Tóm tắt luận án Phân lập, tạo đột biến điểm ở gen P5CS liên quan đến tính chịu hạn và thử nghiệm chuyển vào cây đậu tương Việt Nam

1.1. Giống đậu tương địa phương sưu tập được có sự đa dạng và phong phú vềhình thái, kích thước và khối lượng hạt. Phân tích vềchỉtiêu hóa sinh cho thấy các giống đậu tương địa phương có chất lượng và khảnăng chịu hạn cao hơn so với giống đối chứng. Đã xác định được mối liên quan giữa tỷlệtăng hàm lượng prolin và khảnăng chịu hạn của các giống đậu tương trong phạm vi nghiên cứu. 1.2. Trình tự gen P5CS của hai giống đậu tương DT84 và SL5 đã được phân lập gồm có 2148 nucleotit, mã hóa 715 axit amin. M 1 2 3 4 5 WT - + 20 1.3. Đã tạo đột biến ởbộba có vịtrí thứ125 của gen P5CS của giống đậu tương SL5, thay thế Asp bằng Ala trong trình tự protein. 1.4. Promoter rd29A đã được phân lập thành công từ cây A.thaliana. Promotor rd29Acó chiều dài 1298bp mang các trình tự đặc trưng gồm các nhân tố cis thuộc nhóm MYB, DRE, AMYBOX nhân tố đặc trưng của promoter và nhân tố cảm ứng điều kiện khô hạn. 1.5. Khả năng hoạt động của promtor rd29A đã được đánh giá trong cây thuốc lá chuyển gen. Trong điều kiện thiếu nước, promoter rd29A đã điều khiển gen chỉthịGUS biểu hiện khá mạnh và rõ ràng ởcác dòng thuốc lá chuyển gen được xử lý bởi hạn nhân tạo so với các dòng cây chuy ển gen không xử lý và cây đối chứng. 1.6. Đối với các dòng cây thuốc lá chuyển gen mang cấu trúc rd29A:: P5CSM, có hiện tượng tăng cao hàm lượng prolin sau khi gây hạn nhân tạo, dẫn đến khả năng sống sót cao hơn các cây đối chứng (không chuyển gen). Khả năng phục hồi của các dòng cây chuyển gen nhanh hơn các cây đối chứng. 1.7. Tối ưu được quy trình tái sinh và chuyển gen thông qua mô nách lá mầm ở đậu tương. Bước đầu chuyển thành công cấu trúc gen rd29A:: P5CSMvào giống đậu tương DT84, và thu được một sốdòng dương tính PCR đối với gen chuyển.

pdf22 trang | Chia sẻ: aquilety | Ngày: 31/03/2015 | Lượt xem: 1547 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Tóm tắt luận án Phân lập, tạo đột biến điểm ở gen P5CS liên quan đến tính chịu hạn và thử nghiệm chuyển vào cây đậu tương Việt Nam, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
BỘ GIÁO DỤC VÀ ĐÀO TẠO ĐẠI HỌC THÁI NGUYÊN NGUYỄN THỊ THÚY HƯỜNG PHÂN LẬP, TẠO ĐỘT BIẾN ĐIỂM Ở GEN P5CS LIÊN QUAN ĐẾN TÍNH CHỊU HẠN VÀ THỬ NGHIỆM CHUYỂN VÀO CÂY ĐẬU TƯƠNG VIỆT NAM Chuyên ngành: Di truyền học Mã số: 62.42.70.01 TÓM TẮT LUẬN ÁN TIẾN SỸ SINH HỌC THÁI NGUYÊN - 2011 CÁC CÔNG TRÌNH CỦA TÁC GIẢ ĐÃ CÔNG BỐ LIÊN QUAN ĐẾN LUẬN ÁN 1. Nguyễn Thị Thuý Hường, Chu Hoàng Mậu, Hà Tấn Thụ, Đinh Thị Kim Phương, Trần Thị Trường (2006), “Sưu tập, phân loại và đánh giá chất lượng hạt của một số giống đậu tương địa phương tại tỉnh Sơn La”, Tạp chí Nông nghiệp và phát triển Nông thôn, số 11 kỳ I tháng 6/2006. 28-32 2. Chu Hoàng Mậu, Nguyễn Thị Thuý Hường (2006), “Thành phần axit amin và khả năng chịu hạn của một số giống đậu tương địa phương của tỉnh Sơn La”, Tạp chí Nông nghiệp và phát triển Nông thôn, số 20 kì II tháng 10/2006. 22- 26. 3. Nguyễn Thị Thúy Hường, Chu Hoàng Mậu, Lê Văn Sơn, Nguyễn Hữu Cường, Lê Trần Bình, Chu Hoàng Hà (2008), "Đánh giá khả năng chịu hạn và phân lập gen P5CS của một số giống đậu tương (Glycine max L.Merrili)", Tạp chí công nghệ sinh học, 6(4): 459-466. 4. Nguyễn Thị Thúy Hường, Trần Thị Ngọc Diệp, Nguyễn Thu Hiền, Chu Hoàng Mậu, Lê Văn Sơn, Chu Hoàng Hà (2009), "Phát triển hệ thống tái sinh invitro ở cây đậu tương (Glycine max L.Merrili) phục vụ chuyển gen", Tạp chí khoa học và công nghệ. Đại học Thái Nguyên 52 (4): 82-88. 5. Nguyễn Thị Thúy Hường, Chu Hoàng Mậu, Lê Văn Sơn, Nguyễn Hữu Cường, Lê Trần Bình, Chu Hoàng Hà (2009), "Tạo gen mã hóa Enzym P5CS (Pyroline - 5 - carboxylate synthase) mang đột biến loại bỏ hiệu ứng ức chế phản hồi bằng kỹ thuật PCR". Hội nghị công nghệ sinh học toàn quốc năm 2009: 191 - 193. 6. Nguyễn Thị Thuý Hường, Chu Hoàng Mậu, Lê Văn Sơn, Nguyễn Hữu Cường, Chu Hoàng Hà (2010), "Tách dòng và đánh giá hoạt động của promoter cảm ứng khô hạn rd29A từ Arabidopsis thaliana", Tạp chí Công nghệ sinh học 8(4): 1805-1810 7. Nguyễn Thị Thuý Hường, Chu Hoàng Mậu, Lê Văn Sơn, Nguyễn Hữu Cường, Chu Hoàng Hà (2010), "Tạo cây thuốc lá chuyển gen P5CS đột biến loại bỏ hiệu ứng phản hồi ngược, làm tăng hàm lượng protein và khả năng chống chịu khô hạn. Hội nghị toàn quốc về khoa học sự sống Bio-Hà Nội 2010", Tạp chí công nghệ sinh học, 8 (3A): 539-544. 8. Chu Hoang Mau, Nguyen thi Thuy Huong, Nguyen Tuan Anh, Chu Hoang Lan, Le van Son, Chu Hoang Ha ( 2010) Characteristic of the gene encoding pyrroline - 5 - carboxylate synthase (P5CS) in Vietnamese sobean cultivar (Glycine max L.Merrill) 2010 International Conference on Biology, Environment and Chemistry (ICBEC 2010) IEEE: 319-323 1 MỞ ĐẦU 1. Đặt vấn đề Cây đậu tương (Glycine max (L.) Merrill) là một trong những cây trồng quan trọng không chỉ ở Việt Nam mà còn đối với nhiều quốc gia trên thế giới. Tình trạng hạn hán ảnh hưởng tới tình hình sản xuất đậu tương không chỉ ở Việt Nam mà ngay cả những nước sản xuất đậu tương hàng đầu thế giới. Đậu tương là cây trồng thuộc nhóm cây có khả năng chịu hạn kém. Ở Việt Nam, nhiều giống đậu tương có khả năng chống chịu hạn đã được chọn tạo thành công và đang được triển khai canh tác ở một số địa phương. Tuy nhiên các phương pháp chọn giống truyền thống tốn nhiều thời gian, phức tạp và cần phải có quần thể đủ lớn và không ổn định. Những nhược điểm của phương pháp truyền thống có thể khắc phục bằng việc áp dụng các kỹ thuật mới của công nghệ sinh học. Kỹ thuật chuyển gen ở thực vật thông qua vi khuẩn Agrobacterium tumefaciens đã được các nhà khoa học trên thế giới ứng dụng và đạt được những kết quả rất có triển vọng trên cây đậu tương. Ở Việt Nam, nhóm nghiên cứu của Trần Thị Cúc Hòa tại Viện Nghiên cứu lúa Đồng bằng Sông Cửu Long đã thành công trong việc tạo ra các giống đậu tương mới mang tính kháng sâu bệnh, tuy nhiên cho đến nay công trình nghiên cứu về chuyển gen chịu hạn vào cây đậu tương vẫn chưa được quan tâm đúng mức. Xuất phát từ những lý do trên chúng tôi tiến hành đề tài luận án tiến sĩ là: “Phân lập, tạo đột biến điểm ở gen P5CS liên quan đến tính chịu hạn và thử nghiệm chuyển vào cây đậu tương Việt Nam”. 2. Mục tiêu nghiên cứu 2.1. So sánh trình tự gen mã hóa P5CS của các giống địa phương thuộc nhóm chịu hạn tốt và chịu hạn kém. Tạo được đột biến loại bỏ hiệu ứng ức chế phản hồi bởi prolin. 2.2. Tạo được vector chuyển gen mang cấu trúc liên quan đến tính chịu hạn ở cây đậu tương. 2.3. Tạo cây đậu tương mang cấu trúc gen liên quan đến đặc tính chịu hạn. 2 3. Nội dung nghiên cứu 3.1. Phân tích đặc điểm sinh lý, hóa sinh của một số giống đậu tương trồng tại khu vực miền Bắc. 3.2. Phân lập và xác định trình tự gen mã hóa enzyme 1-pyrroline-5 carboxylate synthetase (P5CS). 3.3. Tạo đột biến loại bỏ hiệu ứng ức chế phản hồi (feedback inhibition) bởi prolin bằng phương pháp tạo đột biến điểm. 3.4. Phân lập promoter cảm ứng dưới điều kiện khô hạn rd29A từ cây Arabidopsis thaliana. Phân tích hoạt động của promoter dựa vào hoạt động của gen GUS ở các dòng cây thuốc lá chuyển gen. 3.5. Thiết kế cấu trúc mang gen P5CS đột biến được điều khiển bởi promoter rd29A và chuyển cấu trúc này vào cây thuốc lá. 3.6. Phân tích các chỉ tiêu hóa sinh và khả năng chống chịu của các dòng thuốc lá trong điều kiện gây hạn nhân tạo. 3.7. Biến nạp cấu trúc mang gen P5CS vào cây đậu tương thông qua vi khuẩn Agrobacterium tumefaciens. Phân tích sự có mặt của gen biến nạp. 4. Những đóng góp mới của luận án 4.1. Gen P5CS được phân lập và đọc trình tự từ hai giống đậu tương Việt Nam (DT84 và SL5), có kích thước 2148 nucleotit, mã hóa 715 axit amin. 4.2. Đã tạo đột biến điểm định hướng ở bộ ba có vị trí thứ 125 của gen P5CS của giống SL5, thay thế Asp bằng Ala trong trình tự protein, loại bỏ hiệu ứng ức chế phản hồi (feedback inhibition). 4.3. Promoter rd29A đã được phân lập thành công từ cây A.thaliana, có kích thước 1298bp mang các trình tự đặc trưng gồm các nhân tố cis thuộc nhóm MYB, DRE, AMYBOX nhân tố đặc trưng của promoter và nhân tố cảm ứng điều kiện khô hạn. 4.4. Thiết kế thành công cấu trúc của promtor rd29A :: GUS và cấu trúc rd29A::P5CSM. Các cấu trúc này đã được đánh giá trong cây thuốc lá ở điều kiện hạn. 4.5. Tối ưu được quy trình tái sinh và chuyển gen thông qua mô nách lá mầm ở đậu tương. Bước đầu chuyển thành công cấu trúc gen 3 rd29A::P5CSM vào giống đậu tương DT84 và thu được một số dòng dương tính PCR đối với gen chuyển. 5. Ý nghĩa khoa học và thực tiễn 5.1. Về khoa học, luận án là công trình ở Việt Nam đã đánh giá được khả năng chống chịu hạn của các giống đậu tương trong điều kiện gây hạn nhân tạo, phân lập và thay đổi cấu trúc gen P5CS dựa vào phương pháp gây đột biến có định hướng bằng phản ứng PCR. Các kết quả phân tích gen P5CS khẳng định rằng sự khác nhau về khả năng chịu hạn của các giống đậu tương khác nhau là do nhiều yếu tố quy định, tuy nhiên hoạt động của gen P5CS giữ vai trò quan trọng đối với tính chịu hạn ở cây trồng. 5.2. Về thực tiễn, những kết quả đánh giá hoạt động của cấu trúc chuyển gen mang promoter rd29A điều khiển hoạt động của gen P5CS đã bị gây đột biến loại bỏ hiệu ứng phản hồi bởi prolin ở cây thuốc lá đã khẳng định ý nghĩa thực tiễn của luận văn. Khả năng chống chịu được cải thiện rõ rệt ở các dòng thuốc lá chuyển gen mang cấu trúc này đảm bảo tính khả thi của việc ứng dụng cấy trúc chuyển gen này trên các đối tượng cây trồng khác nhằm cải thiện một trong những tính trạng rất quan trọng là chống chịu hạn. Kết quả ban đầu trong việc thiết lập quy trình chuyển gen ở cây đậu tương sẽ là tiền đề quan trọng trong tiến trình tạo ra các giống đậu tương mới có tính chịu hạn cao. 6. Cấu trúc của luận án Luận án gồm 113 trang, được chia thành các phần: Phần Mở đầu gồm có 3 trang; Chương 1: Tổng quan tài liệu, 34 trang; Chương 2: Vật liệu và Phương pháp, 15 trang; Chương 3: Kết quả và Thảo luận, 46 trang; Phân Kết luận và Đề nghị: 2 trang; Các công trình đã công bố của tác giả: 1 trang. Tài liệu tham khảo: 11 trang; Luận án có 29 bảng số liệu, 43 hình và 108 tài liệu tham khảo bằng tiếng Việt và tiếng Anh. Chương 1. TỔNG QUAN TÀI LIỆU Luận án đã tham khảo và tổng kết 64 tài liệu, trong đó có 10 tài liệu tiếng việt, 51 tài liệu tiếng Anh và 3 địa chỉ trang web về 5 vấn đề cơ bản liên quan, như : (1) Giới thiệu về cây đậu tương (Glycine max (L.) Merill), 4 giá trị kinh tế và giá trị sử dụng của cây đậu tương; (2) Cơ sở sinh lý, hóa sinh của đặc tính chống chịu hạn của cây đậu tương; (3) Prolin và vai trò của enzym P5CS trong con đường sinh tổng hợp prolin; (4) Promoter và vai trò điều khiển hoạt động của gen trong điều kiện hạn; (5) Những nghiên cứu nâng cao khả năng chịu hạn của cây đậu tương. Prolin được biết đến là một trong những chất đóng vai trò quan trọng trong quá trình điểu chỉnh áp suất thẩm thấu khi cơ thể thực vật sống trong các điều kiện bất lợi như hạn, mặn (Delauney and Verma, 1993). Tác dụng bảo vệ các cấu trúc nội bào và các đại phân tử khi tế bào gặp các điều kiện bất lợi về áp suất thẩm thấu; bảo vệ các cấu trúc protein và nâng cao hoạt tính của nhiều loại enzyme khác nhau; chống oxy hóa với chức năng phân cắt các gốc oxy phản ứng (reactive oxygen residues) và bất hoạt các gốc oxy tự do (singlet oxygen quencher) (Szavados và đtg, 2009). Ở thực vật, quá trình sinh tổng hợp prolin được kiểm soát bởi hoạt tính của hai gen mã hóa cho enzym P5CS. Hai gen này có độ tương đồng rất cao về trình tự mã hóa nhưng biểu hiện lại rất khác nhau trong những điều kiện khác nhau. Cả hai gen P5CS đều hoạt động ở các mô phân sinh của hoa, chủ yếu để cung cấp prolin cho quá trình phát triển của hoa (Mattioli và đtg, 2009). Nghiên cứu trên cây Arabidopsis các nhà khoa học đã chứng minh được mối quan hệ chặt chẽ giữa hoạt động của enzme P5CS và sự tích lũy prolin trong điều kiện cây bị xử lý mặn; và hiệu ứng ức chế ngược của prolin tới hoạt tính của P5CS cũng bị ảnh hưởng trong các điều kiện bất lợi này. Khi chuyển gen P5CS đã bị gây đột biến loại bỏ hiệu ứng ức chế ngược bởi prolin vào cây thuốc lá các nhà khoa học đã nhận ra rằng các dòng thuốc lá chuyển gen này tăng cường tích lũy prolin nhiều hơn gấp 2 lần so với các dòng thuốc lá được chuyển gen P5CS kiểu dại. Gần đây, gen P5CS phân lập thành công từ cây lúa và khi được chuyển trở lại lúa nhằm tăng cường hoạt động của gen này các nhà khoa học đã nhận thấy rằng tính chịu mặn và chịu lạnh được cải thiện rõ rệt. Promoter rd29A là một trình tự bị cảm ứng biểu hiện dưới các điều kiện bất lợi như khô hạn, mặn, và lạnh đã được nhiều nhà khoa học quan tâm. Một số nghiên cứu đã phát hiện được trình tự promoter rd29A chứa 2 vùng có hoạt tính cis là vùng cảm ứng ABA (ABRE) và vùng cảm ứng mất 5 nước (DRE)/C repeat (CRT). Cả 2 vùng đều liên quan đến sự biểu hiện các gen biểu hiện dưới điều kiện bất lợi của môi trường (Yamaguchi-Shinozaki và Shinozaki, 1993). Nhiều phòng thí nghiệm trên thế giới đã phân lập và kiểm tra hoạt động của promoter rd29A trên nhiều loài cây như A. thaliana, thuốc lá và lúa mì (Sun và Chen, 2002). Cấu trúc promoter RD29A điều khiển gen chỉ thị GUS được chuyển vào cây khoai tây, mía. Hoạt tính của GUS đều được phát hiện trong cây chuyển gen dưới điều kiện bất lợi của môi trường nuôi cấy (Zhang et al., 2005) . Có nhiều biện pháp cải thiện khả năng chịu hạn của cây trồng, những hiện nay áp dụng kỹ thuật chuyển gen nhằm tăng cường khả năng chịu hạn của thực vật đang được quan tâm nghiên cứu. Có thể nhận định rằng tính khả thi và tiềm năng ứng dụng phương pháp chuyển gen thực vật như là biện pháp nâng cao khả năng chịu hạn của cây đậu tương tại Việt Nam là rất cao. Chương 2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. Vật liệu, hóa chất, thiết bị Vật liệu thực vật: 16 giống địa phương và DT84; giống thuốc lá 326 (Nicotiana tabacum), và cây Arabidopsis thaliana. Hóa chất nghiên cứu: Vector tách dòng pBT, vector pBI101 dùng mục đích thiết kế vector chuyển gen, vector pTN 289 dùng để chuyển gen. Các cặp mồi dùng để nhân bản gen P5CS và promoter RD29A được thiết kế dựa trên trình tự gen P5CS và promoter RD29A đăng kí trên GeneBank với mã số: AY492005, AB428730. Các loại hóa chất dùng cho các thí nghiệm nuôi cấy mô và sinh học phân tử được mua từ các hãng hóa chất: Merk, Bioneer, Fermentas do Phòng Công nghệ tế bào thực vật, Viện Công nghệ sinh học cung cấp. 2.2. Phương pháp nghiên cứu 2.2.1. Phương pháp sinh lý, hoá sinh - Đánh giá nhanh khả năng chịu hạn theo phương pháp của Lê Trần Bình và đồng tác giả năm 1998. 6 - Định lượng protein tan được thực hiện theo phương pháp Lowry. Định lượng lipit được mô tả trong tài liệu của Phạm Thị Trân Châu. Hàm lượng và thành phần axit amin trong hạt theo Phạm Văn Chi và đtg (1997). - Hàm lượng prolin được xác định bằng phương pháp Bates và đtg (1973). - Phương pháp tính toán và xử lý số liệu theo Nguyễn Hải Tuất và Ngô Kim Khôi (1996). 2.2.2. Các phương pháp sử dụng nuôi cấy in vitro Các phương pháp sử dụng nuôi cấy in vitro ở cây Arabidopsis, cây thuốc lá theo Topping ,1988. Đối với cây đậu tương tái sinh cây qua đa chồi từ nách lá mầm hạt chín và quy trình chuyển gen vào nách lá mầm hạt chín được tiến hành dựa trên phương pháp của Olhoft và đtg (2001) có cải tiến. 2.2.3. Phương pháp sinh học phân tử Thiết kế mồi dựa vào trình tự đã công bố trên GenBank. Quy trình tách chiết DNA tổng số (đối với Arabidopsic và thuốc lá). Phương pháp tách chiết RNA tổng số: Sử dụng bộ kit Trizol Regents (của hãng Invitrogen) để tách chiết RNA tổng số từ các mẫu lá đậu tương theo chỉ dẫn của nhà sản xuất. Phương pháp tách chiết, tinh sạch DNA và RNA. - Phương pháp tổng hợp cDNA. RNA tổng số được sử dụng để nhân gen bằng phương pháp tổng hợp cDNA, cDNA được tổng hợp theo quy trình RevertAidTMH Minus First Strand cDNA Synthesis Kit (Fermentas). - Phản ứng PCR. Chu trình nhiệt của phản ứng PCR: Gen P5CS được khuếch đại bằng kỹ thuật PCR với cặp mồi đặc hiệu theo chu trình nhiệt như sau: 94ºC/5 phút;: 94ºC/30 giây, Tm /45 giây, 72ºC/1 phút 30 giây; 72ºC/10 phút, 35 chu kì. Tiến hành phản ứng PCR với các nhiệt độ khác nhau (từ 50 - 620C) để tìm nhiệt độ gắn mồi đặc hiệu. - Phương pháp OE - PCR ( Overlap Extention) Chu trình nhiệt của phản ứng PCR: 94ºC/5 phút; 94ºC/30 giây, Tm /45 giây, 72ºC/1 phút 30 giây; 72ºC/10 phút, 4 chu kì. Sau 4 chu kỳ lấy sản phẩm ra 7 đặt ngay vào đá và bổ sung 1µl BamHI và 1µl SaclI thực hiện tiếp phản ứng theo chu trình nhiệt sau: 94ºC/5 phút; 94ºC/30 giây, Tm /45 giây, 72ºC/1 phút 30 giây; 72ºC/10 phút, 30 chu kì. - Phương pháp tách dòng: Tách chiết plasmid tái tổ hợp được thực hiện theo Sambrook và đtg (2001) và tinh sạch bằng Plasmid Miniprep Kit (Qiagen). Phương pháp sử dụng enzym cắt hạn chế thực hiện theo Sambrook và đtg (2001) - Phương pháp PCR trực tiếp từ khuẩn lạc (colony-PCR) - Thiết kế cấu trúc rd29A :: GUS và rd29A :: P5CSM - Các phương pháp phân tích cây biến nạp. Kiểm tra sự có mặt của gen chuyển bằng phương pháp hóa sinh. Cây thuốc lá chuyển gen sau khi sống trong nhà kính được xử lý hạn nhân tạo bằng PEG (Jun và đtg 20001). Hàm lượng enzym Gus tiếp tục được xác định bằng phương pháp của Tefferson và đtg (1987) Chương 3. KẾT QUẢ VÀ THẢO LUẬN 3.1. Kết quả sưu tập và đánh giá các giống đậu tương địa phương của tỉnh Sơn La. 3.1.1. Đặc điểm hình thái, hóa sinh của hạt đậu tương. Phát hiện 16 giống đậu tương địa phương ở 7 huyện ở 11 huyện thị khác nhau của tỉnh Sơn La. Hàm lượng protein của các giống dao động trong khoảng 29,72%-52,75% protein/khối lượng khô. Hàm lượng lipit dao động từ 9,9% - 18,65%. Giống DT84 cho hàm lượng lipit cao nhất là 18,65%, đến SL3 (17,34%) 3.1.2. Kết quả đánh giá khả năng chịu hạn của các giống đậu tương nghiên cứu. Đối với giống SL5 hàm lượng prolin tăng cao nhất sau khi gây hạn được 9 ngày (tăng 377,44%). Giống DT84 có tỷ lệ tăng hàm lượng prolin ở cả ba thời điểm đều thấp nhất (101,06; 129,26 và 146,81%). Kết quả nghiên cứu phù hợp với các nghiên cứu của các tác giả trên các loài cây trồng khác nhau như lúa (Nguyễn Hữu Cường và đtg), (Do và đtg ), 8 (Choudhary và đtg 2005), cây họ đậu (Curtis và đtg 2004), (Chen và đtg 2009). 3.2. Phân lập gen P5CS và đột biến điểm loại bỏ ức chế ngược 3.2.1. Kết quả phân lập gen P5CS 3.2.2. Kết quả khuếch đại, tách dòng và xác định trình tự gen P5CS RNA tổng số đã được tách chiết và tổng hợp cDNA từ SL5 và DT84. Bốn đoạn gen P5CS được nhân lên bằng PCR và được kiểm tra bằng điện di trên gel agarose 0,8%. Kết quả hình 3.3 cho thấy, các đoạn thu được có kích thước tương ứng với kích thước tính toán theo lý thuyết. Để thu được gen P5CS hoàn chỉnh, hai sản phẩm PCR được trộn lẫn và được sử dụng làm khuôn cho phản ứng PCR với cặp mồi P5CSfor/P5CSrev theo phương pháp OE-PCR. Sản phẩm PCR thu được có kích thước khoảng 2100 bp ( Hình 3.4). Hình 3.3. Kết quả nhân hai đoạn gen P5CS từ 2 giống đậu tương DT84 và SL5 1, 3: giống DT84; 2, 4: giống SL5; M: Thang DNA chuẩn 1 kb. Hình 3.4. Kết quả PCR ghép nối hai đoạn gen P5CS từ 2 giống đậu tương DT84 và SL5 1, 3: giống DT84; 2, 4: giống SL5; M: Thang DNA chuẩn 1 kb Kết quả đọc trình tự gen cho thấy, sản phẩm gen tách dòng từ 2 mẫu nghiên cứu có kích thước 2148 nucleotide, mã hoá 715 axit amin. Ở 2 vị trí 125 và 128 của P5CS ở cả ba giống đều là axit amin Asp và Phe. Đây là hai vị trí gây ra sự ức chế hoạt động của enzym P5CS do tăng hàm lượng của prolin trong tế bào (Zhang và đtg 1995), (Hong và đtg 2000). 1000bp 1500bp 2100bp M 1 2 3 4 M 1 2 3 4 9 3.2.3. Tạo đột biến điểm loại bỏ hiệu ứng ức chế ngược ở P5CS phân lập từ cây đậu tương Kết quả hình 3.10 cho thấy, các đoạn thu được có kích thước tương ứng với kích thước tính toán theo lý thuyết. Sản phẩm OE-PCR thu được có kích thước khoảng 2100bp (hình 3.11). Kích thước này tương ứng với kích thước của gen P5CS gốc. 2 Hình 3.10. Điện di sản phẩm PCR Với cặp mồi P5CS M125for2/SacI-P5C; Với cặp mồi P5CS for / P5CS rev ; M : Thang DNA chuẩn 1 kb. Hình 3.11. Phản ứng nối hai đoạn gen theo phương pháp OE-PCR với cặp mồi BamHI-P5CS và Sacl - P5CS. A, B : 1+2, M:thang DNA chuẩn 1 kb Nhưng để biết chính xác gen có tạo được đột biến điểm hay không cần phải được đọc trình tự gen. Kết quả được thể hiện ở hình 3.13. 310 320 330 340 350 360 370 380 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| MSL5 AACAGCCTTATGGCTCTTTATGATGTTTTGTTTAGTCAGCTGGATGTGACATCTGCTCAGCTTCTTGTGACGGCCAATGA N S L M A L Y D V L F S Q L D V T S A Q L L V T A N D SL5 .........................................................................A...... N S L M A L Y D V L F S Q L D V T S A Q L L V T D N D Hình 3.13. Phân tích, so sánh trình tự nucleotit và phát hiện đột biến tại vị trí nucleotit 374 của gen P5CS Trình tự gen này mã hoá cho protein P5CS của đậu tương, qua kết quả đọc trình tự chúng tôi nhận thấy nucleotit A ở vị trí 374 của mã bộ ba GAC 2100bp M 2 1 1800bp 400bp M A B 10 được thay thế bằng nucleotit C của mã bộ ba GCC tương ứng trên trình tự protein axit amin ở vị trí 125 Asp được thay bằng Ala 3.3. Phân lập và kiểm tra hoạt động của promotor rd29A cảm ứng khô hạn 3.3.1. Phân lập promoter rd29A Trên cơ sở trình tự gen rd29A đã công bố trên ngân hàng gen thế giới, cặp mồi rd29A -HindIII / rd29A -BamHI đã được thiết kế có trình tự như bảng 3.7. Cặp mồi này sẽ tách được promoter có kích thước 1290 bp, nằm trước codon mở đầu của gen chức năng rd29A. Bằng kỹ thuật PCR, promoter rd29A đã được phân lập từ A. thaliana sử dụng cặp mồi đặc hiệu. Sản phẩm được kiểm tra trên gel agarose cho thấy có một băng duy nhất với kích thước khoảng 1300 bp, tương đương kích thước tính toán theo lý thuyết. Hình 3.15. Điện di sản phẩm PCR và cắt hạn chế vector pBT/ rd29A M) Marker; 1) sản phẩm PCR; 2) sản phẩm cắt bằng BamHI/HindIII Sản phẩm PCR được gắn vào vector tách dòng pBT và được biến nạp vào E. coli DH5α. Kết quả chọn dòng bằng colony-PCR và cắt plasmid bằng enzym hạn chế BamHI/HindIII cho thấy sản phẩm có kích thước tương đương kích thước đã tính toán theo lý thuyết (hình 3.15). Như vậy sản phẩm PCR đã được ghép nối thành công vào vector tách dòng pBT. 11 3.3.2. Phân tích trình tự promoter rd29A Để biết chính xác sản phẩm PCR chúng tôi đã tiến hành đọc trình tự nucleotide. Kết quả thu được so sánh với các trình tự gen trên Ngân hàng gen chính cho thấy sản phẩm là promoter rd29A của A.thaliana. Khi phân tích trình tự thu được cho thấy promoter phân lập có chiều dài 1290 bp, chứa các box trình tự cần thiết cho promoter điều hòa biểu hiện gen như TATA; CCAAT box- vùng giàu GC (GGGCCAATAG), Cap signal và các vùng liên quan quả trình phiên mã (-10 và -35). Ngoài ra còn chứa các vùng liên quan đến cảm ứng điều kiện khô hạn DRE, ABRE (hình 3.16). Kết quả này phù hợp với công bố của Wu và đtg. (2008) và Shinozaki và đtg (2007). Sau khi đã tách dòng và xác định trình tự promoter rd29A sử dụng phần mềm chuyên dụng để phân tích trình tự đoạn promoter đã tách dòng được. Kết quả nhận thấy rằng trên đoạn trình tự promoter rd29A phân lập trong nghiên cứu này có chứa các nhân tố cis thuộc nhóm MYB, DRE, AMYBOX. Các nhân tố cis này đã được khẳng định là đặc hiệu cho các promoter điều khiển biểu hiện của gen dưới các điều kiện bất lợi như hạn, mất nước và mặn.Đã phân lập thành công promoter rd29A, đoạn gen dài 1290bp chứa các nhân tố cis đặc hiệu, sử dụng đoạn gen để thiết kế vector phân tích quá trình biểu hiện của promoter dưới điều kiện hạn. gaatgagaaggatgtgccgtttgttataataaac -10 agccacacgacgtaaacgtaaaatgaccacatgatgggccaatagacatggaccga CCAAT box và vùng giàu GC ctactaataatagtaagttacattttaggatggaataaatatcaTACCGACATcag DRE-1 ttttgaaagaaaagggaaaaaaagaaaaaataaataaaagatatacTACCGACATg -35 DRE-2 agttccaaaaagcaaaaaaaaagatcaagccgacacagacacgcgtagagagcaaaatgactttgacgtcacaccacgaaaacagacg cttcatACGTGTCcctttatctct ABRE ctcagtctctctataaacttagtgagaccctcctctgttttactcacaaatatgca Cap signal TATA box aactagaaaacaatcatcaggaataaagggtttgattacttctattgga Hình 3.16. Phân tích trình tự promoter rd29A 12 3.3.3. Thiết kế vector chuyển gen mang cấu trúc rd29A Để kiểm tra khả năng điều khiển của promoter thu được, promoter rd29A được thiết kế vào vector pBI101 điều khiển sự biểu hiện gen chỉ thị GUS. Kết quả kiểm tra bằng PCR và cắt bằng enzym hạn chế BamHI/SacI cho thấy vector tái tổ hợp thu được chứa đoạn promoter rd29A (hình 3.18) có kích thước như mong muốn. Hình 3.18. Điện di sản phẩm PCR và cắt hạn chế vector pBI101/ rd29A M) Marker; 1-2) sản phẩm PCR; 3-4) sản phẩm cắt bằng BamHI/SacI Vector tái tổ hợp thu được biến nạp vào chủng vi khuẩn Agrobacterium C58, đây sẽ là nguyên liệu cho chuyển gen vào thực vật, để đánh giá khả năng điều khiển của promoter bằng mức độ biểu hiện GUS dưới điều kiện xử lý hạn. 3.3.4. Tạo cây thuốc lá chuyển gen mang cấu trúc rd29A :: GUS 1. Mảnh lá thuốc lá trên môi trường cảm ứng GM sau 2 ngày 2. Mảnh lá ngâm trong dịch huyền phù vi khuẩn 3. Mảnh lá trên môi trường cộng sinh sau 2 ngày 13 4. Mảnh lá trên môi trường GM + 50 mg/l Kanamycine + 400 mg/l Cefotaxime sau 1 tháng 5. Cụm chồi trên môi trường GM + 50 mg/l Kanamycine + 400 mg/l Cefotaxime sau 1 tháng 6. Cây con trên môi trường RM + 50 mg/l Kanamycine + 400 mg/l Cefotaxime sau 1 tháng 7. Ra cây trong bầu trấu: cát 8. Trong bầu đất 9. Ra nhà lưới Hình 3.19. Hình ảnh chuyển cấu trúc promotor rd29A vào thuốc lá Đánh giá hoạt động của promtor RD29A trong cây thuốc lá chuyển gen Kết quả thu được 51 dòng cây thuốc lá tái sinh trên môi trường chứa kanamycin. Kiểm tra 22 dòng cây bằng phản ứng PCR với cặp mồi đặc hiệu rd29A -HindIII/ rd29A -BamHI cho thấy có 21 dòng mang gen chuyển rd29A. Để đánh giá hoạt động điều khiển sự biểu hiện gen GUS của promoter rd29A, chúng tôi chọn ngẫu nhiên 3 dòng cây dương tính với PCR và tiến hành xử lý hạn nhân tạo bằng 10% PEG (polyethylene glycol). Kết quả cho thấy dưới điều kiện thiếu nước biểu hiện GUS ở các dòng thuốc lá chuyển gen khá mạnh và rõ ràng so với các dòng cây chuyển gen không xử lý và cây đối chứng (hình 3.20). 14 0 100 200 300 400 500 600 700 800 DCT DCS 3T 3S 4T 4S 5T 5S Mẫu Lư ợ n g M U (pm o l/m in . m g) Hình 3.20. Biểu hiện gen GUS trên cây chuyển gen A: Cây đối chứng không chuyển gen có xử lý hạn; B: Cây chuyển gen không xử lý hạn; C: Cây chuyển gen sau xử lý hạn 24 giờ. Hình 3.21. Hoạt tính của enzym GUS ở các dòng cây thuốc lá chuyển gen mang promoter rd29A trong điều kiện hạn nhân tạo ĐC: mẫu cây đối chứng không chuyển gen; 3, 4, 5: các dòng cây chuyển gen, T: trước xử lý hạn, S: sau xử lý hạn. Hoạt tính của enzym GUS còn được xác định thông qua phản ứng chuyển hóa cơ chất (MUG). Enzym GUS xúc tác cho phản ứng chuyển hóa MUG thành MU, hoạt tính của gen enzym GUS càng mạnh thì MU được tạo ra càng nhiều. MU được phát hiện bằng phép đo độ hấp thụ ở bước sóng 378 nm ( Fior và đtg 2009). Lượng MU đo được sau xử lý hạn cao hơn so với trước xử lý hạn từ 6 - 13 lần ( hình 3.21). Những số liệu này hoàn toàn thống nhất với công bố của (Zhang và đtg 2005) 3.4. Đánh giá khả năng tăng cường khả năng chịu hạn của cây thuốc lá chuyển gen mang cấu trúc rd29A:: P5CSM 3.4.1. Thiết kế vector chuyển gen mang cấu trúc rd29A:: P5CSM Kết quả cắt P5CSM và rd29A :: GUS bằng BamHI và SacI. Và thực hiện phản ứng ghép nối . bằng enzym T4 ligaza và biến nạp sản phẩm ghép nối vào tế bào khả biến E.coli chủng DH5α, 15 A B Hình 3.23. Điện di sản phẩm clony- PCR và cắt hạn chế vector pBT rd29A:: P5CSM Kết quả của phản ứng cắt bằng enzym giới hạn và colony-PCR (Hình 3.23) đã khẳng định chắc chắn cả 3 dòng khuẩn lạc đều có chứa vector chuyển gen, nghĩa là chúng tôi đã thiết kế thành công cấu trúc gen chuyển mang gen chịu hạn rd29A:: P5CSM được ghép nối thành công vào vector tách dòng pBT. Kết quả biến nạp vector chuyển gen rd29A:: P5CSM vào A. tumefaciens Kết quả PCR được điện di kiểm tra trên gel agarose 0,8% cho thấy: có 4 trong 9 dòng khuẩn lạc được lựa chọn cho kết quả dương tính với phản ứng PCR với 1 băng duy nhất có kích thước khoản 1300 bp. Điều này chứng tỏ đã biến nạp thành công vector rd29A:: P5CSM vào tế bào A. tumefaciens.. Như vậy chúng tôi đã tạo được chủng A. tumefaciens pGV2260 mang plasmid tái tổ hợp rd29A:: P5CSM. Đây chính là nguồn nguyên liệu phục vụ cho mục đích chuyển gen tạo cây trồng chống chịu hạn. 3.4.2. Tạo cây thuốc lá chuyển gen mang cấu trúc rd29A:: P5CSM Cấu trúc chuyển gen pBI101 mang promoter rd9A điều khiển hoạt động của gen P5CS được chuyển vào mảnh lá cây thuốc lá giống K326 1 2 3 M M 1 2 3 - + 1.3kb 12kb 3,4kb 16 Hình 3.25. Kết quả PCR các dòng chuyển gen bằng cặp mồi rd29A for /rd29Arev M: Marker DNA 1kb; 1-9: Các dòng chuyển gen; (-) Đối chứng âm; (+) Đối chứng dương Hình 3.25 cho thấy, trong số 33 dòng kiểm tra thu được 30 dòng cho phản ứng dương tính, các giếng xuất hiện một vạch AND có kích thước khoảng 1,4kb. Đây là kích thước tương ứng của promoter rd29A. Điều này chứng tỏ các dòng cây này có mang cấu trúc rd29A:: P5CSM mong muốn. 3.4.3. Đánh giá khả năng chịu hạn của các dòng thuốc lá chuyển gen. Các mẫu lá của các dòng thuốc lá chuyển gen và đối chứng đã được thu trước gây hạn và sau khi gây hạn 3, 5, 7 và 9 ngày. Các mẫu được tách chiết và kiểm tra hàm lượng prolin. Kết quả trình bày ở bảng 3.7 và hình 3.25. Sau khi gây hạn nhân tạo, hàm lượng prolin tăng rất mạnh so với trước gây hạn ở tất cả các dòng cây nghiên cứu, đặc biệt các dòng cây chuyển gen. Sau 9 ngày gây hạn, prolin ở cây đối chứng không chuyển gen tăng 206.8%, trong khi đó với cây chuyển gen tăng từ 259,5-451,8% (cao nhất ở dòng H33 và thấp nhất dòng H11). M 1 2 3 4 5 6 7 8 9 - + 17 Hình 3.27. Các dòng cây thuốc lá sau 20 ngày hạn nhân tạo (A) và sau phục hồi (B) WT: cây đối chứng không chuyển gen, H11, H15, H26, H33: các dòng cây chuyển gen 3.5. Kết quả tạo cây đậu tương chuyển gen 3.5.1. Kết quả tái sinh tạo đa chồi ở giống đậu tương DT84 3.5.1.1. Tối ưu thời gian khử trùng hạt So sánh hai phương pháp khử trùng (bằng khí clo và bằng Javen), chúng tôi nhận thấy phương pháp khử trùng bằng khí clo đã tỏ ra ưu thế hơn, vì vậy chúng tôi lựa chọn phương pháp khử trùng này trong thời gian khử trùng là 16 giờ để khử trùng hạt thu nguyên liệu cho các thí nghiệm tiếp theo. 3.5.1.2. Ảnh hưởng của BAP đến khả năng tạo đa chồi từ lá mầm hạt chín Các mẫu này sau khi gây tổn thương và cắt bỏ đỉnh sinh trưởng, chúng được tạo đa chồi trên 8 loại môi trường (SIM0-SIM7) chứa nồng độ BAP từ 0mg/l đến 2,5 mg/l. Như vậy chúng tôi lựa chọn nồng độ BAP là 2 mg/l (SIM4) để bổ sung vào môi trường tạo đa chồi và sử dụng kết quả này cho các thí nghiệm tiếp theo. 3.5.1.3. Ảnh hưởng của hocmon sinh trưởng GA3,tới khả năng kéo dài chồi. Các cụm chồi tạo trên môi trường SIM4 được chuyển sang 4 môi trường (SEM0-SEM3) có bổ sung GA3 với các nồng độ tương ứng là 0,5 18 mg/l, 1 mg/l và 1,5 mg/l Những kết quả thu được nhận thấy sự phối hợp giữa GA3 (0,5 mg/l) là thích hợp cho quá trình kéo dài chồi. Kết quả này cũng phù hợp với một số kết quả nghiên cứu của các tác giả khác đã công bố (Olhoft và đtg 2007), Olhoft và đtg 2001) 3.5.1.4. Ảnh hưởng của IBA đến hiệu quả tạo rễ. Nồng độ IBA chúng tôi đã nghiên cứu nhận thấy 0,1 mg/l là nồng độ thích hợp nhất cho việc ra rễ của cây đậu tương in vitro giống DT84. 3.5.1.5. Xác định giá thể thích hợp cho ra cây in vitro Thử nghiệm 3 loại giá thể khác nhau là: trấu hun, 1 trấu hun:1 cát vàng và hỗn hợp trồng cây có bán sẵn. Hai yếu tố được đánh giá trong thí nghiệm này là tỉ lệ sống của cây con và chất lượng cây con. Căn cứ vào chất lượng cây con kết quả nhận thấy với tỷ lệ giá thể là 1 trấu hun: 1 cát vàng là phù hợp..Sau hai tuần chúng tôi chuyển ra đất. 3.5.2. Kết quả bước đầu chuyển gen GUS vào cây đậu tương DT84. Tỷ lệ biểu hiện tạm thời gen gus thu được là 67,5%. Tỷ lệ mẫu sống sót sau 2 tuần trên môi trường chọn lọc là 15,21%. 3.5.3. Kết quả chuyển cấu trúc gen chịu hạn vào đậu tương Thí nghiệm được tiến hành trên 3 lô thí nghiệm với tổng số 1262 mẫu được sử dụng cho chuyển gen, có 564 số mẫu tạo chồi, 101 số mẫu kéo dài chồi, trong quá trình chọn lọc kháng sinh có 28 cây sống sót ra rễ và trồng ở nhà lưới. Để kiểm tra sự có mặt của gen chuyển, sau khi ra cây khoảng 1 tháng, mẫu lá của các dòng cây T0 được tiến hành thu để tách chiết DNA tổng số. Kết quả điện di sản phẩm PCR cho thấy đã thu nhận được 3 cây dương tính với phản ứng PCR. 19 Hình 3.36. Kiểm tra cây đậu tương T0 chuyển gen bằng PCR M: Thang DNA chuẩn 1kb; (-): Đối chứng âm; WT: Cây không chuyển gen; 1 -4: Các dòng T0 được phân tích; (+): Đối chứng dương (plasmid) Dòng 11 Dòng 23 Dòng 17 Hình 3.37. Cây đậu tương T0 chuyển gen KẾT LUẬN VÀ ĐỀ NGHỊ 1. Kết luận 1.1. Giống đậu tương địa phương sưu tập được có sự đa dạng và phong phú về hình thái, kích thước và khối lượng hạt. Phân tích về chỉ tiêu hóa sinh cho thấy các giống đậu tương địa phương có chất lượng và khả năng chịu hạn cao hơn so với giống đối chứng. Đã xác định được mối liên quan giữa tỷ lệ tăng hàm lượng prolin và khả năng chịu hạn của các giống đậu tương trong phạm vi nghiên cứu. 1.2. Trình tự gen P5CS của hai giống đậu tương DT84 và SL5 đã được phân lập gồm có 2148 nucleotit, mã hóa 715 axit amin. M 1 2 3 4 5 WT - + 20 1.3. Đã tạo đột biến ở bộ ba có vị trí thứ 125 của gen P5CS của giống đậu tương SL5, thay thế Asp bằng Ala trong trình tự protein. 1.4. Promoter rd29A đã được phân lập thành công từ cây A.thaliana. Promotor rd29A có chiều dài 1298bp mang các trình tự đặc trưng gồm các nhân tố cis thuộc nhóm MYB, DRE, AMYBOX nhân tố đặc trưng của promoter và nhân tố cảm ứng điều kiện khô hạn. 1.5. Khả năng hoạt động của promtor rd29A đã được đánh giá trong cây thuốc lá chuyển gen. Trong điều kiện thiếu nước, promoter rd29A đã điều khiển gen chỉ thị GUS biểu hiện khá mạnh và rõ ràng ở các dòng thuốc lá chuyển gen được xử lý bởi hạn nhân tạo so với các dòng cây chuyển gen không xử lý và cây đối chứng. 1.6. Đối với các dòng cây thuốc lá chuyển gen mang cấu trúc rd29A:: P5CSM , có hiện tượng tăng cao hàm lượng prolin sau khi gây hạn nhân tạo, dẫn đến khả năng sống sót cao hơn các cây đối chứng (không chuyển gen). Khả năng phục hồi của các dòng cây chuyển gen nhanh hơn các cây đối chứng. 1.7. Tối ưu được quy trình tái sinh và chuyển gen thông qua mô nách lá mầm ở đậu tương. Bước đầu chuyển thành công cấu trúc gen rd29A:: P5CSM vào giống đậu tương DT84, và thu được một số dòng dương tính PCR đối với gen chuyển. 2. Đề nghị 2.1. Tiếp tục nghiên cứu, phân tích các dòng cây đậu tương chuyển gen chịu hạn phục vụ cho chọn tạo giống. 2.2. Mở rộng sử dụng cấu trúc promoter rd29A:: GUS và rd29A:: P5CSM vào các đối tượng cây trồng khác.

Các file đính kèm theo tài liệu này:

  • pdftom_tat_tieng_viet_ncs_ng_thi_thuy_huong_05_2011t_3534.pdf
Luận văn liên quan