), C42R (5’GAATTCCTAGTTGAGACCGCTTCGGA3’) được thiết kế dựa trên gen ech42 của chủng T. harzianum CB-Pin-01 (accession nember: DQ166036), mồi có thêm 2 trình tự nhận biết điểm cắt cho enzyme cắt hạn chế EcoRI và BamHI (phần gạch chân). Quá trình khếch đại gen bằng PCR, điện di kiểm tra và tinh sạch tiến hành tương tự như với trình tự ITS. Sản phẩm PCR và vector pYES2/NT A được cắt lần lượt bằng EcoRI và BamHI với thể tích phản ứng 20 µL gồm: 0,5 µg sản phẩm PCR hoặc vector, 2 µL buffer 10×, 2 đơn vị enzyme và nước cất vô trùng. Sản phẩm PCR và vector sau khi cắt được gắn trong 20 µL thể tích phản ứng gồm: 80 ng sản phẩm PCR, 60 ng vector, 4 đơn vị T4 ligase và 2 µL đệm phản ứng 10× T4 ligase. Phản ứng được thực hiện ở 140C qua đêm. Vector mang gen chitinase được biến nạp vào chủng E. coli TOP10 bằng phương pháp shock nhiệt. Đoạn gen chitinase được giải trình tự và so sánh dữ liệu trên ngân hàng gen tương tự như thực hiện với trình tự ITS. 36 Sau đó, vector pYES2/NT A mang gen chitinase được biến nạp vào chủng S. cerevisiae INVSc1 theo phương pháp sốc nhiệt sử dụng Lithium Acetate (Invitrogen). Sự hiện diện của gen chitinase trong S. cerevisiae tái tổ hợp được phân tích bằng kỹ thuật PCR. Tế bào nấm men tái tổ hợp được nuôi cấy trên môi trường YPD gồm 1 % dịch chiết nấm men, 2 % peptone, 2 % D glucose, cảm ứng với galactose 2% để tổng hợp chitinase, mẫu được thu 12 giờ một lần để phân tích hoạt tính. 2.2.6. Các phƣơng pháp thống kê sinh học - Tính trung bình mẫu và sai số chuẩn của ít nhất 3 lần lặp lại. - Phân tích ANOVA các số liệu thực nghiệm về đặc tính của chitinase tái tổ hợp. 37 3. KẾT QUẢ VÀ THẢO LUẬN 3.1. Tuyển chọn các chủng nấm Trichoderma sinh chitinase ngoại bào mạnh Dựa trên nguồn nấm Trichoderma đã được Phạm Thanh Hòa (2009) thu thập và phân lập [5]. Chúng tôi tiến hành tuyển chọn chủng có hoạt độ enzyme chitinase mạnh, vòng phân giải chitin được xác định sau 96 giờ nuôi cấy ở 280C. Kết quả cho thấy hầu hết 43 chủng nấm đều có khả năng sinh tổng hợp chitinase với mức độ khác nhau. Trong đó, chúng tôi tuyển chọn được 5 chủng Trichoderma spp. có hoạt độ chitinase cao nhất dựa vào đường kính và độ sáng của vòng phân giải chitin (bảng 3.1). Bảng 3.1. Đƣờng kính vòng phân giải chitin của Trichoderma trên môi trƣờng cảm ứng Chủng Trichoderma spp. Đường kính vòng phân giải chitin(cm) CH2 3,20 b SH16 2,50 c PQ34 4,07 a TN41 1,70 d TN42 2,07 cd Ghi chú : Các chữ cái khác nhau trong cột biểu thị sự sai khác có ý nghĩa thống kê với p <0,05 . 38 Kết quả trên bảng 3.1 cho thấy khả năng phân giải cơ chất giữa các chủng Trichoderma spp. là khác nhau. Hầu hết các chủng đều có đường kính vòng phân giải chitin trên 2 cm. Trong đó, đáng chú ý là chủng CH2 có đường kính trên 3 cm và chủng PQ34 đường kính trên 4 cm. Các chủng CH2, SH16, PQ34, TN41 và TN42 là những chủng có hoạt tính mạnh được chọn lọc và tiếp tục khảo sát hoạt độ (Hình 3.1). Hình 3.1. Vòng phân giải chitin của các chủng nấmTrichoderma spp. 3.2. Xác định hoạt độ chitinase Chủng SH16 có hoạt độ chung cao nhất, chủng CH2 có hoạt độ chung thấp nhất. Hoạt độ chung các chủng PQ34, TN41 và TN42 sai khác không có ý nghĩa thống kê. CH2 SH16 PQ34 TN41 TN42 ĐC 39 Bảng 3.2. Hoạt độ chitinase của các chủng Trichoderma spp. Chủng Trichoderma Hoạt độ chung (u/ml) Hoạt độ riêng (u/mg) CH2 0,042 c 0,209 b SH16 0,559 a 0,748 ab PQ34 0,450 ab 1,307 a TN41 0,179 bc 0,659 ab TN42 0,439 ab 0,964 ab Kết quả bảng 3.1 và 3.2 thấy có sự sai khác, chủng SH16 có đường kính vòng phân giải thấp nhưng hoạt độ riêng cao, ngược lại với chủng CH2 hoạt độ riêng thấp trong khi đường kính vòng phân giải cao. Có thể giữa các chủng khác nhau hoạt tính chitinase biểu hiện ở các mức độ khác nhau. Tuy nhiên khả năng tiết chitinase và hoạt tính chitinase giữa các chủng tuyển chọn không có sự sai khác lớn. So sánh hoạt tính chitinase của các chủng Trichoderma với kết quả nghiên cứu hoạt độ chitinase ở thực vật, những chủng nấm Trichoderma chúng tôi khảo sát có hoạt độ cao hơn (Nguyễn Thị Ngân Hà, 2008) [4]. 40 3.3. Xác định khối lƣợng phân tử của enzyme chitinase Việc xác định được khối lượng phân tử của chitinase là cơ sở cho việc thiết kế mồi đặc hiệu cho gen này. Kết quả điện di xuất hiện nhiều băng tương đối rõ. Điều này chứng tỏ hàm lượng protein tổng số ở hầu hết các chủng tương đối nhiều. Hình 3.2. Điện di SDS và điện di cơ chất Để xác định khối lượng phân tử của chitinase, chúng tôi tiếp tục tiến hành điện di cơ chất và nhuộm bằng thuốc thử Lugol để phát hiện băng có hoạt tính chitinase. Sau khi nhuộm, thuốc thử Lugol bắt màu với chitin tạo màu trên gel điện di. Tại những băng có hoạt tính chitinase, chitin ở đó bị phân giải. Do vậy, tại những băng đó không xuất hiện màu mà xuất hiện một vệt sáng, trong suốt. Kết quả điện di cơ chất được trình bày ở hình 3.2 cho thấy tất cả các chủng đều xuất hiện băng không có màu tương ứng với vị trí khoảng 42 kDa. Như vậy, các chủng CH2, SH16, PQ34, TN41 và TN42 đã sản xuất ra chitinase khối lượng 42 kDa (Chit42 ). Khi nuôi các chủng Trichoderma spp. trong môi trường gồm chitin và một số loại muối khoáng, để sử dụng được nguồn dinh M CH2 SH16 PQ34 TN41 TN42 M CH2 SH16 PQ34 TN41 TN42 ~ 42 kDa 41 dưỡng chitin, bắt buộc chúng phải tiết ra chitinase phân hủy cơ chất này tạo nguồn dinh dưỡng dễ tiêu. 3.4. Định danh chủng nấm PCR được thực hiện với DNA khuôn mẫu là bộ gen nấm tách chiết được. Sản phẩm được điện di trên gel được trình bày ở hình 3.3 Hình 3.3 cho thấy sản phẩm của PCR là đặc hiệu, cặp mồi ITS1 và ITS4 đã khuếch đại được vùng ITS của nấm Trichoderma, sản phẩm có kích thước khoảng 600 bp. Sản phẩm PCR sau đó được tạo dòng và phân tích trình tự. Kết quả phân tích trình tự ITS của 5 chủng cho thấy chúng có chiều dài 602 bp và tương đồng 100%. Hình 3.3. Phản ứng PCR với cặp mồi ITS1 và ITS4 So sánh các trình tự này với dữ liệu trên GenBank ( nhận thấy 5 trình tự ITS này tương đồng 100% với CH2 SH16 PQ3 TN41 TN42 M ~ 600 bp 42 trình tự ITS của loài Trichoderma asperellum chủng ZJPH0810 (accession number: GU318216), như vậy, đây là 5 chủng thuộc loài Trichoderma asperellum. Các trình tự này đã được đăng ký tại GenBank với các mã số là HM545079, HM545080, HM545081, HM545082 và HM545083. Query 1 TCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 TCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGA 60 Query 61 ACGTTACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 ACGTTACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACC 120 Query 121 AGGCGCCCGCCGGAGGAACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTATTTCT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 AGGCGCCCGCCGGAGGAACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTATTTCT 180 Query 181 TACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 TACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTC 240 Query 241 TGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 TGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGA 300 Query 301 ATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 ATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCG 360 Query 361 AGCGTCATTTCAACCCTCGAACCCCTCCGGGGGATCGGCGTTGGGGATCGGGACCCCTCA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 AGCGTCATTTCAACCCTCGAACCCCTCCGGGGGATCGGCGTTGGGGATCGGGACCCCTCA 420 Query 421 CACGGGTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 CACGGGTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGT 480 Query 481 TTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTTCTGA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 TTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTTCTGA 540 Query 541 AATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 AATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAG 600 Query 601 GA 602 || Sbjct 601 GA 602 Hình 3.4. So sánh trình tự ITS của chủng SH16 với chủng ZJPH0810. 43 3.5. Tạo dòng và biểu hiện gen chitinase PCR được thực hiện với DNA khuôn mẫu của nấm và cặp mồi C42R và C42F Sản phẩm được điện di trên gel được trình bày ở hình 3.5. Hình 3.5 cho thấy sản phẩm của PCR là đặc hiệu, cặp mồi C42R và C42F đã khuếch đại được vùng gen chitinase của nấm Trichoderma, sản phẩm có kích thước khoảng 1.450 bp, các sản phẩm PCR được phân tích trình tự. Kết quả phân tích trình tự gen chitinase từ 5 chủng cho thấy các gen này có chiều dài bằng nhau (1459 bp), tương đồng 99% so với trình tự được sử dụng để thiết kế mồi (ech42), trong đó trình tự gen chitinase từ chủng SH16 giống 100% với trình tự gen chitinase từ chủng TN41. Các gen này đang được đăng ký tại GenBank với các mã số là HM191682, HM191683, HM191684 và HM208346. Hình 3.5. sản phẩm PCR với cặp mồi C42R và C42F M CH2 SH16 PQ3 TN41 TN42 ~1,400 bp 44 ech42 ATGTTGGGCTTCCTCGGAAAATCCGTGGCCCTGCTTGCTGCGCTGCAGGCCACTCTCACC 60 chi42-TN42 ATGTTGGGCTTCCTCGGAAAATCCGTGGCCCTGCTTGCTGCGCTGCAGGCCACTCTCACC 60 chi42-SH16 ATGTTGGGCTTCCTCGGAAAATCCGTGGCCCTGCTTGCTGCGCTGCAGGCCACTCTCACC 60 chi42-CH2 ATGTTGGGCTTCCTCGGAAAATCCGTGGCCCTGCTTGCTGCGCTGCAGGCCACTCTCACC 60 chi42-DQ34 ATGTTGGGCTTCCTCGGAAAATCCGTGGCCCTGCTTGCTGCGCTGCAGGCCACTCTCACC 60 ************************************************************ ech42 TCTGCAACTCCTGTGTCTACAAACGACGTCTCAGTTGAGAAGAGAGCCAGCGGATACACA 120 chi42-TN42 TCTGCAACTCCTGTGTCTACAAACGACGTCTCAGTTGAGAAGAGAGCCAGCGGATACACA 120 chi42-SH16 TCTGCAACTCCTGTGTCTACAAACGACGTCTCAGTTGAGAAGAGAGCCAGCGGATACACA 120 chi42-CH2 TCTGCATCTCCTGTGTCTACAAACGACGTCTCAGTTGAGAAGAGATCCAGCGGATACGCA 120 chi42-DQ34 TCTGCATCTCCTGTGTCTACAAACGACGTCTCAGTTGAGAAGAGAGCCAGCGGATACGCA 120 ****** ************************************** *********** ** ech42 AACGCTGTCTACTTCACCAACTGGTGAGTGAAGCTAACTCGTGGTCATGAATTTCAGGGC 180 chi42-TN42 AACGCTGTCTACTTCACCAACTGGTGAGTGAAGCTAACTCGTGGTCATGAATTTCAGGGC 180 chi42-SH16 AACGCTGTCTACTTCACCAACTGGTGAGTGAAGCTAACTCGTGGTCATGAATTTCAGGGC 180 chi42-CH2 AACGCTGTCTACTTCACCAACTGGTGAGTGAAGCTAACCCGTGGTCATGAATTTCAGGGC 180 chi42-DQ34 AACGCTGTCTACTTCACCAACTGGTGAGTGAAGCTAACTCGTGGTCATGAATTTCAGGGC 180 ************************************** ********************* ech42 TAACTATGGGCAATTAAAGGGGTATCTATGGCCGCAACTTTCAACCCCAGGACCTGGTGG 240 chi42-TN42 TAACTATGGGCAATTAAAGGGGTATCTATGGCCGCAACTTTCAACCCCAGGACCTGGTGG 240 chi42-SH16 TAACTATGGGCAATTAAAGGGGTATCTATGGCCGCAACTTTCAACCCCAGGACCTGGTGG 240 chi42-CH2 TAACTATGGGCGATTAAAGGGGTATCTATGGCCGCAACTTTCAACCCCAGGACCTGGTTG 240 chi42-DQ34 TAACTATGGGCGATTAAAGGGGTATCTATGGCCGCAACTTTCAACCCCAGGACCTGGTTG 240 *********** ********************************************** * ech42 CGTCGGACATCACTCATGTCATCTACTCTTTCATGAACTTCCAAGCAGACGGCACTGTGT 300 chi42-TN42 CGTCGGACATCACTCATGTCATCTACTCTTTCATGAACTTCCAAGCAGACGGCACTGTGT 300 chi42-SH16 CGTCGGACATCACTCATGTCATCTACTCTTTCATGAACTTCCAAGCAGACGGCACTGTGT 300 chi42-CH2 CGTCGGACATCACTCATGTCATCTACTCTTTCATGAACTTCCAAGCAGACGGCACTGTGT 300 chi42-DQ34 CGTCGGACATCACTCATGTCATCTACTCTTTCATGAACTTCCAAGCAGACGGCACTGTGT 300 ************************************************************ ech42 AAGTTTCGAAGCCAAGAGTTTTCTATCTATATCCAGTCGCTGACCTTTTCAACTATAGTG 360 chi42-TN42 AAGTTTCGAAGCCAAGAGTTTTCTATCTATATCCAGTCGCTGACCTTTTCAACTATAGTG 360 chi42-SH16 AAGTTTCGAAGCCAAGAGTTTTCTATCTATATCCAGTCGCTGACCTTTTCAACTATAGTG 360 chi42-CH2 AAGTTTCGAAGCCAAGAGTTTTCCATCCATATTCAGTCGCTGACCTTTTCAACTATAGTG 360 chi42-DQ34 AAGTTTCGAAGCCAAGAGTTTTCCATCTATATTCAGTCGCTGACCTTTTCAACTATAGTG 360 *********************** *** **** *************************** ech42 TCTCTGGAGATGCCTACGCCGATTATCAGAAGCACTATTCCGACGATTGTATGACAACTC 420 chi42-TN42 TCTCTGGAGATGCCTACGCCGATTATCAGAAGCACTATTCCGACGATTGTATGACAACTC 420 chi42-SH16 TCTCTGGAGATGCCTACGCCGATTATCAGAAGCACTATTCCGACGATTGTATGACAACTC 420 chi42-CH2 TCTCTGGAGATGCCTACGCCGATTATCAGAAGCACTATTCTGACGATTGTATGACAGCTC 420 chi42-DQ34 TCTCTGGAGATGCCTACGCCGATTATCAGAAGCACTATTCTGACGATTGTATGACAGCTC 420 **************************************** *************** *** ech42 TTTCCCCTTAGTACTCCAACTTTGAGCCAATGCATATAAACTAACATCTACAACAGCCTG 480 chi42-TN42 TTTCCCCTTAGTACTCCAACTTTGAGCCAATGCATATAAACTAACATCTACAACAGCCTG 480 chi42-SH16 TTTCCCCTTAGTACTCCAACTTTGAGCCAATGCATATAAACTAACATCTACAACAGCCTG 480 chi42-CH2 TTTCCCCTTATTACTCCAACTTTGAGCCAATGCATATAAACTAACATCTATAATAGCCTG 480 chi42-DQ34 TTTCCCCTTAGTACTCCAACTTTGAGCCAATGCATATAAACTAACATCTATAATAGCCTG 480 ********** *************************************** ** ****** ech42 GAATGACGTCGGAAACAACGCATACGGCTGTGTGAAGCAGCTGTTTAAGTTGAAGAAGGC 540 chi42-TN42 GAATGACGTCGGAAACAACGCATACGGCTGTGTGAAGCAGCTGTTTAAGTTGAAGAAGGC 540 chi42-SH16 GAATGACGTCGGAAACAACGCATACGGCTGTGTGAAGCAGCTGTTTAAGTTGAAGAAGGC 540 chi42-CH2 GAATGATGTCGGCAACAACGCATACGGTTGTGTGAAGCAGTTGTTCAAGTTGAAGAAGGC 540 chi42-DQ34 GAATGATGTCGGCAACAACGCATACGGTTGTGTGAAGCAGTTGTTCAAGTTGAAGAAGGC 540 ****** ***** ************** ************ **** ************** ech42 CAATCGCAACTTGAAGGTTATGCTCTCTATCGGTGGCTGGACCTGGTCCACCAACTTCCC 600 chi42-TN42 CAATCGCAACTTGAAGGTTATGCTCTCTATCGGTGGCTGGACCTGGTCCACCAACTTCCC 600 chi42-SH16 CAATCGCAACTTGAAGGTTATGCTCTCTATCGGTGGCTGGACCTGGTCCACCAACTTCCC 600 chi42-CH2 CAACCGCAACTTGAAGGTTATGCTCTCTATCGGTGGCTGGACCTGGTCCACCAACTTCCC 600 chi42-DQ34 CAACCGCAACTTGAAGGTTATGCTCTCTATCGGTGGCTGGACCTGGTCCACCAACTTCCC 600 *** ******************************************************** ech42 TTCTGCAGCAAGCACCGATGCCAACCGCAAGAACTTTGCCAAGACGGCCATCACCTTCAT 660 chi42-TN42 TTCTGCAGCAAGCACCGATGCCAACCGCAAGAACTTTGCCAAGACGGCCATCACCTTCAT 660 45 chi42-SH16 TTCTGCAGCAAGCACCGATGCCAACCGCAAGAACTTTGCCAAGACGGCCATCACCTTCAT 660 chi42-CH2 TTCTGCAGCAAGCACCGATGCCAACCGCAAGAACTTTGCCAAGACGGCCATCACCTTCAT 660 chi42-DQ34 TTCTGCAGCAAGCACCGATGCCAACCGCAAGAACTTTGCCAAGACGGCCATCACCTTCAT 660 ************************************************************ ech42 GAAGGACTGGGGTTTTGATGGTATTGACGTCGACTGGGAGTACCCTGCCGATGACACTCA 720 chi42-TN42 GAAGGACTGGGGTTTTGATGGTATTGACGTCGACTGGGAGTACCCTGCCGATGACACTCA 720 chi42-SH16 GAAGGACTGGGGTTTTGATGGTATTGACGTCGACTGGGAGTACCCTGCCGATGACACTCA 720 chi42-CH2 GAAGGACTGGGGTTTTGATGGTATTGACGTCGACTGGGAGTACCCTGCCGATGACACCCA 720 chi42-DQ34 GAAGGACTGGGGTTTTGATGGTATTGACGTCGACTGGGAGTACCCTGCCGATGACACCCA 720 ********************************************************* ** ech42 GGCCACCAACATGGTTCTTCTGCTCAAGGAGATCCGATCTCAACTAGATGCCTATGCTGC 780 chi42-TN42 GGCCACCAACATGGTTCTTCTGCTCAAGGAGATCCGATCTCAACTAGATGCCTATGCTGC 780 chi42-SH16 GGCCACCAACATGGTTCTTCTGCTCAAGGAGATCCGATCTCAACTAGATGCCTATGCTGC 780 chi42-CH2 GGCCACCAACATGATTCTTCTGCTCAAGGAGATCCGATCTCAACTAGATGCCTATGCTGC 780 chi42-DQ34 GGCCACCAACATGATTCTTCTGCTCAAGGAGATCCGATCTCAACTAGATGCCTATGCTGC 780 ************* ********************************************** ech42 GCAATACGCTCCAGGCTACCACTTCCTTCTCTCCATCGCTGCCCCCGCTGGACCAGAGCA 840 chi42-TN42 GCAATACGCTCCAGGCTACCACTTCCTTCTCTCCATCGCTGCCCCCGCTGGACCAGAGCA 840 chi42-SH16 GCAATACGCTCCAGGCTACCACTTCCTTCTCTCCATCGCTGCCCCCGCTGGACCAGAGCA 840 chi42-CH2 GCAATACGCTCCAGGCTACCACTTCCTGCTCTCCATCGCTGCCCCCGCTGGACCAGAGCA 840 chi42-DQ34 GCAATACGCTCCAGGCTACCACTTCCTGCTCCCCATCGCTGCCCCCGCTGGACCAGAGCA 840 *************************** *** **************************** ech42 CTACTCTGCCCTGCACATGGCCGACCTTGGTCAAGTTCTCGACTATGTCAACCTTATGGC 900 chi42-TN42 CTACTCTGCCCTGCACATGGCCGACCTTGGTCAAGTTCTCGACTATGTCAACCTTATGGC 900 chi42-SH16 CTACTCTGCCCTGCACATGGCCGACCTTGGTCAAGTTCTCGACTATGTCAACCTTATGGC 900 chi42-CH2 CTACTCTGCGCTGCACATGGCCGACCTTGGTCAAGTTCTCGACTATGTCAACCTTATGGC 900 chi42-DQ34 CTACTCTGCGCTGCACATGGCCGACCTTGGTCAAGTTCTCGACTATGTCAACCTTATGGC 900 ********* ************************************************** ech42 CTATGACTATGCTGGTTCTTGGAGCAGCTACTCTGGACACGATGCCAACTTGTTTGCCAA 960 chi42-TN42 CTATGACTATGCTGGTTCTTGGAGCAGCTACTCTGGACACGATGCCAACTTGTTTGCCAA 960 chi42-SH16 CTATGACTATGCTGGTTCTTGGAGCAGCTACTCTGGACACGATGCCAACTTGTTTGCCAA 960 chi42-CH2 CTATGACTATGCTGGTTCTTGGAGCAGCTACTCTGGACACGATGCCAACTTGTTTGCCAA 960 chi42-DQ34 CTATGACTATGCTGGTTCTTGGAGCAGCTACTCTGGACACGATGCCAACTTGTTTGCCAA 960 ************************************************************ ech42 CCCGTCCAATCCCAACTTTTCACCATACAACACCGATCAGGCTATCAAGGCTTATATCAA 1020 chi42-TN42 CCCGTCCAATCCCAACTCTTCACCATACAACACCGATCAGGCTATCAAGGCTTATATCAA 1020 chi42-SH16 CCCGTCCAATCCCAACTCTTCACCATACAACACCGATCAGGCTATCAAGGCTTATATCAA 1020 chi42-CH2 CCCGTCCAACCCCAACTCTTCACCATACAACACCGATCAGGCTATCAAGGCTTATATCAA 1020 chi42-DQ34 CCCGTCCAACCCCAACTCTTCACCATACAACACCGATCAGGCTATCAAGGCTTATATCAA 1020 ********* ******* ****************************************** ech42 CGGAGGCGTTCCCGCAAGCAAGATCGTTCTTGGCATGCCTATCTATGGACGATCTTTCGA 1080 chi42-TN42 CGGAGGCGTTCCCGCAAGCAAGATCGTTCTTGGCATGCCTATCTATGGACGATCTTTCGA 1080 chi42-SH16 CGGAGGCGTTCCCGCAAGCAAGATCGTTCTTGGCATGCCTATCTATGGACGATCTTTCGA 1080 chi42-CH2 CGGAGGCGTTCCCGCAAGCAAGATCGTTCTTGGCATGCCTATCTATGGACGATCTTTCGA 1080 chi42-DQ34 CGGAGGCGTTCCCGCAAGCAAGATCGTTCTTGGCATGCCTATCTATGGACGATCTTTCGA 1080 ************************************************************ ech42 GAGCACTAATGGCATTGGCCAAACCTACAATGGAATTGGATCTGGAAGCTGGGAGAACGG 1140 chi42-TN42 GAGCACTAATGGCATTGGCCAAACCTACAATGGAATTGGATCTGGAAGCTGGGAGAACGG 1140 chi42-SH16 GAGCACTAATGGCATTGGCCAAACCTACAATGGAATTGGATCTGGAAGCTGGGAGAACGG 1140 chi42-CH2 GAGCACTAACGGCATTGGCCAAACCTACAGTGGAATTGGATCTGGAAGCTGGGAGAACGG 1140 chi42-DQ34 GAGCACTAACGGCATTGGCCAAACCTACAGTGGAATTGGATCTGGAAGCTGGGAGAACGG 1140 ********* ******************* ****************************** ech42 TATCTGGGACTACAAGGTTCTTCCCAAGGCCGGCGCTACAGTCCAGTACGACTCTGTCGC 1200 chi42-TN42 TATCTGGGACTACAAGGTTCTTCCCAAGGCCGGCGCTACAGTCCAGTACGACCCTGTCGC 1200 chi42-SH16 TATCTGGGACTACAAGGTTCTTCCCAAGGCCGGCGCTACAGTCCAGTACGACTCTGTCGC 1200 chi42-CH2 TATCTGGGACTACAAGGTTCTTCCCAAGGCCGGCGCTACAGTCCAGTACGACTCTGTCGC 1200 chi42-DQ34 TATCTGGGCCTACAAGGTTCTTCCCAAGGCCGGCGCTACAGTCCAGTACGACTCTGTCGC 1200 ******** ******************************************* ******* ech42 ACAGGCGTACTACAGCTATGATTCTAGCAGCAAGGAGCTCATCTCTTTCGATACCCCTGA 1260 chi42-TN42 ACAGGCGTACTACAGCTATGATTCTAGCAGCAAGGAGCTCATCTCTTTCGATACCCCTGA 1260 chi42-SH16 ACAGGCGTACTACAGCTATGATTCTAGCAGCAAGGAGCTCATCTCTTTCGATACCCCTGA 1260 46 chi42-CH2 ACAGGCGTACTACAGCTATGATTCTAGCAGCAAGGAGCTCATCTCTTTCGATACCCCTGA 1260 chi42-DQ34 ACAGGCGTACTACAGCTATGATTCTAGCAGCAAGGAGCTCATCTCTTTCGATACCCCTGA 1260 ************************************************************ ech42 CATGGTCAGCAAAAAGGTCTCTTACCTCAAGAATCTCGGCCTGGGAGGCAGTATGTTCTG 1320 chi42-TN42 CATGGTCAGCAAAAAGGTCTCTTACCTCAAGAATCTCGGCCTGGGAGGCAGTATGTTCTG 1320 chi42-SH16 CATGGTCAGCAAAAAGGTCTCTTACCTCAAGAATCTCGGCCTGGGAGGCAGTATGTTCTG 1320 chi42-CH2 CATGGTCAGCAAAAAGGTCTCTTACCTCAAGAATCTCGGCCTGGGAGGCAGCATGTTCTG 1320 chi42-DQ34 CATGGTCAGCAAAAAGGTCTCTTACCTCAAGAATCTCGGCCTGGGAGGCAGCATGTTCTG 1320 *************************************************** ******** ech42 GGAGGCTTCTGCTGACAAGACTGGCTCCGACTCCTTGATCGGAACAAGCCACAGAGCGCT 1380 chi42-TN42 GGAGGCTTCTGCTGACAAGACTGGCTCCGACTCCTTGATCGGAACAAGCCACAGAGCGCT 1380 chi42-SH16 GGAGGCTTCTGCTGACAAGACTGGCTCCGACTCCTTGATCGGAACAAGCCACAGAGCGCT 1380 chi42-CH2 GGAGGCTTCTGCCGACAAGACTGGCTCCGACTCCTTGATCGGAACAAGCCACAGAGCGCT 1380 chi42-DQ34 GGAGGCTTCTGCTGACAAGACTGGCTCCGACTCCTTGATCGGAACAAGCCACAGAGCGCT 1380 ************ *********************************************** ech42 GGGAAGCCTGGACTCAACTCAGAACTTGCTGAGCTACCCCAACTCCCAGTATGATAACAT 1440 chi42-TN42 GGGAAGCCTGGACTCAACTCAGAACTTGCTGAGCTACCCCAACTCCCAGTATGATAACAT 1440 chi42-SH16 GGGAAGCCTGGACTCAACTCAGAACTTGCTGAGCTACCCCAACTCCCAGTATGATAACAT 1440 chi42-CH2 GGGAAGCCTGGACTCAACTCAGAACTTGCTGAGCTACCCCAACTCCCAGTATGATAACAT 1440 chi42-DQ34 GGGAAGCCTGGACTCAACTCAGAACTTGCTGAGCTACCCCAACTCCCAGTATGATAACAT 1440 ************************************************************ ech42 CCGAAGCGGTCTCAACTAG 1459 chi42-TN42 CCGAAGCGGTCTCAACTAG 1459 chi42-SH16 CCGAAGCGGTCTCAACTAG 1459 chi42-CH2 CCGAAGCGGTCTCAACTAG 1459 chi42-DQ34 CCGAAGCGGTCTCAACTAG 1459 ******************* Hình 3.6. So sánh trình tự các gen chitinase phân lập đƣợc và gen ech42. Dấu * thể hiện sự giống nhau trong trình tự của các gen. 3.6. Biến nạp gen chitinase vào nấm men Đoạn gen chitinase được chèn vào vùng tạo dòng của vector pYES2 như hình 3.7. Sau khi biến nạp vào nấm men, sự hiện diện của gen chitinase trong S. cerevisiae tái tổ hợp được phân tích bằng kỹ thuật PCR, kết quả cho thấy có sự hiện diện của gen chitinase trong tế bào nấm men . 47 Hình 3.7. Vector pYES2/NT A có mang gen chi42-SH16 Hình 3.8. Kiểm tra sự hiện diện của gen chi42-SH16 trong nấm men tái tổ hợp. SM. size marker (Lambda/HindIII), S: sản phẩm PCR từ nấm men tái tổ hợp, NC: đối chứng âm, PC: đối chứng dƣơng. ~ 1450 bp SM S NC PC 48 Tế bào nấm men tái tổ hợp được nuôi cấy trên môi trường YPD, cảm ứng với galactose cho thấy hoạt tính chitinase xuất hiện sau 24 giờ cảm ứng và đạt cao nhất vào 96 giờ (7,44 đơn vị/mg protein) (Hình 3.9) kết quả này cũng tương tự kết quả của Caihong và cs (2007) [21]. Các chỉ tiêu về điều kiện nuôi cấy cảm ứng sản xuất chitinase tái tổ hợp (CHIT42-SH16) vẫn đang tiếp tục được nghiên cứu. Hình 3.9. Hoạt tính chitinase tái tổ hợp theo thời gian cảm ứng Thời gian (giờ) H o ạ t đ ộ r iê n g ( U /m g p ro te in ) 49 4. KẾT LUẬN VÀ ĐỀ NGHỊ 4.1. Kết luận - Hầu hết các chủng đều có đường kính vòng phân giải trên 2 cm, trong đó lớn nhất là chủng PQ34 là 4 cm. - Chủng SH16 có hoạt độ chung lớn nhất, chủng PQ34 có hoạt độ riêng lớn nhất và lớn hơn nhiều ở thực vật. - Khối lượng phân tử của chitinase khoảng 42 kDa. - 5 chủng nấm Trichoderma CH2, SH16, PQ3, TN41,TN42 đề thuộc loài Trichoderma asperellum - Gen chtinase của 5 chủng CH2, SH16, PQ3, TN41,TN42 đều có chiều dài là 1459 bp - Hoạt độ chitinase tái tổ hợp cao nhất sau 96h cảm ứng với galactose 2 % đạt trên 7 U/mg protein 4.2. Đề nghị - Tiếp tục tối ưu quy trình sản xuất chitinase, tìm ra điều kiện sản xuất chitinase với hiệu xuất cao hơn. 50 TÀI LIỆU THAM KHẢO Tài liệu tiếng việt 1. Nguyễn Quỳnh Anh, Nguyễn Đức Hoàng, Trần Linh Thước (2003), “Tạo dòng và mã hóa protein vỏ VP19 của vi rút WSSV gây hội chứng đốm trắng ở tôm Sú (P. monodon)”, TC Di truyền học & Ứng dụng 4, tr. 49-55. 2. Nguyễn Văn Đĩnh (2007), Giáo trình biện pháp sinh học bảo vệ thực vật, NXB Nông Nghiệp,tr. 38, 65,128-143 3. Đỗ Tấn Dũng (2006), “Nghiên cứu bệnh héo rủ gốc mốc trắng (Sclerotium rolfsii Sacc) hại một số cây trồng cạn vùng Hà Nội và phụ cận năm 2005-2006”, Trường đại học Nông Nghiệp I Hà Nội. 4. Nguyễn Thị Ngân Hà (2008), Khảo sát hoạt tính chitinase ở một số loài thực vật, Đồ án tốt nghiệp, Trường Đại học Bách khoa Đà Nẳng. 5. Phạm Thanh Hòa (2009), nghiên cứu khả năng đối kháng của nấm Trichoderma với nấm bệnh hại cây trồng sclerotium rolfsii sacc trong điều kiện in vitro, Khóa luận tốt nghiệp, Trường Đại học Nông Lâm Huế. 6. Nguyễn Xuân Hồng, Nguyễn Thị Yến (1991). “Kết quả nghiên cứu bệnh hại lạc ở Việt Nam”, Tiến bộ kỹ thuật về trồng lạc và đậu đỗ ở Việt Nam, NXB Nông Nghiệp Hà Nội, 111-120. 7. Nguyễn Hoàng Lộc, Trần Thị Lệ, Hà Thị Minh Thi (2007), Giáo trình Sinh học phân tử, NXB Đại học Huế. 8. Nguyễn Hoàng Lộc (2007), Giáo trình nhập môn công nghệ sinh học, NXB Đại học Huế. 9. Trần Kim Long, Lê Đình Đôn, Tạ Thanh Nam, Ngô Thị Xuân Thịnh, Nguyễn Thị Tiến Sỹ, Trần Thị Xê (2009), “Phòng trừ bệnh do nấm Phytophthora trên cây hồ tiêu bằng chế phẩm sinh học Trichoderma (Trico- VTN) tại Tây Nguyên”.Tạp chí chuyên ngành bảo vệ thực vật. Số 2, Tr. 22-27. 51 10. Vũ Triệu Mân (2007), Giáo trình bệnh cây đại cương, Trường Đại học nông nghiệp I Hà Nội, tr. 3-6. 11. Mehan V K,Nguyễn Xuân Hồng, Nguyễn Thị Ly (1991), “Kết quả điều tra, xác định nguyên nhân gây hiện tượng chết yểu hại lạc ở miền Bắc Việt Nam”, Tiến bộ kỹ thuật về trồng lạc và đậu đỗ ở Việt Nam, NXB Nông Nghiệp Hà Nội, Tr. 105-109. 12. Nguyễn Văn Mùi (2001), Thực hành hóa sinh học, Nhà xuất bản đại học quốc gia Hà Nội. 13. Nguyễn Thị Thuần, Lê Minh Thi, Dương Thị Hồng (1996). “Kết quả nghiên cứu bước bầu về nấm đối kháng Trichoderma ”.Tuyển tập công trình nghiên cứu bảo vệ thực vật 1990-1995. Nxb Hà Nội. 14. Nguyễn Văn Tuất (2002), Kỹ thuật chẩn đoán và giám định bệnh hại cây trồng, Nxb Nông Nghiệp Hà Nội, 22-23. 15. Hà Thị Quyến (2008), Nghiên cứu tính chất của Chitinase ở một số chủng vi nấm Metarhizium anisopliae diệt côn trùng, Luận văn thạc sĩ, Viện Sinh thái và Tài nguyên Sinh vật. Tài liệu tiếng anh 16. Alias N., Mahadi N. M., Murad A. M. A., Bakar F. D. A., Mahmood N. A. N., Illias R. M. (2009), “Expression and characterization of Trichoderma virens UKM-1 endochitinasein Escherichia coli”, World J Microbiol Biotechnol 25, pp. 561–572. 17. Baneyx F. (1999), Ecombinant protein expression in Escherichia coli, Current Opinion in Biotechnology, 10, pp. 411-421. 18. Benhamou N., Lafontaine P. J., Nicole M (1994), Induction of systemic 52 resistance to Fusarium crown and root rot in tomato seed treatment with chitosan, Phytopathology 84, pp. 1432-1444. 19. Bitter G. A., Chen K. K., Banks A. R., Lai P H. (1984), “Secretion of foreign proteins from Saccharomyces cerevisiae directed by a-factor gene fusions”, Proc. Natl. Acad. Sci, 81, pp.5330-5334 20. Broglie Z. K., Gaynor J. J., Broglie R. M. (1986), Ethylene- regulated gene expression: mulecular cloning of the genes encoding an endochitinase from Phaseolus vulgaris, Proc. Natl Acad. Sci. USA 83, pp. 6820-6824. 21. Caihong H., Qian Y., Jinzhu S., Yingqi S. (2007), “Expression of a Novel Chitinase Gene from Trichoderma harzianum in Saccharomyces cerevisiae”, Chinese National Programs for High Technology Research and Development, pp. 283-285. 22. Casolio C., Gutiérrez A., Jiménez B., Van Montagu M., Herrera E. A. (1994), Characterization of ech-42, a Trichoderma harzianum endochitinase gene expressed during mycoparasitism, Proc. Natl. Acad. Sci, 91, pp. 10903- 10907. 23. Corona J. E. B., Mazzocco E. N., Robledo R. V., Hernandez R. S., Bautista M., Jimenez B., Ibarra J. E. (2003), “Cloning, Sequencing, and Expression of the Chitinase Gene chiA74 from Bacillus thuringiensis”, Appliedand Environmental Microbiology, Vol.69, No.2, pp. 1023–1029 24. Cowan D. (1993), Industrial enzyme technology. Trend Biotechnol 14, pp. 177-178. 25. De J., Gallego A. H., Lora J. M., Benitez T., Toro J. A. P., Llobell A. (1992), Insolation and charaterizatin of three chitinase from Trichoderma haianum, Eur. J. Biochem, 206,pp. 859. 26. Demain A. L., Vaishnav P. (2009), Production of recombinant 53 proteins by microbes and higher organisms. Biotechnol Adv 53, pp. 112-122. 27. Gold M., Hayes C., Harman G. E. (1994), Molecular and cellular biology of biocontrol by Trichoderma harzianum, Trends Biotechnol 12, pp. 478-482. 28. Guang B. Z., Yong J. C., Qin S., Hong B. M., Yan G., Qin W, Zhi J., Ying X., Xue G. Z. (2004), “Human Recombinant B7 H3 Expressed in E. coli Enhances T Lymphocyte Proliferation and IL-10 Secretion in vitro”, Acta Biochimica et Biophysica Sinica, 36(6), pp. 430–436. 29. Guozhu C., Chery L. P., Herb E. S. (2003), “Controlled Expression of an rpoS Antisense RNA Can Inhibit RpoS Function in Escherichia coli”, Antimicrobial Agentsand Chemotherapy, Vol.47, No.11, pp.3485–3493. 30. Hamshary E., M. O. I., Salem H. H., Soliman. N. A. (2008), “Molecular Screening of Chitinase Gene in Bacillus spp.”, Journal of Applied Sciences Research, 4(9), pp. 1118-1123. 31. Harighi M. J., Zamani M. R., Motallehi M. (2007), “Evaluation of Antifungal Activity of Purified Chitinase 42 from Trichoderma antroviride PTCC 5200”. Biotechnology 6, pp. 28-33. 32. Harry B., Helena S., Sylvain C., Hans S., Anu K (2007), Heterologous expression and site-directed mutagenesis studies of two Trichoderma harzianum chitinases, Chit33 and Chit42, in Escherichia coli, VTT Technical Research Centre of Finland, P.O. Box 1000, FI-02044 VTT, Finland . 33. Hartingsveldt W., Zeijl C. M., Harteeld G. M., Gouka R. J. (1993), “Cloning, characterization and overexpression of the phytase-encoding gene (phyA) of A. niger”, Gene 127, pp. 87-94. 54 34. Hendy L., Gallagher J., Winter A., Hacket T. J., McHale L., McHale A. P. (1990), Production of extracellular chitinolytic system by Talaromyces emersonii CBS 814. 70, Biotechnol. Lett, 12, pp. 673- 678. 35. Henrissat B. (1991), “A classification of glycosyl hydrolase based on amino acid sequence similarities”, Biochem J, 280, pp. 309-316. 36. Henrissat B., Bairoch A. (1993), “New families in the classification of glycosyl hydrolases based on amino acid sequence similarities”, Biochem J , 293, pp. 781-788. 37. Hodgson J. (1994). “The changing bulk biocatalyst market”, Biotechnol 12: 789-790. 38. Inui H, Yamaguchi Y., Ishigami Y., Kawaguchi S. Yamada T., Ihara H., Hirano S. (1996), Three Extracellular Chitinases sn Suspension- Cultured Rice Cells Elicited by N- Acetylchitooligosaccharides, Biosci. Biotech, 60, pp. 1956-1961. 39. Jif S., Haiying Y., Jun L., Guoping S., Linfu Z., Yingyan L. (2007), “Cloning and expression of the human augmenter of liver regeneration at low temperature in Escherichia coli”, J. Biochem Biophys Methods 70, pp. 465– 470. 40. Jing H. M. D., Yule L., Arthur P. B., Robert M. L., Stefan J., David W., Rodney B. C. (2005), “Genetic Engineering of Taxol Biosynthetic genes in Saccharomyces cerevisiae”. Biotechnology and bioengineering, 93, (2), pp. 212-224. 41. Jinshu X., Wenjia L. J. W., Yin Z., Zheng Z., Jingjing L., Zhuoyi H. (2006), “Stability of plasmid and expression of are combinant gonadotropin releasing hormone (GnRH) vaccine in Escherichiacoli”, ApplMicrobiol Biotechnol 73, pp.780–788. 55 42. Jocelyne D., Frankt R. (1995), “Expression and In vitro Assembly of Recombinant Glutamate Dehydrogenase from the Hyperthermophilic Archaeon Pyrococcusfuriosus”, Appliedand Environmental Microbiology, Vol.61,No.1, pp.159-164. 43. John E. G., McCarthy (1998), “Posttranscriptional Control of Gene Expression in Yeast”, Microbiol Mol Biol Rev. December, 62(4), pp. 1492– 1553. 44. Kondo K., Matsumoto M., Maeda R. (1997), “Purification and characteristic of chitinase from japanase radish seeds”, jounal of chemical engineering of japan, pp. 610-03. 45. Laduvoca I., Gogorova L. (1988), “Biological control of phytopathogennic fungi through lytic action of Trichoderma species”, FEMS, Microbio. Lett, 52, pp. 193-198. 46. Li D. C. (2006), “Review of fungal chitinase”, Mycopathologia 161, pp. 345-360. 47. Limon C. M., J. Toro A. P., Benitaz T. (1999), “Increased Antifungal Activity of Trichoderma harzianum Transformants That Overexpress a 33- kDa Chitinase”, The American Phytopathological Society, 254. 48. Lin Y., Xiong G. (2004), “Molecular cloning and sequence analysis of the chitinase gene from Bacillus thuringiensis serovar alesti”, Biotechnology Letters 26, pp. 635-639. 49. Loc N. H, Song N. V., Quang H. T., Dung L.D., Loi D. D., Phuong T. T. B., Thuy D. T. B (2008),“Cloning and expression of neutral protease gene from Bacillus subtilis”. Vietnamese Journal Biotechnology 6, pp. 963-970. 50. Lorito M., Peterbauerg C., Hayes C. K., Harman G. E. (1988), “Synergistic interraction between fungal cell wall degrading enzymes and 56 different antifungal compound enhances inhibition of spore germination”, Microbiology 140, pp. 623 – 629. 51. Majeti N. V., Ravi K. (2000), “A review of chitin and chitosan applications”, Reactive & functional polymers, 46, pp. 1-27. 52. Majid G., Sima R., Yasaman T., Tahereh T., Fatemeh D., Mehdi A. (2004), “High level expression and evaluation of the antigenicity of a recombinant Toxoplasma gondii GRA2 protein”, Iranian Journal Of Biotechnology, Vol. 2, No. 3. 53. Malherbe D. F., Toit M. D., Otero R. R. C., Rensburg P. Van, Pretorius I. S. (2003), “Expression of the Aspergillus niger glucose oxidase gene in Saccharomyces cerevisiae and its potential applications in wine production”, Appl Microbiol Biotechnol, 61, pp. 502–511. 54. Mạnula K, Krishna G. K., Girish A. G., Singh S. D. (2004), Combined Application of Pseudomonas fluorescens and Trichoderma viride has an Improved Biocontrol Activity Against Stem Rot in Groundnut, plant phathol. J 20(1), pp. 75-80. 55. Pay H. C., Long L. L., Wen H. H. (1998), “Expression of Pseudomonas amyloderamosa isoamylase gene in Saccharomyces cerevisiae”. Biotechnology Letters, 20, (8), pp. 735-739. 56. Ping Y., Jian R. L. (2008), “Molecular cloning, sequence analysis, expression and Characterization of the endochitinase gene from Trichoderma sp. in Escherichiacoli BL21”, World J Microbiol Biotechnol 24, pp.2509-2516. 57. Rashed S. A., Bakar F. D. A., Said M., Hassan O., Rabu1A., Illias R. M., Murad A. M. A. (2010), “Expression and characterization of the recombinant Trichoderma virens endochitinase Cht2”, African Journal of Microbiology Research Vol. 4(16), pp. 1758-1767, 57 58. Riout C. J., Coley Smith J. R., Lynch J. M. (1986), Enzymes activity and electrophorectic profile of extraccellular protein induced in Trichoderma spp. By cell walls of Rhizoctonia solani, J. Gen. Microbiol, 13, pp. 2345-2352. 59. Roberts W. K., Selitrennikoff C. P. (1988), Plant and bacterial chitinases differ in antifugal activity, J. Gen. Microbiol, 134, pp. 169-176 60. Seidl V., Huemer B., Seiboth B., Kubicek C. P. (2005), “A complete survey of Trichoderma chitinase reveals three distinct subgroups of family 18 chitinase”, The FEBS Journal, 272, pp. 5923-5939. 61. Shimosaka M., Fukumori Y., Narita T., Zhang X. Y., Kodaira R., Nogawa M., Okazaki M. (2001), “The bacterium burkholderia gladioli strain CHB101 produces two different kind of chitinase belonging to families 18 and 19 of the glycosyl hydrolase”, Journal of bioscience and bioengineering, vol.91, No.1, pp. 103-105. 62. Shiuan C., Patrick E. C., Paul A. M., Paulis S. K. D., Che H. Y., Terry D. L., H. J. P., Paul T. (1994), “Mouse liver NAD(P)H: quinone acceptor oxidoreductase: Protein sequence analysis by tandem mass spectrometry, cDNA cloning, expression in Escherichia coli, and enzyme activity analysis”, Protein Science, 3, pp. 1296-1304. 63. Song J.,Yang Q., Liu B., Chen D. (2005),” Expression of the chitinase gene from Trichoderma aureoviride in Saccharomyces cerevisiae”, Appl Microbiol Biotechnol 69, pp. 39–43 64. Songjang K., Donchai T., Chaiyawat P., Meyer C. R. (2006), “Cloning and Expression of Chitinase Gene Isolated from Insect Pathogenic Fungi”, Beauveria bassiana in Escherichia coli, Chiang Mai J. Sci. 33(3), pp. 347 – 355. 65. Stroh W. H. (1994), Trends in the use of industrial bioprocessing 58 enzymes for the 21 st century, Gen Eng News 14(16), pp. 10-12. 66. Tsujibo H., Orikoshi H., Tanno H., Fujimoto K., Miyamoto K., Imada C., Okami Y., Inamori Y. (1993), “Cloning, Sequence, and Expression of a Chitinase Gene from a Marine Bacterium, Alteromonas sp. Strain 0-7”, Journal Of Bacteriology, Vol. 175, No. 1, pp 176-181. 67. Ueda M., Okada A., Kawaguchi T., Arai M. (1998), “Cloning and Sequence Analysis of a Chitinase Gene (pCA8 ORF) from Aeromonas sp”. No. lOS-24, Journalo F Fermentationa nd Bioengineering Vol. 86, No. 6, pp. 600-604. 68. Wu G. Q., Li L. X., Ding J. X, Wen L. Z., Shen Z. L. (2008), “High Level Expression and Novel Purificatio Strategy Of Recombinant Thanatin Analog in Escherichia coli”, Curr Microbiol 57, pp. 95-101. 69. Xiao D. S., In S. L. (2006), “Gene Technology in Tissue Engineering”, American Journal of Biochemistry and Biotechnology, 2 (2), pp. 66-72 70. Xiao J. C., Qiu L. X., Wei J. Z., Feng Y. S., Wan X. X., An Hong, Jing L., Jian H. W. (2005), “Expression of Nonfusion Extracellular Porcine Zona Pellucida Protein 3β in E. coli”, Journal of Reproduction & Contraception 16 (1), pp.11-16. 71. Xin L. L., Lars G. L. (1996), “Expression of Au. pullulans xynA in, and Secretion of the Xylanase from Sac. cerevisiae”, Apply and environmental microbiolory, 62, pp. 209-213 72. Xiqian L., Xin Z., Junhua H., Shimosaka M., (2006),”Cloning, expression, and characterization of a chitinase from the chitinolytic bacterium Aeromonas hydrophila strain SUWA-9”, biosci. Biotechnol. Biochem., 70(10), pp. 2437-2442. 59 73. Yang B., Ya Li Z., Jian F. J., Ji De W., Zhao S. Z., Dian Y. Z. (2003), “recombinant helicobacter pylori calalase”, World Journal Gastroenterol 9(5), pp. 1119-1122. 74. Yang C. Y., Ho Y. C., Pang J. C., Huang S. S., J. Tschen S. M. (2009), Cloning and expression of an antifungal chitinase gene of a novel Bacillus subtilis isolate from Taiwan potato field, Bioresource Technology, pp. 100 75. Yousuke Y., Katsuichiro O. (2004), “Purification and Antifungal Activity of Recombinant Chitinase from Escherichia coli Carrying the Family 19 Chitinase Gene of Streptomyces sp. J-13-3”, Biosci. Biotechnol. Biochem, 68 (10), pp. 2193-2196. 76. Zhinan X., Zhixia Z., Lei H., Li P., Fang W., Peilin C. (2006), “High level production of bioactive human beta-defens in-4 in Escherichia coli by soluble fusion expression”, Appl Microbiol Biotechnol 72, pp. 471-479.

Các file đính kèm theo tài liệu này:

  • pdfTạo dòng và biểu hiện gen chitinase từ nấm trichoderma.pdf
Luận văn liên quan