Tiêu chuẩn hóa phương pháp xác định các chỉ tiêu sinh hóa của vi khuẩn aeromonashydrophilatại khoa thủy sản

- Môi trường decarboxylase (xem công thức pha chế trên nhãn) + 0,5% yeast extract. - Thêm 1% amino acid (arginine, lysinevà ornithine) cho các phản ứng. - Môi trường làm đối chứng không có amino acid. - Cho 3ml môi trường vào ống nghiệm. - Thanh trùng ở 1200C trong 15 phút. - Cấy một ít vi khuẩn vào trong ống nghiệm sau đó phủ lên mỗi ống 0.5ml parafin tiệt trùng, để trong tủ ấm ở 280C.

pdf49 trang | Chia sẻ: lylyngoc | Ngày: 06/11/2013 | Lượt xem: 2610 | Lượt tải: 3download
Bạn đang xem nội dung tài liệu Tiêu chuẩn hóa phương pháp xác định các chỉ tiêu sinh hóa của vi khuẩn aeromonashydrophilatại khoa thủy sản, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
ydrophila. Bên cạnh đó tác giả còn sử dụng phương thức khác để định danh vi khuẩn (bộ kít API 20E, ELISA,…) đồng thời sử dụng các hóa chất trong nghiên cứu đa số đều ghi hãng cung cấp (Difco, Oxoid,..). Một tài liệu khác có liên quan đến loài vi khuẩn A. hydrophila là “Bacterial diseases of fish” (Inglis et al, 1993), các nhà khoa học cũng đưa ra những kết quả định danh bằng phương pháp truyền thống tương tự của Austin và Austin (1993), nhưng phần miễn dịch học (về huyết thanh, kháng thể,…) được nghiên cứu sâu hơn. Một nghiên cứu gần đây của Buller (2004) là đã dùng phương pháp định danh truyền thống với 41 chỉ tiêu và bộ kít API 20E cho các chủng chuẩn A. hydrophila để kiểm tra các đặc tính sinh lý, sinh hóa. Cùng với việc định danh này thì theo Đặng Thị Hoàng Oanh (2006) cũng đã dùng phương pháp truyền thống kiểm tra các đặc điểm sinh hóa và sinh lý với 41 chỉ tiêu. Nghiên cứu này có sự kết hợp định danh giữa các chủng vi khuẩn chuẩn và các chủng phân lập thể hiện mối quan hệ qua sơ đồ gia phả. Cùng sử dụng phương pháp truyền thống để định danh vi khuẩn A. hydrophila, các nghiên cứu ở Khoa Thuỷ sản – Trường Đại học Cần Thơ cũng được thực hiện. Chẳng hạn như, Báo cáo khoa học của Nguyễn Thị Thu Hằng (2005), đề tài “Khảo sát bệnh ký sinh trùng và vi khuẩn trên tôm càng xanh nuôi trong ao và ruộng lúa mật độ thấp” của Nguyễn Tấn Đạt (2002), luận văn về thử nghiệm vaccin phòng bệnh xuất huyết trên cá chép của Đoàn Nhật Phương (2001),… Gần đây, trong Báo cáo khoa học Đặng Thị Hoàng Oanh (2006) đã sưu tầm và thiết lập hệ thống lưu trữ các loài vi khuẩn phân lập trên tôm, cá bệnh thu được từ các đề tài và dư án thực hiện trước tại Khoa Thuỷ sản – Trường Đại học Cần Thơ. Từ kết quả nghiên cứu trên thu được đa số là hai giống vi khuẩn Vibro và Aeromonas. Trong đó, các chủng vi khuẩn được định danh trước và sau khi sưu tập gồm có 11 chủng vi khuẩn A. hydrophila phân lập trên cá chép bị xuất huyết và 20 chủng Aeromonas sp. phân lập từ tôm càng xanh bị cụt râu và mòn phụ bộ. Ngoài ra, còn có rất nhiều tác giả nghiên cứu loài vi khuẩn này như: Đỗ Thị Hòa và ctv (2004), Bùi Quang Tề (2006), Từ Thanh Dung và ctv (2005),… Bên cạnh phương pháp định danh truyền thống vi khuẩn như của Baumann et al (1984), phương pháp này đã được dùng phổ biến nhưng tốn nhiều công và môi trường để chuẩn bị ngoài ra thời gian kiểm tra cũng kéo dài, nên người ta đã sử dụng nhiều phương pháp kiểm tra nhanh khác (API-zym, API-NFT, API-RE, API 20E,…). Trong đó, hệ thống kiểm tra nhanh API 20E do phương pháp sử dụng Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 10 đơn giản và tiết kiệm được thời gian nên hiện nay đang được sử dụng phổ biến trong các phòng thí nghiệm (Nguyễn Thị Thu Hằng, 2005). Kozinska et al (2002) dùng bộ kít API 20E để định danh các chủng vi khuẩn Aeromonas như A. hydrophila, A. caviae và A. sobria, các chủng này được phân lập từ cá chép. Ngoài ra, Kara et al (2000) cũng định danh vi khuẩn A. hydrophila, A. caviae và A. sobria trên cá hồi. Ông cũng đã so sánh với kết quả định danh sinh hóa trên ống nghiệm và cho rằng hệ thống này có thể dùng để phân lập Aeromonas đối với các chủng A. hydrophila, A. caviae và A. sobria (trích dẫn của Nguyễn Thị Thu Hằng, 2005). Tuy nhiên, theo Buler (2004) phương pháp này chưa được tối ưu trong việc định danh vi khuẩn Aeromonas. Theo ông với loài vi khuẩn Aeromonas thì cần thêm một số chỉ tiêu như: aesculin, MR và salicin thì kết quả sẽ tương đối chính xác hơn. Ngoài hai phương pháp định danh vi khuẩn nêu trên, hiện nay có khá nhiều kỹ thuật phân tử được cải tiến và ứng dụng trong định danh nhóm Aeromonas. Phương pháp thường được sử dụng nhất là xác định kiểu ARN ribosom (ribotyning) hay xác định độ dài đa hình các đoạn giới hạn (Restriction Fragment Length Polymorphism-RFLP), phản ứng trùng hợp (PCR) 16S DNA ribosom, tính đa hình chiều dài những đoạn khuếch đại (Amplified Fragment Length Polymorphism- AFLP) và thể đa hình khuếch đại ngẫu nhiên (Random Amplified Polymorphic DNA-RAPD) (Laganowska et al, 2004, trích dẫn của Đặng Thị Hoàng Oanh, 2006). Gần đây nghiên cứu kỹ thuật multiplex-PCR (m-PCR) đang được phát triển và ứng dụng do đặc điểm phát hiện đồng thời nhiều loại mầm bệnh vi khuẩn khác nhau và tiết kiệm thời gian lẫn chi phí. Từ nghiên cứu của Wang et al (2003) phát hiện đặc tính của hai gen hemolysin (aerolysin và hemolysin) có khả năng gây bệnh của hai loài A. hydrophila và A. sorbia bằng phương pháp m-PCR. Năm 2007, Panangala et al đã công bố phương pháp m-PCR có thể xác định cùng lúc cả ba loài vi khuẩn gây bệnh trên cá, đó là Flavobacterium columnare (504bp), Edwardsiella ictaluri (407bp), và Aeromonas hydrophila (209bp). Điều này sẽ góp phần tăng khả năng phát hiện bệnh trên đối tượng thuỷ sản nhằm giảm thiệt hại tối thiểu cho người nuôi, đặc biệt là khi tốc độ tăng diện tích và mật độ nuôi ngày càng tăng nhanh thì sự gia tăng mầm bệnh cũng tăng nhanh theo tỉ lệ thuận. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 11 PHẦN 3 PHƯƠNG PHÁP NGHIÊN CỨU 3.1 Địa điểm và thời gian nghiên cứu  Địa điểm nghiên cứu: các phòng thí nghiệm Bộ môn Sinh học và Bệnh Thủy sản - Khoa Thủy sản - Trường Đại học Cần Thơ.  Thời gian thực hiện: từ tháng 01 đến tháng 05 năm 2008. 3.2 Vật liệu 3.2.1 Vật liệu nghiên cứu  Que cấy, bình xịt cồn, đèn cồn,  Đĩa petri, ống nghiệm,  Ống đong, lame, lamella,  Chai nấu môi trường, bình tam giác,  Cá từ, pipet, đầu cole, ống hút, găng tay,  Các vật liệu nghiên cứu khác, v.v…. 3.2.2 Thiết bị  Kính hiển vi,  Tủ sấy, tủ ấm, tủ lạnh, tủ cấy,  Bếp nấu môi trường, máy lắc, nồi thanh trùng,  Máy ly tâm, máy chu kỳ nhiệt, máy ủ nhiệt, máy so màu quang phổ,…  Cân điện tử, lò viba, bộ điện di….  Các thiết bị khác, v.v…. 3.2.3 Hóa chất, thuốc thử và môi trường để kiểm tra các chỉ tiêu hình thái, sinh lý và sinh hóa của vi khuẩn  Cồn 700, cồn 960.  Môi trường phục hồi và nuôi cấy vi khuẩn: tryptone soya agar (TSA; Merck), nutrient broth (NB; Merck) và Aeromonas agar (500ml agar + 1lọ ampicilin) (Oxoid).  Bộ kít API 20E (bộ test + thuốc thử: TDA, IND, VP) (BIO MÉRIEUX). Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 12 3.2.3.1 Môi trường và thuốc thử dùng thực hiện các phản ứng sinh hóa theo phương pháp truyền thống Môi trường  Các môi trường đường (glucose, arabinose, cellobilose, galactose, glycerol, lactose, manitol, salicin, sucrose, xylose, trehalose) (Merck) dùng để kiểm tra khả năng lên men của vi khuẩn.  Môi trường OF (Merck) dùng để kiểm tra khả năng oxi hóa và lên men của vi khuẩn.  Môi trường thạch muller hinton agar (MHA; Merck) dùng cho phản ứng O/129 để phân biệt 2 giống vi khuẩn Vibrio và Aeromonas.  Môi trường thạch simon citrate (Merck) dùng để kiểm tra khả năng sử dùng nguồn cacbon của vi khuẩn.  Môi trường thạch dưỡng (NA-nutrient agar; Merck) + 0,5% starch (Merck) dùng để kiểm tra khả năng thủy phân tinh bột.  Môi trường MR-VP (voges proskauer; Merck) dùng cho phản ứng VP.  Môi trường nutrient broth (NB; Merck) dùng kiểm tra khả năng sinh indole.  Môi trường decarboxylase (Himedia) + yeast extract (Merck) + 1% acid amin (arginine, lysine và ornithin) (Merck) dùng kiểm tra khả năng khử amino acid.  Môi trường 0,1% pepton (Himedia) + 0,2% KH2PO4 (Merck) + 0,0012% phenol red (Merck) + 0,1% glucose + 2% ure (Merck) dùng kiểm tra khả năng sử dụng urea của vi khuẩn.  Môi trường triple sugar iron (TSI; Merck) dùng kiểm tra khả năng sinh khí H2S của vi khuẩn.  Môi trường trypton broth (Merck) + 1% hay 3%,...NaCl (Merck) dùng kiểm tra khả năng chịu đựng ở các nồng độ muối. Thuốc thử  Dung dịch H2O2 3% cho phản ứng catalase.  Que thử Oxidase (Merck).  Đĩa ONPG (Ortho-nitrophenyl galactosidase; Merck).  Thuốc thử Kovac’s (Merck) cho phản ứng sinh indole.  Thuốc thử Lugol’s Iodine (cách pha được trình bày ở phần Phụ lục) cho khả năng thủy phân tinh bột (starch). Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 13  Thuốc thử cho phản ứng VP.  Các dung dịch nhuộm Gram. 3.2.4 Các hóa chất cần thiết cho phản ứng PCR  LB (10g tryptone, 5g yeast extract và 5g sodium chloride, trong 1L nước cất ).  TE (pH 8.0) gồm 10mM Tris HCl và 1mM EDTA.  Hóa chất dùng trong khuếch đại DNA: Bufer 10X, MgCl2, dNTPs (10mM), Taq polymerase (5u), mồi, nước cất 2 lần.  Dung dịch nạp mẫu 6X, ethidium bromide, agarose, dung dịch chạy diện di TAE (Tris HCl:acetate:EDTA). 3.2.5 Các chủng vi khuẩn Aeromonas hydrophila  Chủng chuẩn : 1chủng (LMG 2844- ngân hàng gen của Bỉ).  Chủng tham khảo: 7 chủng từ bộ sưu tập vi khuẩn của Khoa Thủy sản, Đại học Cần Thơ. Bảng 3.1: Các nguồn vi khuẩn Mã mới Mã cũ Nguồn gốc CAF 2 CAF23 CAF25 CAF131 CAF132 CAF133 CAF134 CAF135 A.hydrophila LMG 2844 V402 V425 60 Lei.1.10.99 BSL3172000 69 (Tam 2L) BSK Ngân hàng gen Bỉ CAF CAF CAF CAF CAF CAF CAF 3.3 Phương pháp nghiên cứu Các thao tác phải thực hiện trong điều kiện vô trùng. Phục hồi vi khuẩn: dùng que cấy lấy vi khuẩn cấy lên môi trường TSA. Đem ủ ở 28oC trong 18-24 giờ kiểm tra kết quả. Nuôi tăng sinh vi khuẩn: chọn một khuẩn lạc từ đĩa cấy thuần cho vào ống nghiệm chứa 5 ml NB đặt lên máy lắc 200 vòng/phút sau 18- 24 giờ. Kiểm tra kết quả. Mỗi chỉ tiêu kiểm tra sinh hóa được lặp lại 3 lần. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 14 3.3.1 Định danh vi khuẩn Aeromonas hydrophila bằng phương pháp truyền thống Các chỉ tiêu hình thái, sinh lý và sinh hóa: được chọn để định danh dựa theo hệ thống phân loại của Baumann et al (1984). Các đặc điểm sinh lý sinh hóa được xác định dựa theo cẩm nang Cowan và Steel (Barrow và Feltham, 1993) và phương pháp của West và Colwell (1984). Các chỉ tiêu về hình thái - Hình dạng và màu sắc của khuẩn lạc. - Khả năng di động của vi khuẩn. - Nhuộm gram để kiểm tra tính ròng của vi khuẩn. Các chỉ tiêu về sinh lý - Phản ứng oxidase. - Phản ứng catalase. - Khả năng phát triển của vi khuẩn ở 0%, 3%, 6%, 7% và 10% NaCl. Các chỉ tiêu về sinh hóa - Khả năng lên men và oxy hóa đường glucose. - Khả năng tạo acid từ các loại đường: glucose, arabinose, cellobilose, galactose, glycerol, lactose, manitol, salicin, sucrose, xylose, trehalose. - Khả năng sinh khí từ glucose và tạo H2S. - Khả năng thủy phân tinh bột. - Khả năng lên men β-galactosidase (ONPG). - Khả năng sử dụng citrate. - Khả năng sinh indole. - Phản ứng VP (voges- proskauer). - Khả năng sử dụng amino acid: arginine, lysine và ornithine. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 15 3.3.2 Định danh vi khuẩn bằng bộ kít API 20E Kiểm tra các các phản ứng sinh lý và sinh hóa của A. hydrophila sử dụng bộ kít API 20E của hãng BIO MÉRIEUX. Các chỉ tiêu cơ bản (hình dạng, khả năng di động, osidase, catalase và phản ứng O/F) được thực hiện trước khi sử dụng bộ kít API 20E. Phương pháp thực hiện  Cho một ít nước vào khay nhựa của bộ kít để giữ ẩm trong quá trình ủ trong tủ ấm.  Dùng que cấy tiệt trùng lấy một ít khuẩn lạc cho vào 5ml nước muối sinh lý tiệt trùng, lắc đều.  Dùng pipet với đầu cole tiệt trùng hút dung dịch vi khuẩn cho vào mỗi ô của bộ test.  Nhỏ dung dịch vi khuẩn vừa đủ vào tất cả các ô ngoại trừ 3 ô CIT, VP và GEL thì nhỏ đầy và 5 ô ADH, LDC, ODC, H2S và URE cho paraffin tiệt trùng vào.  Ủ trong tủ ấm ở 280C và đọc kết quả sau 24 giờ. Đọc kết quả TDA: Nhỏ một giọt thuốc thử TDA. Một màu đen xuất hiện cho phản ứng dương (+), màu vàng cho phản ứng âm (-). IND: Nhỏ một giọt thuốc thử IND. Đợi 2 phút. Một vòng màu đỏ xuất hiện cho phản ứng dương (+), màu vàng cho phản ứng âm (-). VP: Thêm một giọt mỗi dung dịch thuốc thử VP1, VP2. Đợi ít nhất 10 phút, màu hồng hoặc màu đỏ xuất hiện cho phản ứng dương (+). Nếu màu hồng nhạt xuất hiện trong vòng 10-12 phút, được coi là phản ứng âm (-). Các chỉ tiêu còn lại không cần sử dụng thuốc thử thì đọc kết quả dựa vào bảng bên dưới (Bảng 3.2). Sau khi cho thuốc thử vào không nên đem ủ trở lại trong tủ ấm. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 16 Bảng 3.2: Bảng đọc kết quả bộ kit API 20E Chỉ tiêu Âm tính Dương tính ONPG Không màu Vàng ADH Vàng Đỏ/cam LDC Vàng Đỏ/Cam ODC Vàng Đỏ/Cam CIT Vàng Xanh/xanh lá H2S Không màu Đen URE Vàng Đỏ/cam TDA Vàng Nâu sậm IND Vàng Đỏ (2 phút) VP Không màu Hồng/đỏ (10 phút) GEL Không màu (còn kết tủa đen) Đen GLU Xanh/xanh lá Vàng MAN Xanh/xanh lá Vàng INO Xanh/xanh lá Vàng SOR Xanh/xanh lá Vàng RHA Xanh/xanh lá Vàng SAC Xanh/xanh lá Vàng MEL Xanh/xan lá Vàng AMY Xanh/xanh lá Vàng ARA Xanh/xanh lá Vàng Ghi chú: ONPG: ortho-nitrophenyl galactosidase; ADH: arginine dihydrolase; LDC: lysine decarboxylase; ODC: ornithine decarboxylase; CIT: citrate; H2S: sinh H2S; Urea: ure; TDA: tryptophane deaminase; IND: indole; VP: phản ứng Voges- Proskauer; GEL: gelatin; GLU: glucose; MAN: mannitol; INO: inositol; SOR: sorbitol; RHA: rhamnose; SAC: sucrose; MEL: melibiose; AMY: amygdaline; ARA: arabinnose. Mỗi chủng vi khuẩn được lặp lại ba lần. 3.3.3 Phát hiện vi khuẩn bằng phương pháp PCR Chiết tách acid nucleic (Bartie et al, 2006)  Nuôi tăng sinh vi khuẩn (16-18 giờ) trong 5ml LB.  Rút 1,5ml dung dịch vi khuẩn và 100µl TE (10mM Tris HCl và 1mM EDTA) vào ống eppendorf.  Đun ở 950C trong vòng 15 phút.  Làm lạnh trong nước đá. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 17  Ly tâm 14000 vòng/phút trong 2 phút. Rút phần dung dịch cho vào ống eppendorf mới (trữ ở -20 ºC nếu chưa sử dụng). Đo hàm lượng DNA (OD=260nm). Khuyếch đại DNA (theo Panangala et al (2007) có chỉnh sửa) Thành phần cho phản ứng Mồi sử dụng cho phản ứng gen Aerolysin AeroFd CCAAGGGGTCTGTGGCGACA AeroRs TTTCACCGGTAACAGGATTG Bảng 3.3: Thành phần 25µl tham gia 1 phản ứng PCR STT Thành phần tham gia phản ứng Hàm lượng 1 PCR Buffer 10 X 2 MgCl2 1.5 mM 3 dNTPs 200 µM 4 Taq DNA polymerase 5 U 5 Đoạn mồi (AeroFd) 0.5 µM 6 Đoạn mồi (AeroRs) 0.5 µM 7 Mạch khuôn 20 ng 8 Nước cất - Chu kỳ nhiệt (Hình 3.1) Làm biến tính DNA ở 95oC trong 4 phút. Lặp lại chu kỳ 30 lần: Giai đoạn biến tính ở 950C trong 30 giây, giai đoạn gắn mồi 520C trong 45 giây, giai đoạn kéo dài chuỗi 720C trong 30 giây. Tổng hợp cuối ở 72oC trong 7 phút. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 18 30 chu kỳ 95 0C 95 0C 4’:00 0’:30 72 0C 72 0C 0’:30 7’:00 52 0C (0’:45) Hình 3.1. Chu kỳ nhiệt của phản ứng PCR theo quy trình Panangala et al (2007) có chỉnh sửa. Kỹ thuật điện di  Dùng dòng điện một chiều, quá trình điện di được thực hiện với dung dịch TAE 0,5X và bản thạch (gel) chứa 1,5% agarose.  Đun nóng dung dịch agarose tan hoàn toàn. Sau đó để du g dịch nguội khoảng 50-600C cho ethium bromide vào và đổ agarose vào khay. Thể tích gel tùy thuộc vào kích cỡ của khay đựng gel. Độ dày của gel chỉ cần cao hơn đáy của lược gel khoảng 0,3-0,5 cm và bề dày gel không quá 0,8cm. Cho gel vào bồn điện di. Thêm dung dịch điện di cho vừa bao phủ gel.  Dùng pipette hút 10µl lần lượt cho thang DNA, đối chứng âm (nước cất) và mẫu cần phân tích trộn với một giọt 6X dung dịch nạp mẫu vào từng giếng một. Sử dụng thang DNA để xác định khối lượng phân tử của sản phẩm PCR. Sử dụng dòng điện từ 80-120V. Ngừng điện di khi màu xanh đậm di chuyển khoảng 1/2 đến 2/3 gel (trong khoảng từ 40-50 phút) Đọc kết quả  Đặt gel lên bàn UV để đọc kết quả.  Kết quả điện di được ghi nhận bằng máy đọc gel Vilber Lourmat.  Căn cứ vào thang DNA 1kb plus (Invitrogen) để xác định trọng lượng phân tử.  Mẫu hiện vạch 209bp là mẫu dương tính với Aeromonas hydrophila Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 19 PHẦN 4 KẾT QUẢ VÀ THẢO LUẬN 4.1 Kết quả Các chủng vi khuẩn Aeromonas hydrophila trong đề tài (1 chủng chuẩn và 7 chủng tham khảo) sau khi phục hồi từ tủ âm 800C của Khoa Thuỷ sản – Trường Đại học Cần Thơ, kiểm tra tính ròng qua kết quả nhuộm gram, các chỉ tiêu cơ bản gồm hình dạng, khả năng di động, oxidase, catalase và và phản ứng O/F cho cả hai phương pháp định danh (truyền thống và API 20E). 4.1.1 Đặc điểm hình thái, sinh lý và sinh hóa của các chủng vi khuẩn A. hydrophila xác định bằng phương pháp sinh hóa truyền thống Kiểm tra các đặc điểm sinh lý sinh hóa được xác định dựa theo cẩm nang Cowan và Steel (Barrow và Feltham, 1993) và phương pháp của West và Colwell (1984). Mỗi chỉ tiêu được lặp lại 3 lần, kết quả được ghi nhận là kết quả có ít nhất 2 lần lặp lại. Đặc điểm hình thái, sinh lý và sinh hoá của các chủng vi khuẩn A. hydrophila trong đề tài được trình bày ở Bảng 4.1. Bảng 4.1 Đặc điểm hình thái, sinh lý và sinh hoá của chủng vi khuẩn chuẩn và 7 chủng tham khảo VI KHUẨN CHỈ TIÊU CAF2 Chủng chuẩn CAF 23 CAF 25 CAF 131 CAF 132 CAF 133 CAF 134 CAF 135 Gram - - - - - - - - Hình dạng Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Sinh sắc tố - - - - - - - - Di động + + + + + + + + Catalase + + + + + + + + Oxidase - - - - - - - - Phản ứng lên men yếm khí + + + + + + + + Phản ứng lên men hiếu khí + + + + + + + + Arginine + - - + + + + + Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 20 Ghi chú: (+): Phản ứng dương tính, (-): Phản ứng âm tính Theo bảng kết quả test các chỉ tiêu sinh hoá (Bảng 4.1), các dòng vi khuẩn A. hydrophila đều là vi khuẩn gram âm, hình que ngắn (Hình 4.1), di động, catalase dương tính, oxidase âm tính và có khuẩn lạc dạng tròn, nhẵn (Hình 4.2). Vi khuẩn A. hydrophila có khuẩn lạc dạng tròn, hơi lồi, nhẵn và màu vàng nhạt khi phát Lysine + + + + + + + + Ornithine + + + + + + + + H2S - - - - - - - - Urease - - - + + - + - VP + + + + + + + + Citrate + + + + + + + + Indole + + + + + + + + Starch + + + + + + + + O/129 - - - - - - - - ONPG + + + + + + + + 0% NaCl + + + + + + + + 3% NaCl + + + + + + + + 6% NaCl + + + + + + + + 7% NaCl - - - - - - - - 10% NaCl - - - - - - - - Gas glucose + + + + + + + + Glucose + + + + + + + + Arabinose + + + + + + + + Cellobiose + + + + + + + + Galactose + + + + + + + + Mannitol + + + + + + + + Salicin + + - + + + + + Sucrose + + + + + + + + Xylose + + + + + + + + Glycerol + + + + + + + + Trehalose + + + + + + + + Lactose + + + + + + + + Aeromonas agar Klạc vàng Klạc vàng Klạc xanh Klạc vàng Klạc vàng Klạc vàng Klạc vàng Klạc vàng Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 21 triển trên môi trường Aeromonas agar (Hình 4.3). Đồng thời, vi khuẩn A. hydrophila cũng vừa có khả năng lên men yếm khí vừa có khả năng lên men hiếu khí. Ngoài ra, đặc tính phân bố rộng muối của loài vi khuẩn này được thể hiện ở khả năng phát triển được ở các nồng độ muối 0-6%. Hình 4.1 Hình dạng A. hydrophila (100X) Hình 4.2 A. hydrophila trên môi trường TSA Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 22 Hình 4.3 A. hydrophila trên môi trường Aeromonas agar Aeromonas hydrophila trong đề tài hầu như đều sử dụng citrate (Hình 4.4), có khả năng lên men β-galactosidase và dịch hóa được amylase. Tuy nhiên, chúng không có khả năng sử dụng ure. Ngoài ra, chúng còn có khả năng lên men nhiều loại đường (glucose, mannitol, sucrose, lactose,….), sinh gas từ glucose nhưng lại không sinh khí H2S. Bên cạnh đó, chúng có khả năng sinh indole (Hình 4.6) và cho phản ứng dương tính với VP (Hình 4.5), arginine, lysin và cả ornithin. Hình 4.4 Phản ứng citrate (+) Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 23 Hình 4.5 Phản ứng VP (+) Hình 4.6 Phản ứng indole (+) So với chủng chuẩn, chủng CAF23 và CAF25 sai khác ở chỉ tiêu arginine (-), chủng CAF25 là chủng duy nhất sai khác là đường salicin (-) và biểu hiện màu khuẩn lạc cũng như làm thay đổi môi trường Aeromonas agar (xanh). Còn 3 chủng CAF131, CAF132 và CAF134 có sự dao động là chỉ tiêu ure (+). Các dòng còn lại đều có kết quả định danh giống với dòng chuẩn. 4.1.2 Kiểm tra kết quả định danh vi khuẩn A. hydrophila theo bộ kít API 20E Cùng với việc kiểm tra các đặc điểm sinh lý, sinh hóa bằng phương pháp truyền thống của A. hydrophila phương pháp sử dụng bộ kít API 20E cũng được áp dụng đồng thời nhằm so sánh kết quả giữa 2 phương pháp này. Kết quả kiểm tra các chỉ tiêu cơ bản giống với kết quả ở phương pháp truyền thống (Bảng 4.1) và kết quả API 20E được thể hiện ở Bảng 4.2. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 24 Bảng 4.2 Kết quả kiểm tra bằng bộ kít API 20E chủng chuẩn và 7 chủng tham khảo VI KHUẨN CHỈ TIÊU CAF2 Chủng chuẩn CAF 23 CAF 25 CAF 131 CAF 132 CAF 133 CAF 134 CAF 135 Gram - - - - - - - - Hình dạng Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Sinh sắc tố - - - - - - - - Di động + + + + + + + + Catalase + + + + + + + + Oxidase - - - - - - - - Phản ứng lên men yếm khí + + + + + + + + Phản ứng lên men hiếu khí + + + + + + + + ONPG + + + + + + + + ADH - - + - - - - - LCD + + - + + + + + OCD - - + - - - - - CIT + + + + + + + + H2S - - - - - - - - URE - - - + + - + - TDA - - - - - - - - IND + + + + + + + + VP + + + + + + + + GEL - - - - - - - - GLU + + + + + + + + MAN + + + + + + + + INO + + - + + + + + SOR + + + + + + + + RHA + + + + + + + + SAC + + + + + + + + MEL + + + + + + + + AMY + + + + + + + + ARA + + + + + + + + Ghi chú: (+): Phản ứng dương tính, (-): Phản ứng âm tính ONPG: ortho-nitrophenyl galactosidase; ADH: arginine dihydrolase; LDC: lysine decarboxylase; ODC: ornithine decarboxylase; CIT: citrate; H2S: sinh H2S; Urea: ure; TDA: tryptophane deaminase; IND: indole; VP: phản ứng Voges- Proskauer; GEL: gelatin; GLU: glucose; MAN: mannitol; INO: inositol; SOR: sorbitol; RHA: rhamnose; SAC: sucrose; MEL: melibiose; AMY: amygdaline; ARA: arabinnose. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 25 Dựa trên kết quả định danh API 20E (Bảng 4.2), tất cả các chủng kiểm tra đều không có khả năng thủy phân gelatin nhưng lại có khả năng tạo men β- galactosidase (ONPG). Chúng còn cho phản ứng dương tính với citrate và VP. Ngoài ra, chúng cũng có khả năng sinh indole nhưng lại không sinh H2S và cho phản ứng âm tính với tryptophane. Đặc biệt, tất cả các kết quả lên men các loại đường (glucose, manitol, sorbitol, rhamnose,…) đều cho kết quả dương tính. Các chủng vi khuẩn trên hầu như có đặc điểm sinh hóa trong kết quả kiểm tra API 20E là giống nhau. Ngoại trừ, có chủng CAF 25 biến động nhiều nhất 4 chỉ tiêu so với chủng chuẩn (ADH, LCD, OCD và INO). Bên cạnh đó, có 3 chủng (CAF131, CAF 132 và CAF 134) cho phản ứng dương với chỉ tiêu URE ngược với chủng chuẩn là âm tính. Các chủng còn lại (CAF 23, CAF 133 và CAF 135) cho kết quả kiểm tra ở tất cả các chỉ tiêu đều trùng với chủng chuẩn (Hình 4.7 ). (a) (b) Hình 4.7 Kết quả định danh API 20E của dòng CAF2 (a) và dòng CAF25 (b) Ghi chú: (+): Phản ứng dương tính, (-): Phản ứng âm tính 1: Ortho-nitrophenyl galactosidase (+); 2: Arginine dihydrolase((a): (-); (b): (+)); 3: Lysine decarboxylase ((a): (+); (b): (-)); 4: Ornithine decarboxylase ((a): (-); (b): (+)); 5: Citrate (+); 6: Sinh H2S (-); 7: Ure (-); 8: Tryptophane deaminase (-); 9: Indole (+); 10: Phản ứng Voges- Proskauer (+); 11: Gelatin (-); 12: Glucose (+); 13: Mannitol (+); 14: Inositol ((a): (+); (b): (-)); 15: Sorbitol (+); 16: Rhamnose (+); 17: Sucrose (+); 18: Melibiose (+); 19: Amygdaline (+); 20: Arabinnose (+). 4.1.3 Kết quả kiểm tra bằng phương pháp PCR Sử dụng phương pháp PCR cho 5 chủng nghiên cứu (CAF2, CAF 25, CAF 131, CAF 133 và CAF 134) nhưng sản phẩm không đặc hiệu cho A. hydrophila (không 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 26 hiện vạch ở 209bp) hoặc không có sản phẩm (Hình 4.8). Hai chủng CAF 2 (chủng chuẩn; giếng 5) và chủng CAF 25 (giếng 6) cho sản phẩm không đặc hiệu. Các chủng còn lại không có sản phẩm (giếng 1, 2 và 3). Ghi chú: Giếng M: thang đo DNA 1kb plus (Invitrogen) Giếng 1: Đối chứng âm (nước cất) Giếng 2: CAF 131 Giếng 3: CAF 133 Giếng 4: CAF 134 Giếng 5: CAF 2 Giếng 6: CAF 25 Hình 4.8 Kết quả điện di 5 chủng A. hydrophila 4.2 Thảo luận Qua quá trình kiểm tra vi khuẩn A. hydrophila bằng phương pháp định danh truyền thống (36 chỉ tiêu) và API 20E (28 chỉ tiêu), các chỉ tiêu dùng kiểm tra A. hydrophila ở 2 phương pháp giống nhau. Tuy nhiên, một số chỉ tiêu (GEL, MEL, SOR, RHA và AMY) có trên bộ kit API 20E do điều kiện không cho phép nên không thực hiện trong phương pháp truyền thống. Bên cạnh kết quả các chỉ tiêu giống hay khác với các nghiên cứu trước đây thì chỉ tiêu khác quan trọng nhất là chỉ tiêu cơ bản oxidase cho kết quả âm tính. Kết quả này có thể là do vi khuẩn trữ quá lâu trong tủ -800C làm vi khuẩn trở nên biến 200 bp 100 bp M 1 2 3 4 5 6 Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 27 tính hoặc quá yếu để cho phản ứng dương tính với oxidase. Kết quả ở hầu hết các chủng vi khuẩn đều thể hiện giống nhau chỉ sai khác một vài chỉ tiêu so với chủng chuẩn ở một số chủng. Chẳng hạn như dòng CAF 23 và CAF 25 có kết quả kiểm tra theo phương pháp truyền thống là arginine âm tính, trong khi đó dòng chuẩn CAF 2 (LMG 2844) lại cho kết quả dương tính. Theo ghi nhận của Abbott et al (2003), A. hydrophila có 25/25 dòng kiểm tra có khả năng phân giải arginine. Cùng với phương pháp định danh truyền thống trong nghiên cứu của Đặng Thị Hoàng Oanh (2006), Nguyễn Thị Thu Hằng (2005) và Nguyễn Tấn Đạt (2002) cũng cho phản ứng dương tính với chỉ tiêu arginine. Ngoài ra, trong quá trình kiểm tra cũng có 3 chủng (CAF 131, CAF 132 và CAF 134) khác biệt khả năng sử dụng urea khác với dòng chuẩn cũng như với các dòng khác là cho kết quả dương tính ở cả hai phương pháp. Theo các tài liệu nghiên cứu trước đây của Đặng Thị Hoàng Oanh (2006), Nielsen et al (2001), Autin và Autin (1993), thì A. hydrophila không có khả năng sử dụng urea. Mặt khác, đối với phương pháp truyền thống ở chỉ tiêu lactose, xylose và ornithine đều dương tính ở tất cả các chủng nghiên cứu, điều này khác với các nghiên cứu trước đây của Đặng Thị Hoàng Oanh (2006), Buller (2004) và nhiều tác giả khác. Trong khi đó, các chủng sử dụng trong đề tài của Đoàn Nhật Phương (2001) lại cho rằng A. hydrophila có khả năng lên men đường lactose và xylose. Ngoài ra, trong ghi nhận của Nguyễn Tấn Đạt (2002) thì loài vi khuẩn này có phản ứng dương tính với chỉ tiêu ornithine. Sự khác biệt được nêu trên có thể phụ thuộc vào nhiều yếu tố. Có thể là do mỗi tác giả sử dụng cách lưu trữ các chủng chuẩn cũng như các chủng tham khảo khác nhau. Ngoài ra, loài vi khuẩn ở những vùng địa lí khác nhau và nguồn cung cấp, sử dụng hóa chất cho các chỉ tiêu phản ứng khác nhau hoặc tùy thuộc vào người thực hiện nên từ đó thể hiện kết quả khác nhau. Các hóa chất sử dụng trong đề tài này đa số đều là từ hãng Merck cung cấp, còn một số đề tài trước đây (Nguyễn Tấn Đạt (2002), Đoàn Nhật Phương (2001),…) không ghi nhận được nguồn gốc hóa chất nên đây có thể là trong những nguyên nhân kết quả khác biệt. Thật vậy, khi sử dụng hóa chất không đảm bảo (về chất lượng, về hạn sử dụng,…) cũng sẽ ảnh hưởng ít nhiều đến kết quả định danh vi khuẩn. Các chỉ tiêu khi sử dụng các phương pháp khác nhau để định danh đã được Buler (2004) cho rằng sai khác kết quả là do áp dụng phương pháp khác nhau hoặc do sai sót trong quá trình định danh. Các kết quả giữa các dòng A. hydrophila ghi Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 28 nhận ở 2 phương pháp chỉ khác nhau ở một số chỉ tiêu của phản ứng decarboxylase. Chỉ tiêu khác biệt giữa hầu hết các dòng vi khuẩn là ornithin và arginine, trong phương pháp truyền thống cho kết quả dương tính (+), còn ở phương pháp API 20E lại cho kết quả âm tính (-) (Hình 4.2a). Tuy nhiên, kết quả của ornithin từ API 20E và kết quả của arginine từ phương pháp truyền thống lại giống với kết quả của Abbott et al (2003). Điều này có thể giải thích, các chỉ tiêu cho phản ứng trong phương pháp truyền thống là do tự pha chế, còn API 20E là bộ kít có sẵn và được nghiên cứu điều kiện thích hợp cho phản ứng mà nhà sản xuất yêu cầu là 30-370C còn thực hiện trong phòng thí nghiệm là 280C, vì thế sự khác nhau có thể chấp nhận được (Popovic et al, 2007). Như vậy khi sử dụng hai phương pháp truyền thống và API 20E trong cùng điều kiện phòng thí nghiệm ở nghiên cứu này so sánh các chỉ tiêu giống nhau thì thể hiện kết quả gần như là giống nhau. Chỉ có sự khác nhau là hai chỉ tiêu arginine và ornithine của phản ứng decarboxylase. Mặc dù ở một vài chỉ tiêu chưa đúng với đặc tính của A. hydrophila cũng như khác hẳn với rất nhiều nghiên cứu trước nhưng kết quả của hai phương pháp này đều thể hiện kết quả như nhau. Điều đó cho thấy ít có sự sai khác giữa hai phương pháp trên. Sau khi kiểm tra kết quả định danh bằng PCR, kết quả không có sản phẩm đặc hiệu hiện ở vạch 209bp. Mặc dù kết quả chưa rõ ràng nhưng cũng không thể nói rằng các chủng nghiên cứu không phải là A. hydrophila. Có thể là do điều kiện cho phản ứng PCR chưa phù hợp trong việc phát hiện A. hydrophila ở điều kiện phòng thí nghiệm hiện tại hoặc do các yếu tố khác như nhiệt độ gắn mồi, thành phần phản ứng PCR chưa phù hợp,…. Ngoài ra, trong nghiên cứu Nielsen et al (2001) về xác định loài A. hydrophila phân lập trên cá chình bệnh ở Trung Quốc cũng có xảy ra hiện tượng một số dòng vi khuẩn có chỉ tiêu cellobiose dương tính lại không cho kết quả PCR dương tính. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 29 PHẦN 5 KẾT LUẬN VÀ ĐỀ XUẤT 5.1 Kết luận - Đã kiểm tra các chỉ tiêu hình thái, sinh lý và sinh hoá 8 chủng A. hydrophila bằng phương pháp truyền thống và sử dụng bộ kít API 20E. Hai phương pháp thể hiện kết quả giống nhau ở hầu hết các chỉ tiêu trừ chỉ tiêu arginine và ornithine. - Các chủng nghiên cứu qua kiểm tra bằng phương pháp PCR chưa cho sản phẩm đặc hiệu. - Các chủng tham khảo tuy có một số chỉ tiêu khác với chủng chuẩn (CAF 2) nhưng có thể sử dụng làm chủng tham khảo, bao gồm các chủng CAF 23, CAF 131, CAF 132, CAF 133, CAF 134 và CAF 135. 5.2 Đề xuất - Cần so sánh thêm nhiều chủng chuẩn và chủng tham khảo A. hydrophila để có kết quả chính xác hơn. - Tối ưu phương pháp PCR để có sản phẩm PCR đặc hiệu với mồi. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 30 TÀI LIỆU THAM KHẢO 1. Abbott, S.L., W.K.W. Cheung and J.M. Janda. 2003. The Genus Aeromonas: Biochemical Characteristics, Atypical Reactions, and Phenotypic Identification Schemes. Journal of Clinical Microbiology, p. 2348-2357, Vol. 41, No. 6. 2. Austin, B. and D.A. Austin. 1993. Bacterial fish pathogens: Disease in farmed and wild fish, 2nd edn. Ellis Horwood Ltd., Chichester. 384 pp. 3. Bartie, K., Đ. T. H. Oanh, G. Huy, C. Dickson, M. Cnockaert, J. Swings, N. T. Phương, A. Teale. 2006. Ứng dụng REP-PCR và PFGE để định dạng vi khuẩn kháng chloramphenicol. Tạp chí Công nghệ sinh học 4 (1): p31- 40. 4. Bộ môn Sinh học và Bệnh Thủy sản - Khoa Thủy sản, Trường Đại học Cần Thơ, 2007. Tài liệu hướng dẫn thực tập giáo trình chuyên môn bệnh học thủy sản. 63 trang. 5. Bùi Quang Tề và Phạm Thị Yên. 2002. Báo cáo về bệnh cá sông nuôi lồng ở Vịnh Hạ Long. 6. Bùi Quang Tề. 2003. Bệnh của tôm nuôi và biện pháp phòng trị. Nhà xuất bản Nông nghiệp Hà Nội. 112 trang 7. Barrow, G. I. and R. K. A. Feltham. 1993. Cowan and Steel ‘s manual for the indentification of medical bacteria, 3rd edn. Cambridge Univesity Press, Cambridge. 262 pp. 8. Baumann, P. A. L. Furnss and J. V. Lee. 1984. Genus 1 Vibrio pacini 1854, 411 al. 518-538 pp. In: Krieig, N. R. and J. G. Holt (eds). Bergeyf’s manual of systematic bacteriology, Volume1. William and Wilkin Baltimore. 9. Buller, N. B. .2004. Bacteria from fish and other aquatic animal: A practical indentification manual. CABI publishing. 353 pp. 10. Chowdhury, Md.B.R, 1998. Bacteria in fish disease in Bangladesh. department of aquaculture, Facculy of Fisheries. Bangladesh Agriculture Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 31 University, Mymensingh, 2002, Bangladesh. 247 pp. 11. Chu, W. H. and C-P Lu. 2005. Multiplex PCR assay for the detection of pathogenic Aeromonas hydrophila. Journal of Fish Diseases. Volume 28 Issue 7: 437-441. 12. Cipriano, R. C., G. L. Bullock and S. W. Pyle. 2001. Aeromonas hydrophila and motile Aeromonad septicemias of fish. Revision of Fish Disease Leaflet 68 (1984). 13. Đặng Thị Hoàng Oanh. 2006. Đặc điểm sinh hóa và kiểu ARN ribosom của vi khuẩn Aeromonas phân lập từ bệnh phẩm thủy sản nuôi ở Đồng bằng sông Cửu Long. Tạp chí khoa học 2006: 85-94. 14. Đặng Thị Hoàng Oanh, Đoàn Nhật Phương, Nguyễn Thị Thu Hằng và Nguyễn Thanh Phương. 2006. Xác định vị trí phân loại và khả năng kháng thuốc kháng sinh của vi khuẩn Vibrio phát sáng phân lập từ hậu ấu trùng tôm sú (Penaeus monodon). Tạp chí khoa học 4/2006: 42-52. 300 trang. 15. Đặng Thị Hoàng Oanh, Nguyễn Thị Thu Hằng và Nguyễn Thanh Phương. 2006. Sưu tập và phân lập vi khuẩn từ mẫu thủy sản nuôi ở Đồng bằng sông Cửu Long. Tạp chí khoa học 4/2006 (2): 53-61. 300 trang. 16. Đoàn Nhật Phương. 2001. Xác định LD50 và thử nghiệm vaccine phòng bệnh vi khuẩn (Aeromonas hydrophila) trên cá chép (Cyprinus carpio) (LVTN). Khoa Thuỷ sản – Trường Đại học Cần Thơ. 29 trang 17. Đỗ Thị Hòa, Bùi Quang Tề, Nguyễn Hữu Dũng và Nguyễn Thị Muội. 2004. Bệnh học thủy sản Nha Trang. 423 trang. 18. Ferguson, H.W, J. F. Turnbull, A Shinn, K.Thomson, T. T. Dung and M.Crumlish. 2001. Bacillary necrosis in farmed Pangasius hypophthalmus (Sauvage) from the Mekong delta, VietNam. Journal of fish disease 2001, 24: 509-513pp. 19. Frerichs, G. N. and S. D. Millar. 1993. Mannual for the isolate and indentification of fish bacterial pathogens. Institute of aquaculture, University of Stirling, Scotland. 107pp. 20. Inglis, V., R. J. Roberts and N. R. Bromage. 1993. Bacterial diseases of fish. Institute of aquaculture, Univesity Press, Cambridge. 312 pp. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 32 21. Kozinska, A., M. J. Figueras, M. R. Chacon and L. Soler. 2002. Phenotypic characteristics and pathogenicity of Aeromonas genomospecies isolate from common carp. In: Journal of applied microbiology 2002, 93: 1034-1041 pp. 22. Nielsen, M. E., L. Høi, A. S. Schmidt, D. Qian, T. Shimada, J. Y. Shen, J. L. Larsen. 2001. Is Aeromonas hydrophila the dominant motile Aeromonas species that causes disease outbreaks in aquaculture production in the Zhejiang Province of China? Diseases of aquatic oraganism. Vol.46: 23- 29. 23. Ngô Minh Dung. 2007. Nghiên cứu khả năng gây bệnh của vi khuẩn Edwardsiella ictaluri và Aeromonas hydrophila trên cá tra (LVTN). Khoa Thuỷ Sản-Trường Đại học Cần Thơ. 47 trang. 24. Nguyễn Chính. 2005. Đánh giá tình hình sử dụng thuốc thú y thủy sản trong nuôi cá tra (Pangasius hypophthalmus Sauvage, 1878) thâm canh ở An Giang và Cần Thơ (LVCH). Khoa Thuỷ sản – Trường Đại học Cần Thơ. 80 trang. 25. Nguyễn Tấn Đạt. 2002. Khảo sát bệnh ký sinh trùng và vi khuẩn trên tôm càng xanh nuôi trong ao và ruộng lúa mật độ thấp (LVTN). Khoa Thuỷ sản – Trường Đại học Cần Thơ. 24 trang 26. Nguyễn Thành Tâm. 2006. Khảo sát các mầm bệnh trên cá rô đồng (Anabas rtestudineus) bị bệnh xù vảy (LVTN). Khoa Thuỷ sản – Trường Đại học Cần Thơ. 39 trang. 27. Nguyễn Thị Như Ngọc. 1997. Xác định tác nhân vi khuẩn gây bệnh tuột nhớt trên cá bống tượng (LVTN). Khoa Thuỷ sản – Trường Đại học Cần Thơ. 54 trang. 28. Nguyễn Thị Thu Hằng. 2005. Sưu tầm và thiết lập hệ thống lưu trữ các loài vi khuẩn phân lập trên tôm cá tại Khoa Thuỷ sản – Trường Đại học Cần Thơ. Báo cáo khoa học (đề tài cấp trường). Trường Đại học Cần Thơ. 24 trang. 29. Panangala, V.S., C.A Shoemaker, V.L. Van Santan, K. Dybvig., P. H. Klesius. 2007. Multiplex-PCR for simultaneous detection of three fish- pathogenic bacteria, Edwardsiella ictaluri, Flavobacterium columnare and Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 33 Aeromonas hydrophila. Diseases of aquatic organisms 74: 199-208. 30. Popovic, N. T., R.Coz-Rakovac and I. Strunjak-Perovic. 2007. Commercial phenotypic tests (API 20E) in diagnosis of fish bacteria: a review. Veterinarni medicina, 52, 2007 (2): 49–53. 31. Sở Thủy sản An Giang. Báo cáo dịch bệnh 9 tháng đầu năm 2007. 32. Trần Thị Tuyết Hoa, Nguyễn Thị Thu Hằng, Đặng Thị Hoàng Oanh và Nguyễn Thanh Phương. 2004. Thành phần loài và khả năng gây bệnh của nhóm vi khuẩn Vibrio phân lập từ hệ thống ương tôm càng xanh (Macrobranchium rosenbergii). Tạp chí khoa học. Đại học Cần Thơ, 2004: p153-164. 373 trang. 33. Triệu Thanh Tuấn. 2006. Khảo sát mối quan hệ giữa kiểu gen của White spots syndrome (WSSV) với bệnh đốm trắng trên tôm Sú (Penaeus monodon) nuôi tại Bạc Liêu và Cà Mau (LVTN). Khoa Thuỷ sản – Trường Đại học Cần Thơ. 45 trang. 34. Từ Thanh Dung, M.Crumlish, Nguyễn Thị Như Ngọc, Nguyễn Quốc Thịnh và Đặng Thụy Mai Thy. 2004. Xác định vi khuẩn gây bệnh trắng gan trên cá tra (Pangasius hypophthalmus). Tạp chí khoa học. Đại học Cần Thơ, 2004: 137-142. 373 trang. 35. Từ Thanh Dung, Đặng Thị Hoàng Oanh và Trần Thị Tuyết Hoa. 2005. Giáo trình Bệnh học thủy sản.151 trang. 36. Từ Thanh Dung. 2006. Bài giảng Bệnh vi khuẩn trên động vật thủy sản. 37 trang. 37. Vila, J, F. Marco, L. Soler, M. Chacon and M. J Figuera. 2002. In vitro antimicrobial susceptibility of clinical isolate of Aeromonas caviae, A. hydrophila and Aeromonas veronii biotype sorbia. Journal of Antimicrobial Chemmotherapy 49: 697-702. 38. Wang, G., C. G. Clark, C. Liu, C. Pucknell, C. K. Munro, T. M. A. C. Kruk, R. C. D. L. Woodward, and F. G. Rodgers. 2003. Detection and characterization of the hemolysin genes in Aeromonas hydrophila and Aeromonas sobria by Multiplex PCR. Journal of Clinical Microbiology, Vol. 41, No. 3: 1048-1054pp. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 34 39. West, P. A. and R. R. Colwell. 1984. Indentification and classification of Vibrionaceae- an overview. Pp 285-363 in: R. R. Colwell (edn). Vibrio in environment. Jonh Wiley and Sons, New York. 40. Horneman, A. and J. G. Morris. 2007. Up to date Aeromonas infections. Cập nhật trên ngày 28/12/2007. 41. Kim ngạch xuất khẩu thủy sản năm 2007 đạt 3,75 tỉ USD. Trích báo cáo của Bộ nông nghiệp và phát triển nông thôn. Cập nhật: 02/01/2008. 42. Phan Anh. 75 tấn cá chết ở tỉnh Đồng Tháp. ngày 09/01/2006. Cập nhật ngày 22/01/2008. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 35 Phụ lục: Các chỉ tiêu test sinh lý và sinh hóa Quan sát tính di động Sự di động của vi khuẩn có thể quan sát bằng phương pháp giọt treo ở vật kính 40X. Các bước thực hiện như sau: - Cho vaseline lên 4 góc của lamelle và đặt ngửa lame trên bàn. - Dùng que cấy tiệt trùng lấy nước muối sinh lý cho lên lamelle. - Tiệt trùng que cấy, lấy một ít vi khuẩn cho lên lame hòa vào nước muối sinh lý. - Dùng lame đặt nhẹ nhàng lên lamelle sao cho lame không chạm vào giọt nước muối sinh lý chứa vi khuẩn. - Cẩn thận lật thật nhanh lame để giọt nước được treo ngược trên lamelle. - Đặt lame lên kính hiển vi quan sát tính di động của vi khuẩn ở vật kính 40X. Nhuộm Gram Chuẩn bị tiêu bản: Nhỏ một giọt nước cất lên lame, dùng que cấy nhặt một ít vi khuẩn trải đều lên giọt nước cất. Để khô ở nhiệt độ phòng sau đó hơ lướt lame trên ngọn lửa đèn cồn để cố định vi khuẩn trên lame. Các bước nhuộm Gram - Nhỏ dung dịch crystal violet lên lame. Để 1 phút. - Rửa bằng nước cho hết màu tím trên lame (khoảng 2 giây), để khô ở nhiệt độ phòng. - Nhỏ dung dịch iodine lên lame, để khoảng 1 phút. - Lật nghiêng lame kính cho hết dung dịch iodine trên lame. - Dùng dung dịch 95% cồn: 5% aceton để tẩy màu bằng cách nghiêng lame rồi nhỏ từ từ dung dịch cho đến khi giọt nước cuối lam không còn màu tím. Rửa và để khô ở nhiệt độ phòng. - Nhỏ dung dịch safranin lên lame, để khoảng 2 phút. Rửa và để khô ở nhiệt độ Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 36 phòng. Quan sát ở vật kính 100X. Đọc kết quả - Vi khuẩn Gram dương (G+) có màu tím xanh. - Vi khuẩn Gram âm (G-) có màu hồng đỏ. Phản ứng catalase - Dùng dung dịch 3% H2O2 (3ml H2O2 trong 100ml nước cất). - Dùng que cấy nhặt một ít vi khuẩn để lên lame, sau đó nhỏ lên vi khuẩn một giọt 3% H2O2 . - Vi khuẩn cho phản ứng Catalase (+) sẽ gây hiện tượng sủi bọt trong dung dịch 3% H2O2 và ngược lại. Phản ứng oxidase - Dùng que cấy phết một ít vi khuẩn lên que đã tẩm dung dịch oxidase. - Vi khuẩn cho phản ứng Oxidase (+) sẽ làm giấy lọc chuyển sang màu xanh trong vòng 60 giây và ngược lại. Phản ứng decarboxylase - Môi trường decarboxylase (xem công thức pha chế trên nhãn) + 0,5% yeast extract. - Thêm 1% amino acid (arginine, lysine và ornithine) cho các phản ứng. - Môi trường làm đối chứng không có amino acid. - Cho 3ml môi trường vào ống nghiệm. - Thanh trùng ở 1200C trong 15 phút. - Cấy một ít vi khuẩn vào trong ống nghiệm sau đó phủ lên mỗi ống 0.5ml parafin tiệt trùng, để trong tủ ấm ở 280C. - Đọc kết quả từ 1-4 ngày. Phản ứng (+) khi các ống nghiệm có amino acid chuyển màu khác với màu của ống đối chứng và ngược lại. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 37 Khả năng phát triển của vi khuẩn ở các nồng độ muối khác nhau - Môi trường 1% tryptone (1g tryptone trong 100ml nước cất). Thêm NaCl ứng với các nồng độ 0, 3, 6, 7, 10% NaCl. - Cho 3ml môi trường vào mỗi ống nghiệm. - Thanh trùng ở 1210C trong 15 phút. - Cấy một ít vi khuẩn vào các ống nghiệm. Để trong tủ ấm ở 280C. - Sau 2-4 ngày, môi trường đục cho kết quả (+) và ngược lại. Khả năng lên men và oxy hóa đường glucose (Fermentation/oxidation: O/F) - Môi trường O/F (xem công thức pha chế trên nhãn) - Đun và khấy cho tan hoàn toàn. - Tiệt trùng ở 1210C trong 15 phút, để nguội 450C. - Thêm 1% glucose tiệt trùng. - Cho 3ml môi trường vào ống nghiệm. - Cấy vi khuẩn vào 2 ống nghiệm có chứa môi trường OF. Sau đó phủ 0.5-1ml dầu parafin tiệt trùng vào 1 ống nghiệm để tạo điều kiện yếm khí trong ống nghiệm. Để trong tủ ấm ở 280C. - Đọc kết quả sau 24h- 7 ngày. - Lên men (F) khi ống có phủ parafin chuyển sang màu vàng. - Oxidation (O) khi ống không có phủ parafin chuyển sang màu vàng. - Không đổi (N) cả hai ống đều có màu xanh lá cây hoặc xanh lơ. Khả năng sinh indole - Môi trường nutrient broth. - Cho 3ml môi trường vào ống nghiệm. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 38 - Thanh trùng ở 1210C trong 15 phút. Để nguội. - Thuốc thử Kovac’s (bảo quản ở 40C). - Cấy một ít vi khuẩn vào trong ống nghiệm. Để trong tủ ấm ở 280C. - Sau 48 giờ nhỏ vài giọt thuốc thử Kovac’s vào ống nghiệm. Vi khuẩn sinh indole sẽ cho phản ứng (+) với một vòng màu hồng đến đỏ sậm trên bề mặt của môi trường và ngược lại. Phản ứng Voges- Proskauer (VP) - MR – VP broth (xem nhãn) - Cho 3ml môi trường vào ống nghiệm. - Thanh trùng ở 1210C trong 15 phút, để nguội. Thuốc thử: A : Hòa tan 5g alpha naphthol (Merck) trong 100ml ethyl alcohol (Merck). B: Hòa tan 40g KOH (Prolabor) trong 100ml nước cất. - Cấy vi khuẩn vào trong các ống nghiệm. Ủ ở 28 0C. - Sau 48 giờ nhỏ 0.6ml thuốc thử A và 0.2ml thuốc thử B vào ống nghiệm, lắc đều và để nghiêng ống nghiệm 30 phút. - Sự chuyển màu hồng hoặc đỏ của môi trường cho phản ứng (+) và ngược lại. Khả năng sử dụng citrate - Môi trường Simmon’s Citrate agar (xem nhãn) - Đun sôi và khuấy cho tan. - Cho 5ml môi trường vào ống nghiệm - Thanh trùng ở 1210C trong 15 phút. - Để nghiêng để tạo mặt phẳng nghiêng trong ống nghiệm và để nguội. - Cấy vi khuẩn mặt đứng (dùng que cấy thẳng cắm thẳng xuống mặt đứng) và trên bề mặt nghiêng (dùng que cấy thường) của ống nghiệm. Ủ ở 280C Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 39 - Sau 2-7 ngày, vi khuẩn sử dụng citrate tạo màu xanh lơ trong môi trường Simmon’s Citrate agar cho kết quả (+) và ngược lại. Starch hydrolysis (khả năng thủy phân starch) - Nutrient agar (xem công thức pha chế trên nhãn) + 0,5% starch - Thanh trùng ở 1210C trong 15 phút. - Để nguội khoảng 450C, đổ môi trường ra đĩa petri. - Thuốc thử Lugol’s Iodine:  5g Iodine (Merck),10g Potassium iodine (KI; Merck),100ml nước cất.  Hòa tan KI và Iodine trong 10ml nước cất rồi thêm tiếp cho đủ 100ml. - Cấy vi khuẩn trên đĩa petri và ủ ở 280C. - Sau 48 giờ nhỏ thuốc thử Lugol’s Iodine trên bề mặt vi khuẩn. - Trong vòng 30 phút, nếu xuất hiện một vòng tròn lan rộng xung quanh chỗ có vi khuẩn phát triển cho phản ứng (+) và ngược lại. Khả năng sử dụng urea - 0,1% pepton + 0,2% KH2PO4 + 0,0012% phenol red + 0,1 % glucose - Thêm 2% urea cho phản ứng. Môi trường làm đối chứng không có urea. - Cho 3ml môi trường vào ống nghiệm. - Thanh trùng ở 1210C trong 15 phút. - Cấy một ít vi khuẩn vào trong 2 ống nghiệm. Để trong tủ ấm ở 280C. - Đọc kết quả trong vòng 2 ngày. Phản ứng dương khi các ống nghiệm có urea chuyển sang màu hồng. Khả năng sử dụng các nguồn carbohydrate - Nutrient broth (xem công thức pha chế trên nhãn). Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 40 - 0,4% Bromothymol blue (1,6%) (Merck) - 1% đường (glucose, arabinose, cellobinose,…). Chỉnh pH 6.8 - Cho 3ml môi trường vào ống nghiệm. - Thanh trùng ở 1210C trong 15 phút. Để nguội. - Dùng môi trường đường tương ứng. - Cấy vi khuẩn vào trong các ống nghiệm. Ủ ở 280C. - Đọc kết quả trong vòng 2-7 ngày. - Nếu môi trường chuyển sang màu vàng cho phản ứng (+) và ngược lại. Khả năng sinh gas từ glucose - Nutrient broth (xem công thức pha chế trên nhãn). - 0,4% Bromothymol blue (1,6%). - 1% đường glucose. Chỉnh pH 6.8 - Cho 3ml môi trường vào ống nghiệm đã tiệt trùng có chứa sẵn chuông (tiệt trùng). - Thanh trùng ở 1210C trong 15 phút. Để nguội. - Cấy vi khuẩn vào trong các ống nghiệm. Ủ ở 280C. - Đọc kết quả trong vòng 2-7 ngày. - Nếu môi trường chuyển sang màu vàng và chuông nổi trên mặt môi trường cho phản ứng (+) và ngược lại. Khả năng sinh H2S - Môi trường TSI (60g/1000ml nước cất). - Đun và khuấy cho tan hoàn toàn. - Tiệt trùng ở 1210C trong 15 phút. Để nguội ở 450C. - Cho 5ml môi trường vào ống nghiệm. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 41 - Để nghiêng ống nghiệm tạo một mặt phẳng nghiêng và chừa lại khoảng 12cm thạch đứng trong ống nghiệm và để nguội. - Cấy vi khuẩn mặt đứng (dùng que cấy thẳng cắm thẳng xuống mặt đứng) và trên bề mặt nghiêng (dùng que cấy thường) của ống nghiệm. Ủ ở 280C. - Đọc kết quả sau 14-28 giờ. - Vi khuẩn sinh H2S cho màu đen trong ống nghiệm. - Vi khuẩn chỉ lên men đường glucose cho màu đỏ ở phần thạch nghiêng và màu vàng ở phần thạch đứng (K (alkaline)/A (acid)). - Vi khuẩn lên men đường glucose và lactose hoặc sucrose cho màu vàng ở phần thạch nghiêng và màu vàng ở phần thạch đứng (A (acid)/ A (acid)). - Vi khuẩn chỉ lên men đường lactose hoặc sucrose cho màu vàng ở phần thạch nghiêng và màu đỏ ở phần thạch đứng (A (acid)/K(alkaline)). - Vi khuẩn không lên men đường glucose, không lên men đường lactose hoặc sucrose cho màu đỏ ở phần thạch nghiêng và màu đỏ ở phần thạch đứng (K (alkaline)/ K (alkaline)). Tính mẫn với hợp chất 2,4-diamino-6,7-diisopropyl pteridine (O/129) - Giúp phân biệt được nhóm vi khuẩn Aeromonas và Vibrio. Vi khuẩn Aeromonas kháng với O/129 nhưng Vibrio thì mẫn cảm với hợp chất này. - Phải thao tác các bước sau trong điều kiện vô trùng - Sử dụng môi trường muller hinton agar (MHA), giấy tẩm O/129 và ống nghiệm chứa 5ml 0,9% NaCl tiệt trùng. - Dùng que cấy tiệt trùng nhặt một ít vi khuẩn ròng cho vào ống nghiệm chứa 5ml 0,9% NaCl tiệt trùng và lắc đều. - So sánh màu của dung dịch vi khuẩn tiêu chuẩn McFarland 0,5. - Dùng pipet tiệt trùng hút dung dịch vi khuẩn cho lên đĩa MHA. - Nghiêng nhẹ để trãi đều dung dịch khắp bề mặt agar rối rút bỏ lượng dung dịch thừa. - Dùng kẹp đặt giấy tẩm O/129 lên mặt đĩa agar. Để đĩa trong tủ ấm ở 280C. Trung tâm Học liệu ĐH Cần Thơ @ Tài liệu học tập và nghiên cứu Trang 42 - Đọc kết quả sau 24 giờ. Vi khuẩn mẫn cảm với O/129 tạo nên 1 vòng tròn vô trùng ≥15mm xung quanh đĩa tẩm O/129. Khả năng lên men β-galactosidase (ONPG, Ortho-nitrophenyl galactosidase) - Đĩa nuôi vi khuẩn đã kiểm tra tính ròng. - Dùng que cấy tiệt trùng nhặt một ít vi khuẩn ròng cho vào ống nghiệm chứa 0,2 ml 0,9% NaCl tiệt trùng và lắc đều. - So sánh màu của dung dịch vi khuẩn tiêu chuẩn McFarland 0,5. - Dùng kẹp đặt đĩa ONPG vào trong ống nghiệm đã chứa dung dịch vi khuẩn. - Nếu dung dịch chuyển sang vàng sau 20 phút thì đọc kết quả là dương tính (+). - Nếu sau từ 20 phút đến 4 giờ dung dịch không chuyển màu thì đọc kết quả là âm tính (-). Các hóa chất và môi trường dùng cho test các chỉ tiêu sinh lý và sinh hóa phải được chuẩn bị trước khi test 24 giờ.

Các file đính kèm theo tài liệu này:

  • pdflv_nh_giang_196.pdf
Luận văn liên quan