Ứngdụng phương pháp PCR phát hiện vi khuẩn aeromonas hydrophila phân lập từ cá tra (pangasianodon hypophthamus ) bị bệnh xuất huyết

Từ kết quả điện di sản phẩm PCR xác định độ nhạy và tính chuyên biệt của phương pháp PCR phát hiện A. hydrophila, cho phép phát hiện nhanh vàsớm các mầm bệnh ở dạng tiềm ẩn. Nên có thể kịp thời xử lý ao nuôi hạn chế rũi ro xảy ra. Đây sẽ là hướng đi mới trong việc chẩn đoán bệnh xuất huyết do A. hydrophila gây ra trên cá tra nuôi. Tuy nhiên phương pháp PCRt ốn kém và cần thiết phải có máy móc hiện đại hơn phương pháp sinh hóa truy ền thống và kítAPI 20E.

pdf46 trang | Chia sẻ: lylyngoc | Ngày: 06/11/2013 | Lượt xem: 3127 | Lượt tải: 6download
Bạn đang xem nội dung tài liệu Ứngdụng phương pháp PCR phát hiện vi khuẩn aeromonas hydrophila phân lập từ cá tra (pangasianodon hypophthamus ) bị bệnh xuất huyết, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
ác nhân gây bệnh vàng da trên cá tra. Nhiễm khuẩn huyết do vi khuẩn Aeromonas Nhóm vi khuẩn gây bệnh chủ yếu thuộc giống Aeromonas gồm có A. hyrophila, A. caviae và A. sobria. Vi khuẩn có mặt trong nước có nhiều chất hữu cơ. Cá con dễ mẫn cảm hơn cá trưởng thành, có thể gây chết đến 80%. Nhiễm khuẩn do Pseudomonas (Bệnh đốm đỏ) Tác nhân gây bệnh do Pseudomonas fluorescens, P. anguilliseptica, P. Chlororaphis. Cá bị bệnh này có dấu hiệu xuất huyết từng đốm nhỏ trên da, xung quanh miệng và nắp mang, phía mặt bụng, bề mặt cơ thể chảy máu, tuột nhớt nhưng không xuất huyết vây và hậu môn. Nhiễm khuẩn huyết do Edwardsiella. Bệnh do vi khuẩn E. tarda gây ra. Xuất hiện những vết thương nhỏ trên da (phía mặt lưng). Những vết thương này sẽ phát triển thành những khối u rỗng bên trong cơ và da bị mất sắc tố. Cá mắc bệnh sẽ mất chức năng vận động do vây đuôi bị rách, gẫy. Có thể xuất hiện những vết thương bên dưới biểu bì, cơ, khi ấn vào sẽ phát ra khí có mùi hôi. Các vết thương này sẽ gây hoại tử vùng cơ xung quanh. Ngoài ra, Trần Thị Ngọc Hân (2006) thí nghiệm gây cảm nhiễm trên cá tra bằng 2 phương pháp ngâm và tiêm E.ictaluri kết quả đến ngày thứ 10 bên ngoài cá có hiện tượng xuất huyết vây đuôi, trên thận có đốm trắng. Vi khuẩn là một trong những nhóm tác nhân gây bệnh trên động vật thủy sản mà chủ yếu thường gặp nhất là nhóm vi khuẩn gram âm, tác nhân vi khuẩn được coi là tác nhân sơ cấp hoặc tác nhân thứ cấp gây bệnh cho các loài thủy sản (Inglish et al., 1993). Mặc khác theo Buler (2004) vi khuẩn không chỉ tồn tại trên vật chủ mà còn tồn tại ngay trong môi trường nước với mật độ tùy theo chất lượng nước (trích dẫn bởi Nguyễn Hà Giang, 2008). Vi khuẩn A. hydrophila là một trong những loài vi khuẩn gây bệnh nguy hiểm và thường gặp trên cá tra hiện nay. PDF created with FinePrint pdfFactory Pro trial version 7 2.5 Sơ lược về vi khuẩn A. hydrophila gây bệnh trên cá tra Tác nhân gây bệnh Theo Bùi Quang Tề (2005) giống vi khuẩn Aeromonas thuộc họ Aeromonadaceae, bộ Aeromonadales, lớp Gammaproteobacteria, ngành Proteobacteria. Trong giống Aeromonas có 2 nhóm, (1) loài vi khuẩn không di động (A. salmonicida) thường gây bệnh ở cá nước lạnh, (2) các loài vi khuẩn di động bao gồm (A. hydrophila, A. caviae, A. sobria), đặc tính chung của 3 loài vi khuẩn này là di động nhờ có 1 tiêm mao, vi khuẩn gram âm, hình que ngắn, hai đầu tròn, phản ứng oxidase dương tính, khử nitrat, không mẫn cảm với thuốc thử O/129. Các loài vi khuẩn Aeromonas di động đều được phân lập từ cá nước ngọt nhiễm bệnh, thường gặp nhất là A. hydrophila (trích dẫn bởi Huỳnh Thị Phượng Quyên, 2008). Theo Bergey (1957), vi khuẩn Aeromonas thuộc họ Aeromonadaceae, bao gồm 3 loài A. hydrophila, A. caviae, A. sobria. Bệnh đốm đỏ còn gọi là bệnh xuất huyết, bệnh nhiễm trùng máu, bệnh sởi,… là bệnh do vi khuẩn A. hydrophila. Vi khuẩn A. hydrophila phát triển trên môi trường thạch có khuẩn lạc tròn, màu vàng rất nhạt, rìa đều hơi lồi, ướt, nhẵn bóng. Vi khuẩn di động (có 1 tiêm mao), gram âm, oxidase dương tính, kháng với O/129, hiếu khí và hiếm khí không bắt buộc, có khả năng lên men, hình que ngắn dài 2-3 µm, hai đầu hơi tròn. Nuôi cấy chúng phát triển tốt nhất ở nhiệt độ 28-30oC, sinh trưởng trong môi trường có độ pH thích hợp 7,1-7,2 (trích dẫn bởi Từ Thanh Dung, 2008). Theo Lewis & Plumb (1979) cho rằng trong các chủng vi khuẩn thuộc giống Aeromonas thì A. hydrophila được xem là chủng gây bệnh cho cá nước ngọt quan trọng nhất, gây bệnh nhiễm trùng máu, xuất huyết ở những loài cá nuôi và cá tự nhiên, theo Angka (1990) A. hydrophila cũng gây bệnh lở loét cho cá tại Java-Indonesia và gây tỉ lệ chết từ 80-90% (trích dẫn bởi Ngô Minh Dung, 2007). Bên cạnh đó trong báo cáo của Saitanu et al., (1982) đã tìm thấy vi khuẩn A. hydrophila gây bệnh xuất huyết do bệnh nhiễm trùng máu trên cá chép. Dấu hiệu bệnh lý Cá bị nhiễm A. hydrophila có biểu hiện chung là da thường đổi màu tối, không có ánh bạc, cá mất nhớt, khô ráp, xuất hiện các đốm xuất huyết đỏ trên (thân, các gốc vây, quanh miệng), hậu môn xuất huyết, mắt lồi đục. Ở cá tra và cá basa xoang bụng xuất huyết, mô mở xuất huyết nặng, gan tái nhợt, mật sưng to, thận sưng, ruột dạ dày bóng hơi đều xuất huyết, xoang bụng chứa nhiều PDF created with FinePrint pdfFactory Pro trial version 8 dịch nhờn có mùi hôi thối, cá trê giống bị bệnh thường tách đàn và treo râu (Bùi Quang Tề, 2006). Theo Từ Thanh Dung (2008) cá bị bệnh sẫm màu từng vùng ở bụng, xuất hiện từng mảng đỏ trên cơ thể, đuôi và vây bị hoại tử, xuất hiện các vết thương trên lưng, các khối u trên bề mặt cơ thể, vẩy dễ rơi rụng, mắt lồi mờ đục, xoang bụng chứa dịch nội tạng hoại tử. Bệnh đốm đỏ, xuất hiện vào lúc giao mùa, nhiễm trên cả cá tra, basa và nhiều loài cá khác. Bệnh gây ra do một số loài vi khuẩn như A. hydrophila và Pseudomonas fluorescens. Cá bị bệnh thường bơi lờ đờ trên mặt nước, trên thân xuất hiện điểm xuất huyết nhỏ li ti, nếu bệnh nặng thì các gốc vây cũng xuất huyết. Bụng cá trương to, thành ruột xuất huyết, cá ít ăn hoặc bỏ ăn. Các tia vây lưng, hậu môn và vây đuôi bị rách xơ xác (Bộ thủy sản, 2008). A. hydrophila, A. caviae và A. sobria cả 3 loài phân lập được trên cá khi có dấu hiệu bệnh nhiễm khuẩn huyết, mặt dù A. hydrophila là loài thường gặp nhất. Thỉnh thoảng cũng phân lập được vi khuẩn gram âm khác như Pseudomonas fluorescens (theo Roberts & Horne 1978, Schaperclaus 1926) hoặc Proteus rettgeri trên cá bị nhiễm khuẩn huyết (theo Bejerano et al. 1976), có thể phân lập được đĩa cấy thuần của một chủng, hoặc kết hợp nhiều chủng thì gây ảnh hưởng cao hơn (trích dẫn bởi Inglis et al, 1993). Phân bố và lan truyền bệnh Đỗ Thị Hòa và ctv (2004) bệnh nhiễm trùng do A. hydrophila thường gặp ở nhiều loài động vật thủy sản nước ngọt ở nhiều nước khác nhau như Trung Quốc, Nhật Bản, Đài Loan, Thái Lan, Úc,…Ở Việt Nam, các loài cá nuôi lồng, bè và ao hồ nước ngọt đều có thể bị bệnh như: cá trắm cỏ, tra, basa, trôi, chép, mè, trê,… Tỷ lệ tử vong ở động vật thủy sản thường từ 30-70%. Bệnh có thể xảy ra ở các giai đoạn khác nhau từ cá giống, cá thịt và cá bố mẹ. Ở Việt Nam bệnh do A. hydrophila có thể xuất hiện quanh năm, nhưng thường tập trung vào mùa xuân và mùa thu ở miền Bắc, ở miền Nam bệnh xuất hiện nhiều vào đầu mùa mưa, mùa có nhiệt độ 25-28oC. Ở Châu Âu, bệnh do A. hydrophila trên cá chình thường xuất hiện vào mùa xuân-hè, nhiệt độ nước khoảng 17-22oC, đây là khoảng nhiệt độ cho vi khuẩn này phát triển (Esteve et al., 1993 trích dẫn bởi Ngô Minh Dung, 2007). Chẩn đoán bệnh Theo Từ Thanh Dung (2008), chẩn đoán bệnh do Aeromonas là dựa vào các dấu hiệu bệnh lý, mùa vụ xuất hiện bệnh, kết quả phân lập bằng phương pháp truyền thống. Để phát hiện bệnh nhanh và ở giai đoạn sớm của bệnh cần áp PDF created with FinePrint pdfFactory Pro trial version 9 dụng phương pháp PCR (Polymerase Chain Reaction), hoặc ELISA (Enzyme Linked Immunosorbent Assay). Một số nghiên cứu về A. hydrophila Groberg (1978) khi gây cảm nhiễm A. hydrophila trên cá hồi giống đã kết luận tỷ lệ chết thường cao ở 20,5oC và 17oC, tỷ lệ chết thấp hơn ở 15oC và 12oC, còn ở 9oC hay thấp hơn nữa thì cá chết rất ít hoặc không chết (Roselynn and Stevenson, 1988; trích dẫn bởi Ngô Minh Dung, 2007). Theo báo cáo của Rahman et al., (2000) thí nghiệm gây cảm nhiễm A. hydrophila trên cá vàng (Carassius auratus) bằng 4 cách: tiêm ở bụng (mật độ vi khuẩn 3x104-3x108 CFU/ml), tiêm dưới da (8,5x104-8,5x108 CFU/ml), tiêm ở cơ (8x104-8x108 CFU/ml), và ngâm vi khuẩn (4,6x104-4,6x108 CFU/ml), sau khi so sánh kết quả gây cảm nhiễm bằng phương pháp tiêm dưới da độc lực của vi khuẩn mạnh nhất với giá trị LD50 là 106,4 CFU/ml (trích dẫn bởi Ngô Minh Dung, 2007). Ngoài ra, Đoàn Nhật Phương (2001) đã thí nghiệm gây cảm nhiễm 15 chủng A. hydrophila trên cá chép bằng phương pháp tiêm với mật độ vi khuẩn từ 103 đến 107 CFU/ml trong thời gian 14 ngày, qua 2 lần thí nghiệm thì các chủng vi khuẩn độc lực mạnh có giá trị LD50 lần lược là 3,68x106 CFU/ml, 2,64x106 đến 4,52x106 CFU/ml và 1,96x106 đến 1,45x107 CFU/ml. 2.6 Phương pháp PCR 2.6.1 Khái niệm về PCR Kỹ thuật phản ứng chuỗi trùng hợp (Polymerase Chain Reaction - PCR) do Karl Mullis et al phát minh năm 1985. Thực chất đây là một phương pháp tạo dòng DNA invitro không cần có sự hiện diện của tế bào (trích dẫn bởi Đặng Thị Hoàng Oanh, 2007). Nguyên tắc của phản ứng PCR (xem hình 2.1). PDF created with FinePrint pdfFactory Pro trial version 10 Hình 2.1 Nguyên lý kỹ thuật PCR (Khuất Hữu Thanh, 2003) PCR là kỹ thuật khuếch đại trình tự DNA chuyên biệt trong ống nghiệm từ một đoạn DNA với sự hiện diện của một hoặc hai đoạn mồi (oligonucleotides), enzyme tổng hợp DNA, các nucleotide tự do và dung dịch đệm (buffer) theo các chu kỳ nhiệt. PCR có tính nhạy cao và cho phép tìm ra nhanh chống, thậm chí với một tiểu phần virus. Hiện nay PCR được ứng dụng rộng rãi trong nhiều lĩnh vực nghiên cứu để chẩn đoán và phát hiện mầm bệnh. Theo Đặng Thị Hoàng Oanh ( 2007) phản ứng PCR là một chuỗi gồm nhiều chu kỳ nối tiếp nhau, mỗi chu kỳ gồm 3 giai đoạn là: Giai đoạn 1 (biến tính – denaturation): Trong một dung dịch phản ứng bao gồm các thành phần cần thiết cho sự sao chép DNA, phân tử DNA được biến tính ở nhiệt độ cao hơn nhiệt độ nóng chảy (Tm) cuả phân tử, thường là 94- 95oC trong 30 giây đến 1 phút. Đây là giai đoạn mạch đôi tách thành 2 mạch đơn. Giai đoạn 2 (lai –hybridization): Trong bước này nhiệt độ được hạ thấp hơn Tm của các mồi cho phép mồi bắt cặp với khuôn. Trong thực nghiệm, nhiệt độ này dao động trong khoảng 40-70oC. Tùy thuộc vào Tm của các đoạn mồi sử PDF created with FinePrint pdfFactory Pro trial version 11 dụng mà thời gian bắc cặp khác nhau và kéo dài từ 30 giây đến 1 phút. Đây là giai đoạn quyết định tính đặc hiệu của phản ứng. Giai đoạn 3 (tổng hợp –extension): Nhiệt độ được tăng lên 72oC, đó là điều kiện tốt nhất để cho Taq polymerase hoạt động tổng hợp kéo dài mạch theo nguyên tắc bổ sung từ hai đầu sợi khuôn ban đầu giúp cho DNA polymerase hoạt động. Thời gian tùy thuộc độ dài của trình tự DNA cần khuếch đại, thường kéo dài từ 30 giây đến nhiều phút. Sau một chu kỳ gồm ba giai đoạn như trên, một phân tử DNA khuôn được nhân lên thành hai, các đoạn DNA vừa được nhân lên trong chu kỳ lại làm khuôn cho chu kỳ nhân bản tiếp theo. Do đó sau mỗi chu kỳ số lượng DNA được tổng hợp sẽ tăng lên gấp đôi và như vậy sau (n) chu kỳ nhân bản sẽ tạo ra 2 n bản DNA từ một khuôn ban đầu. PCR có nhiều ứng dụng vào các mục đích khác nhau, như phân tích hệ gen của động vật và thực vật vì nó cho phép tạo ra một lượng lớn các đoạn trình tự đặc hiệu, xác định trình tự của DNA được nhân bản. PCR cũng được dùng để phân tích tiến hóa, phân tích sự đa dạng di truyền ở mức độ DNA trong và giữa các quần thể. PCR là một công cụ hữu hiệu cho việc phát hiện mầm bệnh vi khuẩn, vi rút, ký sinh trùng và nấm. Một số mầm bệnh thủy sản quan trọng ở trên tôm hiện nay được chẩn đoán bằng PCR như virus đốm trắng (WSSV), virus đầu vàng (YHV), virus gây hội chứng Taura (TSV), virus gây hoại tử cơ quan tạo máu và cơ quan tạo lập biểu mô (IHHNV) (Đặng Thị Hoàng Oanh, 2007). Không chỉ đối với vi khuẩn mà cả virus, multiplex PCR (mPCR) đã có những bước phát triển mới phát hiện nhiều loại bệnh cùng lúc, đem lại các kết quả chẩn đoán nhanh, chính xác, tiết kiệm thời gian và công sức. Yang et al. (2006) đã phát triển phương pháp m PCR phát hiện đồng thời hai loại virus IHHNV và WSSV trên tôm he. 2.6.2 Các nhân tố ảnh hưởng tới phản ứng PCR DNA khuôn: Khuất Hữu Thanh (2003) khuôn DNA có vai trò rất quan trọng, ảnh hưởng rõ rệt đến hiệu quả PCR. Phản ứng tối ưu với các đoạn khuôn hoàn toàn tinh sạch, nhưng khi các đoạn khuôn không sạch có lẫn các protein thì hiệu quả giảm theo tỉ lệ thuận với độ tinh sạch của DNA khuôn. Enzyme: DNA polymerase càng mạnh, phản ứng PCR càng triệt để. Tùy các đặc tính của DNA polymerase, tùy thuộc nguồn gốc tách chiết enzyme mà hiệu quả phản ứng khác nhau. PDF created with FinePrint pdfFactory Pro trial version 12 Mồi và nhiệt độ gắn mồi: Mồi là yếu tố quan trọng quyết định hiệu quả phản ứng PCR. Chọn mồi cần tính toán để bảo đảm Tm của mồi xuôi và mồi ngược không chênh lệch nhau quá lớn, thông thường trong khoảng 4-5oC và nhiệt độ nóng chảy của mồi khoảng 72oC. Độ dài mồi cần chọn khoảng 18-30 nucleotide, nếu mồi nhỏ hơn 10 nucleotide mồi bám không đặc hiệu. Còn mồi dài hơn 30 nucleotide sẽ ảnh hưởng đến cơ chế tổng hợp ở bước 3 (Trần Thị Xô và Nguyễn Thị Lan, 2005). Các mồi phải có trình tự nucleotide chỉ có thể bắt cặp bổ sung ở hai đầu của các mạch khuôn, nếu mồi bắt cặp ở giữa khuôn PCR không thành công. Tỷ lệ G-C giữa các mồi thường chiếm khoảng 40- 75% để đảm bảo liên kết gắn mồi với khuôn bền vững. Tuy nhiên trình tự G-C không lặp lại quá nhiều lần trong một mồi. Các mồi chọn phải đặc trưng cho trình tự DNA cần khuếch đại. Trình tự DNA cần khuếch đại là trình tự nằm giữa hai mồi không quá lớn 1 kb. Sợi DNA được tổng hợp khi đầu 3’ của mồi đã liên kết với khuôn mặc dầu đầu 5’ có thể tự do. Do đó đầu 5’ của mồi có thể được gắn thêm linker, hoặc đoạn nucleotide điều khiển (promoter). Thể tích mồi khoảng 0,1 mM đến 0,5 mM. Thể tích mồi thường được xác định dựa vào giá trị OD đo ở 260 nm (Võ Thị Thương Lan, 2006). Nồng độ các loại nucleotide tự do: Nồng độ các loại nucleotide (dATP, dGTP, dCTP, dTTP) khoảng 20-200 µM/ mỗi loại, khi nồng độ nucleotide quá thấp sẽ giảm hiệu quả PCR, ngược lại nồng độ nucleotide quá cao dễ dẫn đến sự khuếch đại “ký sinh” (Khuất Hữu Thanh, 2003). Nồng độ Mg2+: Theo Trần Thị Xô và Nguyễn Thị Lan (2005) ion Mg2+ là thành phần không thể thiếu được của phản ứng PCR, nồng độ Mg2+ tối ưu để thực hiện phản ứng PCR từ 150-200 µM. Nước sử dụng cho phản ứng phải tinh khiết, không chứa bất kỳ ion lạ nào. Không chứa các enzyme cắt hạn chế và các enzyme phân hủy acid nucleic. Môi trường dung dịch đệm phải ổn định. Dung tích tổng số cho một phản ứng PCR khoảng từ 29-50 µl. Chu kỳ phản ứng: Theo Hồ Huỳnh Thùy Dương (2003) số lượng chu kỳ PCR thường không vượt quá 40 chu kỳ cho một phản ứng. Sở dĩ như vậy là vì phản ứng PCR diễn tiến qua 2 giai đoạn, trong giai đoạn đầu số lượng bản sao tăng theo cấp số nhân tỉ lệ với lượng mẫu ban đầu, sau đó hiệu quả khuếch đại giảm hẳn vì những nguyên nhân sau: (1) sự phân hủy và cạn kiệt các thành phần của phản ứng, (2) sự xuất hiện các sản phẩm phụ ức chế phản ứng, (3) các bản sao vừa được tổng hợp không kết hợp với mồi mà bắt cặp với nhau,… 2.6.3 Ứng dụng của kỹ thuật PCR trong thủy sản Theo Trần Thị Tuyết Hoa (2004) thì ứng dụng của PCR là: Phát hiện nhanh tác nhân gây bệnh ở dạng tiềm ẩn, giúp cho quá trình chọn lọc cá thể thủy sản PDF created with FinePrint pdfFactory Pro trial version 13 có chất lượng tốt trong chọn giống và ương nuôi như: (1) Giúp chẩn đoán bệnh: điều tra nguyên nhân bùng nổ bệnh và cách giải quyết. (2) Phòng bệnh: kiểm tra tôm bố mẹ và tôm giống ở trại sản xuất giống. (3) Kiểm soát bệnh: theo dõi kiểm tra theo khu vực và kiểm tra tôm giống nhập khẩu. Ứng dụng trong đánh giá an toàn hàng thủy sản xuất khẩu - Sự nhiễm khuẩn hàng thủy sản bởi Vibrio parahaemolyticus, Escherichia coli. Góp phần vào quy trình xác định trình tự nucleotide đột biến của tác nhân gây bệnh, hay có thể là các loài đông vật thủy sản. Theo Đặng Thị Hoàng Oanh (2007) ở các lĩnh vực khác kể cả thủy sản, PCR là một công cụ hữu hiệu trong việc phát hiện mầm bệnh vi khuẩn, virus, ký sinh trùng và nấm. Một số mầm bệnh thủy sản quan trọng ở tôm nuôi hiện nay được chẩn đoán bằng PCR bao gồm: virus đốm trắng (WSSV), virus đầu vàng (YHV), virus gây hoại tử cơ quan tạo máu và cơ quan lập biểu mô (IHHNV), virus gây hội chứng Taura (TSV). 2.6.4 Đối chứng Một xét nghiệm PCR tiêu chuẩn cần có những đối chứng sau. - Không có DNA/RNA: phản ứng PCR không có mạch khuôn DNA để kiểm soát trường hợp bị tạp nhiễm. - DNA/mRNA của vật chủ: để chắc chắn acid nucleic mẫu cũng được khuếch đại và mồi không đặc hiệu với hệ gen của vật chủ. 2.6.5 Hạn chế của PCR - Phương pháp PCR thường không hoạt động với những đoạn DNA có chiều dài lớn hơn 3kb ( kết quả tốt với những đoạn DNA có chiều dài nhỏ hơn 1,5 kb). - Dễ bị nhiễm do sản phẩm khuếch đại của những lần thao tác trước, dễ bị tạp nhiễm do tính nhạy cảm và lỗi thao tác. - Các sai sót gây ra do Taq DNA polymerase (khoảng 10.000 nucleotic thì enzyme gắn sai một nucleotic). - Phương pháp này không phân biệt được tế bào sống với tế bào chết, do vậy có thể dẫn tới trường hợp dương tính giả do DNA từ tế bào chết gây ra. Bên cạnh đó việc phát hiện mầm bệnh riêng lẽ bằng PCR thường gây tốn kém, do đó các nhà nghiên cứu tìm cách làm giảm chi phí bằng cách sử dụng đồng thời nhiều cặp mồi trong một phản ứng PCR để phát hiện PDF created with FinePrint pdfFactory Pro trial version 14 cùng lúc nhiều vi sinh vật gây bệnh khác nhau (Trần Linh Phước, 2003; trích dẫn bởi Phạm Thị Thu Trang, 2005). PDF created with FinePrint pdfFactory Pro trial version 15 Chương 3 VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1 Thời gian và địa điểm nghiên cứu 3.1.1 Thời gian Thời gian nghiên cứu từ tháng 12/2008 – 05/2009 3.1.2 Địa điểm - Thu mẫu: Cần Thơ, Vĩnh Long và Đồng Tháp. - Nghiên cứu: Phòng thí nghiệm Bộ môn Sinh học và Bệnh Thủy sản – Khoa Thủy sản, trường Đại học Cần thơ. 3.1.3 Nội dung thực hiện - Thu mẫu cá tra bệnh. - Phân lập vi khuẩn ở các cơ quan (gan, thận, tỳ tạng) của cá tra bị bệnh xuất huyết. - Phục hồi vi khuẩn đã được định danh và trữ trong glycerol 50%. Cấy vi khuẩn trực tiếp lên môi trường thạch đặc trưng Aeromonas agar + Ampicillin. - Tách vi khuẩn sang môi trường NA, nuôi tăng sinh vi khuẩn trong NB. - Dùng phương pháp PCR phát hiện A. hydrophila. - Xác định độ nhạy và tính chuyên biệt của phương pháp PCR. 3.2 Vật liệu nghiên cứu 3.2.1 Thiết bị - Dụng cụ - Máy chu kỳ nhiệt, máy so màu quang phổ, máy ủ, máy li tâm, máy vortex, máy lắc, máy PCR, lò viba, bộ điện di, bàn đọc UV, bộ chụp ảnh gel, máy vi tính. - Cân điện tử, pipet tự động, tủ lạnh, tủ đông, tủ sấy, nồi autoclave. - Ống eppendorf 1,5 ml và 0,5 ml. - Đầu col pipet các loại. - Ống nghiệm, đĩa Petri, cốc thủy tinh, ống đong, chai nấu môi trường. - Đèn cồn, bình xịt cồn, que cấy, hộp quẹt. - Hộp đá lạnh, giấy vệ sinh, găng tay, bọc nylon và viết lông dầu. PDF created with FinePrint pdfFactory Pro trial version 16 3.2.2 Hóa chất thí nghiệm - Môi trường nuôi cấy phục hồi vi khuẩn: Nutrient Agar (NA), Aeromonas agar + Ampicillin (18,35g agar + 1 lọ trong 500ml nước), Nutrient Broth (NB). - Loading dye 6X, ethidium bromide, agarose, dung dịch chạy điện di TAE. - NB (8g Nutrient Broth, trong 1 lít nước cất). - TE (pH 8.0) gồm 10 mM Tris HCl và 1mM EDTA. - Hóa chất dùng trong khuếch đại DNA: Buffer 10X, MgCl2, dNTPs (10 mM), Taq DNA polymerase (5U), mồi, nước cất 2 lần. - Cồn tuyệt đối, nước cất, NaCl. Bảng 3.1 Trình tự 2 đoạn mồi sử dụng trong qui trình PCR (Panangala et al., 2007). 3.3 Phương pháp nghiên cứu 3.3.1 Thu mẫu, bảo quản và vận chuyển - Dự kiến thu khoảng 15 ao, mỗi ao thu ít nhất 4 cá bệnh và 2 cá khỏe (mẫu được thu từ tháng 12/2008 đến tháng 2/2009). - Cá thu có dấu hiệu bệnh lý và còn sống. - Mẫu được vận chuyển về phòng thí nghiệm trong thùng mướp có sục khí và được phân tích ngay. Chỉ sử dụng những mẫu còn sống. 3.3.2 Nguồn vi khuẩn Các chủng vi khuẩn A. hydrophila được phân lập trên cá tra bị bệnh xuất huyết ở các tĩnh Cần Thơ, Vĩnh Long và Đồng Tháp. Tên mồi Trình tự AeroFd (mồi xuôi) 5’CCAAGGGGTCTGTGGCGACA3’ AeroRs (mồi ngược) 5’TTTCACCGGTAACAGGATTG3’ PDF created with FinePrint pdfFactory Pro trial version 17 Bảng 3.2 Nguồn gốc các chủng vi khuẩn sử dụng cho đề tài. 3.3.3 Phương pháp phân lập vi khuẩn - Mẫu cá bệnh thu về phòng thí nghiệm Khoa Thủy sản, được giữ sống bằng cách bỏ vào thùng mướp có sục khí. Mỗi ao thu ít nhất 4 cá bệnh và 2 cá khỏe. - Ghi nhận các dấu hiệu bên ngoài của cá: màu sắc, vết thương, điểm xuất huyết. - Mổ cá ghi nhận biểu hiện của các cơ quan nội tạng: điểm xuất huyết, mùi, màu sắc các cơ quan nội tạng. - Cấy vi sinh từ các cơ quan (gan, thận, tỳ tạng) lên môi trường NA (Nutrient agar) và môi trường đặc trưng Aeromonas agar + Ampicillin. Các thao tác được thực hiện bên ngọn đèn cồn và các dụng cụ được vô trùng, để trách tạp nhiễm. - Ủ các đĩa môi trường ở nhiệt độ 28-30oC. Sau 18-24 giờ quan sát và ghi nhận hình dạng của khuẩn lạc, nếu đĩa cấy chưa thuần tiếp tục tách ròng sang đĩa NA để đạt đĩa cấy thuần. Sau đó nhuộm gram, xem tính di động, kiểm tra các chỉ tiêu cơ bản. Nếu vi khuẩn di động, gram âm, Oxidase dương tính, Catalase dương tính thì đem nuôi trong môi trường lỏng NB (5ml) sau 18-24 giờ ở 28-30oC. Định danh vi khuẩn theo phương pháp truyền thống, các chỉ tiêu sinh hoá được xác định theo phương pháp của Barrow và Feltham (1993). Sau đó định danh vi khuẩn bằng bộ kit API 20E. Kết quả định danh được 8 chủng A. hydrophila, sau đó trữ vi khuẩn trong ống eppendorf có chứa 50% glycerol (nước cất:glycerol tỷ lệ 1:1) giữ ở (-20oC). STT Địa điểm Cơ quan phân lập Ký hiệu 1 Sa Đéc – Đồng Tháp Tỳ tạng SD(tt) 2 Sa Đéc – Đồng Tháp Thận SD(t) 3 Mang Thích – Vĩnh Long Tỳ tạng CA(tt) 4 Mang Thích – Vĩnh Long Thận CA(t) 5 Thốt Nốt – Cần Thơ Tỳ tạng TN(tt) 6 Thốt Nốt – Cần Thơ Thận TN(t) 7 Thốt Nốt – Cần Thơ Gan TN(g) PDF created with FinePrint pdfFactory Pro trial version 18 3.3.4 Phương pháp phục hồi và nuôi tăng sinh vi khuẩn - Vi khuẩn được phục hồi bằng cách cấy lên môi trường đặc trưng Aeromonas agar + Ampicillin, ghi nhận kết quả phục hồi vi khuẩn sau 18-24 giờ ở 28-30oC. - Chọn một khuẩn lạc thuần từ đĩa Aeromonas agar tách sang đĩa NA ủ ở 28-30oC, sau 18-24 giờ. - Chon một khuẩn lạc từ đĩa cấy thuần cho vào ống nghiệm 5ml NB ủ trong tủ ấm 28-30oC, sau 18-24 giờ kiểm tra kết quả. 3.3.5 Phương pháp PCR Chiết tách Acid nucleic (Bartie và ctv, 2006 trích dẫn bởi Nguyễn Trúc Phương, 2008) Chiết tách Acid nucleic từ vi khuẩn nuôi trong NB - Nuôi tăng sinh vi khuẩn (18-24 giờ) trong ống nghiệm có chứa 5 ml môi trường NB. - Chuyển 1,5 ml dung dịch vi khuẩn sang ống eppendorf. - Tiếp tục cho vào 100 µl dung dịch TE (10 mM Tris HCl và 1 mM EDTA). - Ủ ở 95oC trong vòng 15 phút. - Làm lạnh nhanh ống eppendorf trong nước đá. - Ly tâm 14000 vòng/phút trong 2 phút. - Rút phần dung dịch bên trên sang ống eppendorf mới. - Đo hàm lượng DNA bằng máy so màu quang phổ (Biomate) ở 260 nm. - Xác định hàm lượng DNA Đầu tiên, sử dụng nước cất 2 lần để tạo mẫu blank, rồi đo mẫu DNA đã được pha loãng 10 lần (50 µl DNA + 450 µl nước cất 2 lần). Hàm lượng DNA được tính theo công thức. Hàm lượng DNA (ng/µl) = A260nm x 50 x độ pha loãng. Chiết tách Acid nucleic từ khuẩn lạc vi khuẩn pha loãng trong dung dịch 0,85% NaCl - Cho 1,5 ml nước muối sinh lý (0,85% NaCl) vào ống eppendorf, tiếp tục dùng que cấy lấy vi khuẩn trên đĩa NA cho vào ống eppendorf. PDF created with FinePrint pdfFactory Pro trial version 19 - Cho thêm 100 µl dung dịch TE vào ống eppendorf và tiếp các bước giống như chiết tách vi khuẩn trong môi trường NB. Mẫu lấy trực tiếp từ đĩa cấy NA đem khuếch đại Sau khi chuẩn bị các chất tham gia phản ứng khuếch đại trong ống eppendorf, 24 µl/mẫu (PCR Buffer, MgCl2, dNTPs, Taq DNA polymerase, đoạn mồi AeroFd, đoạn mồi AeroRs, nước cất), dùng đầu col lấy một ít vi khuẩn trên đĩa nuôi cấy (NA) cọ vào thành eppendorf có chứa các thành phần tham gia phản ứng khuếch đại. Khuếch đại DNA: (theo Panangala ctv, 2007 có chỉnh sữa bởi Đặng Thị Hoàng Oanh và ctv, 2008). Thành phần cho phản ứng Bảng 3.3 Thành phần hóa chất tham gia vào phản ứng khuếch đại của qui trình PCR phát hiện A. hydrophila. Chu kỳ nhiệt 1. Giai đoạn tiền biến tính: 95 oC trong 4 phút. 2. Tiếp theo là 30 chu kỳ gồm - Giai đoạn biến tính: 95 oC trong 30 giây. - Giai đoạn gắn mồi: 60 oC trong 45 giây. - Giai đoạn kéo dài chuỗi: 72 oC trong 30 giây. 3. Giai đoạn kéo dài chuỗi cuối cùng: 72 oC trong 10 phút. Chạy điện di Chuẩn bị bản thạch (gel ) Pha 1,5 g agarose trong 100 ml dung dịch đệm TAE 0,5X, sau đó đun bằng lò vi sóng cho agarose tan hết, đợi đến khi nhiệt độ giảm xuống còn khoảng 50- STT Thành phần tham gia phản ứng Hàm lượng Thể tích 1 PCR Buffer 1X 2,5 µl 2 MgCl2 1,5 mM 1,5 µl 3 dNTPs 200 µM 0,5 µl 4 Taq DNA polymerase 2,5 U 0,5 µl 5 Đoạn mồi (AeroFd) 0,4 µM 1 µl 6 Đoạn mồi (AeroRs) 0,4 µM 1 µl 7 DNA mẫu 20 ng 1 µl 8 Nước cất - 17 µl Tổng cộng 25 µl PDF created with FinePrint pdfFactory Pro trial version 20 60 oC cho ethidium bromide (10 mg/ml) vào rồi lắc nhẹ để ethidium bromide tan đều, tiến hành đổ agarose vào khay đựng gel. Thể tích gel tùy thuộc vào kích cỡ của khay đựng gel. Thường bề dày của gel không quá 0,8 cm. Khi gel đặc lại, cẩn thận gỡ lược gel và keo dán 2 bên ra khỏi khay đựng gel. Cho gel vào bồn điện di. Thêm dung dịch điện di cho vừa bao phủ gel. Dùng thang DNA cho từng gel để xác đinh khối lượng phân tử của sản phẩm PCR. Dùng pipette hút 10 µl cho mẫu cần phân tích trộn với một giọt dung dịch nạp mẫu (loading Dye 6X) cho vào từng giếng một. Điện di Khi đã cho mẫu cần phân tích vào các giếng còn lại, nối bồn điện di với nguồn điện để chạy. Sử dụng dòng điện 100-150 V (không vượt quá 150 V) để chạy gel. Ngừng điện di khi màu xanh đậm di chuyển khoảng 1/2 đến 2/3 gel. Sau đó tiến hành đọc kết quả. Đọc kết quả Đặt gel lên bàn UV để đọc kết quả. Kết quả điện di được ghi nhận bằng máy đọc gel Vilber Lourmat. Căn cứ vào thang DNA 1 kb plus để xác định trọng lượng phân tử. Trọng lượng phân tử đoạn DNA của vi khuẩn A. hydrophila cần phát hiện là 209 bp. 3.3.6 Thí nghiệm xác định độ nhạy của qui trình PCR Tương tự Panangala et al., (2007) xác định tính nhạy và tính chuyên biệt của của phương pháp m-PCR phát hiện đồng thời F. columnare, E. ictaluri và A. hydrophila. Ở đây cũng thực hiện phản ứng với các hàm lượng DNA khác nhau của vi khuẩn để xác định hàm lượng thấp nhất có thể phát hiện A. hydrophila. Thí nghiệm được thực hiện với DNA được chiết tách từ vi khuẩn A. hydrophila nuôi trong NB. Thí nghiệm: Từ đĩa cấy thuần của môi trường NA, lấy vi khuẩn nuôi tăng sinh trong môi trường NB sau 18-20 giờ, sau đó pha loãng 10 lần với 10 nồng độ khác nhau, nồng độ từ 10o đến 10-9 với (10o = 100 ng/µl). Thể tích mỗi mẫu DNA sử dụng là 1µl/phản ứng. Thực hiện phản ứng PCR và chạy điện di để tìm ra nồng độ thấp nhất có thể phát hiện được A. hydrophila (như mục 3.3.5). PDF created with FinePrint pdfFactory Pro trial version 21 3.3.7 Thí nghiệm xác định tính đặc hiệu của qui trình PCR Tính đặc hiệu của qui trình PCR phát hiện A. hydrophila sẽ được xác định bằng cách sử dụng DNA chiết tách từ các chủng vi khuẩn phổ biến trong thủy sản như sau: 1. Vibrio harveyi 2. Vibrio alginolyticus 3. Pseudomonas putida 4. Eschericchia coli 5. Edwardsiella ictaluri Các chủng vi khuẩn này được nuôi trong môi trường NB, sau đó chiết tách và khuếch đại giống như (mục 3.3.5). PDF created with FinePrint pdfFactory Pro trial version 22 Chương 4 KẾT QUẢ VÀ THẢO LUẬN 4.1 Kết quả phân lập vi khuẩn A. hytrophila trên cá tra bị bệnh xuất huyết Kết quả thu mẫu và phân tích mẫu tại phòng thí nghiệm Bộ môn Sinh học và Bệnh thủy sản-Khoa Thủy Sản, Trường Đại học Cần Thơ đã thu mẫu được tổng số 17 ao (5 ao cá bị bệnh xuất huyết và 12 ao cá bị bệnh mũ gan) ở 3 tỉnh Đồng Tháp, Vĩnh Long và Cần Thơ (xem bảng 4.1). Bảng 4.1 Bảng kết quả thu mẫu cá tra bị bệnh. Số ao thu được ở Đồng Tháp là 10 ao (1 ao bị bệnh xuất huyết), Vĩnh Long thu 4 ao (1 ao bệnh xuất huyết) và ở Cần Thơ thu 3 ao tất cả đều bị bệnh xuất huyết. Cá tra bị bệnh xuất huyết có dấu hiệu thường gặp nhất là xuất huyết ở góc các vi, da, nắp mang, quanh miệng hay xuất huyết quanh mắt và phù mắt, mổ cá thấy thành bụng xuất huyết xoang bụng chứa nhiều dịch nhờn có mùi hôi thối (Hình 4.1). Hình 4.1 Cá tra bị bệnh xuất huyết (xoang bụng, hậu môn, nắp mang xuất huyết và mắt lồi đục). Kết quả phân tích mẫu vi sinh ở 5 ao cá bị bệnh xuất huyết đã phân lập được 28 chủng vi khuẩn Aeromonas (Đồng Tháp: 6 chủng; Vĩnh Long: 4 chủng; Cần Thơ: 18 chủng). Dựa vào dấu hiệu bệnh lý của cá lúc phân tích và hình STT Địa điểm Tổng số ao thu Số ao bệnh xuất huyết Số ao bệnh mủ gan Số chủng Aeromonas 1 Đồng Tháp 10 1 9 6 2 Vĩnh Long 4 1 3 4 3 Cần Thơ 3 3 0 18 Tổng cộng 17 5 12 28 PDF created with FinePrint pdfFactory Pro trial version 23 thái khuẩn lạc đã chọn ra 8 chủng vi khuẩn đại diện (Đồng Tháp: 2 chủng; Vĩnh Long: 2 chủng; Cần Thơ: 4 chủng) (xem bảng phụ lục 1). Sau đó 8 chủng vi khuẩn phân lập được định danh bằng phương pháp sinh hóa truyền thống (xem bảng phụ lục 2) và bộ kit API 20E (xen bảng phụ lục 3) đã cho kết quả định danh là vi khuẩn A. hydrophila (kết quả từ đề tài của Trần Thanh Phú, 2009). Vi khuẩn sau đó được nuôi tăng sinh trong môi trường NB sau 24 giờ và trữ trong glycerol (50%) giữ ở (-20°C). 4.2 Kết quả phục hồi vi khuẩn Kết quả có 7 chủng A. hydrophila đã được phục hồi cấy lên môi trường Aeromonas agar + Ampicillin (hình 4.2), sau đó tách sang môi trường NA (hình 4.3), ủ ở 28-30oC sau 18-24 giờ cho khuẩn lạc thuần, hình dạng khuẩn lạc tròn, hơi lồi, nhẵn và có màu vàng nhạt. Hình 4.2 Hình dạng khuẩn lạc của A. hydrophila trên môi trường Aeromonas agar + Ampicillin. Hình 4.3 Hình khuẩn lạc của A. hydrophila trên môi trường NA. Vi khuẩn A. hydrophila được phân lập từ các cơ quan (gan, thận và tỳ tạng) của cá tra bị bệnh xuất huyết ở Đồng Tháp, Vĩnh Long và Cần Thơ. Sau đó vi PDF created with FinePrint pdfFactory Pro trial version 24 khuẩn đã được định danh bằng phương pháp sinh hóa truyền thống và kít API 20E sau đó trữ trong glycerol (50%). Kết quả phục hồi vi khuẩn trên môi trường đặc trưng Aeromonas agar + Ampicillin, quan sát hình dạng khuẩn lạc và nhuộm gram thấy phù hợp với kết quả đã được định danh. Định danh A. hydrophila bằng phương pháp sinh hóa truyền thống hay bộ kít API 20E là 2 phương pháp phổ biến, dùng phương pháp nào cũng cho ra kết quả, tuy nhiên đối với phương pháp sinh hóa truyền thống mất nhiều thời gian hơn dùng kít API chỉ cần vài ngày. Vi khuẩn sau khi phục hồi tiến hành kiểm tra, thấy kết quả vi khuẩn gram âm, di động, có dạng hình que ngắn (hình 4.4). Kết quả này cũng phù hợp với kết quả ghi nhận của Ngô Minh Dung (2007) phân lập A. hydrophila sau khi gây cảm nhiễm trên cá tra. Hình 4.4 Hình nhuộm gram vi khuẩn A. hydrophila 4.3 Phát hiện vi khuẩn A. hydrophila bằng phương pháp PCR PCR là công cụ giúp phát hiện nhanh và chính xác mầm bệnh vi sinh vật trên tôm, cá. Với phương pháp PCR chỉ cần khoảng 1 ngày đã nhanh chóng phát hiện A. hydrophila, mà kết quả lại chính xác, vì khi đúng là DNA của A. hydrophila mới bắt cặp với mồi đặc trưng và hiện vạch tại vị trí 209 bp. Cũng tương tự đề tài của Nguyễn Trúc Phương (2008) đã dùng phương pháp PCR để xác định kết quả định danh E. ictaluri, cho kết quả nhanh và chính xác. Đề tài ứng dụng phương pháp PCR để phát hiện A. hydrophila nhằm kiểm tra tính chính xác của kết quả định danh bằng phương pháp sinh hóa truyền thống và góp phần vào việc chuẩn hóa phương pháp nghiên cứu bệnh do vi khuẩn A. hydrophila gây ra trên cá tra. Nghiên cứu được thực hiện phản ứng PCR bằng 2 cách chiết tách mẫu và lấy mẫu từ khuẩn lạc thuần. PDF created with FinePrint pdfFactory Pro trial version 25 Kết quả phản ứng PCR mẫu DNA chiết tách từ vi khuẩn nuôi trong môi trường NB sau 18-24 giờ, ở 28-30oC được trình bày ở (hình 4.5). Từ kết quả ở (hình 4.5) cho thấy cả 14 mẫu chiết tách và đối chứng dương đều hiện vạch tại vị trí 209 bp, đối chứng âm không hiện vạch. Theo kết quả nghiên cứu của Panangala et al., (2007) đã ứng dụng phương pháp multiplex-PCR để phát hiện đồng thời 3 loài vi khuẩn quan trọng (E. ictaluri, Flavobacterium columnare và A. hydrophila), cho kết quả phát hiện A. hydrophila ở (209 bp). 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M Hình 4.5 Kết quả điện di sản phẩm PCR các chủng A. hydrophila. - Giếng M: thang đo DNA - Giếng 1: đối chứng âm (nước cất) - Giếng 2: đối chứng dương. - 7 giếng DNA được chiết tách từ NB (giếng 3-9). + Giếng 3: chủng CA (t); Giếng 4: chủng SD (t); Giếng 5: chủng CA (tt); Giếng 6: chủng TN (tt); Giếng 7: chủng TN (g); Giêng 8: chủng TN (t); Giếng 9: chủng SD (tt). - 7 giếng DNA được chiết tách pha loãng vi khuẩn với nước muối sinh lý (giếng 10-16). + Giếng 10: chủng CA (t); Giếng 11: chủng SD (t); Giếng 12: chủng CA (t); Giếng 13: chủng TN (tt); Giếng 14: chủng TN (g); Giếng 15: chủng TN (t); Giếng 16: chủng SD (t). Chứng tỏ có sự hiện diện của A. hydrophila và trên tất cả 14 mẫu không có sản phẩm phụ, tuy nhiên ở giếng số 7, 8, 12, 13 và số 14 mẫu hiện vạch chưa rõ như các giếng còn lại, có thể do hàm lượng DNA chiết tách không đủ. Nồng độ của mẫu và đoạn mồi sử dụng cho phản ứng này là 20 ng/µl và 10 µM. Nếu 209 bp PDF created with FinePrint pdfFactory Pro trial version 26 có điều kiện nên tiến hành thử giảm các thành phần hóa chất tham gia phản ứng PCR, để có thể tiết kiệm chi phí mà vẫn mang lại kết quả tốt. Kết quả PCR mẫu lấy trực tiếp từ khuẩn lạc của 7 chủng vi khuẩn, không qua bước chiết tách được trình bày ở (hình 4.6). Qua kết quả ở (hình 4.6) cho thấy cả 7 mẫu đều không hiện vạch ở 209 bp, có thể do mẫu vi khuẩn không qua bước chiết tách DNA nên kết quả điện di sản phẩm PCR không hiện vạch. 1 2 3 4 5 6 7 M Hình 4.6 Kết quả điện di sản phẩm PCR, không qua chiết tách DNA của chủng A. hydrophila. Giếng 1: chủng CA (t); Giếng 2: chủng SD (t); Giếng 3: chủng CA (tt); Giếng 4: chủng TN (tt); Giếng 5: chủng TN (g); Giêng 6: chủng TN (t); Giếng 7: chủng SD (tt). 4.4 Độ nhạy của phương pháp PCR phát hiện A. hydrophila. Để xác định giới hạn thấp nhất hàm lượng DNA của vi khuẩn mà phương pháp PCR có thể phát hiện được. Xác định bởi sự pha loãng của acid nucleic được làm tinh sạch. Kết quả PCR xác định độ nhạy của phương pháp được thể hiện qua (hình 4.7). Dựa vào kết quả ở (hình 4.7) cho thấy chỉ có 3 mẫu cho kết quả là (10o, 10-1 và 10-2) đều hiện vạch ở 209 bp, 7 mẫu còn lại có thể do hàm lương DNA quá thấp không đủ cho phản ứng PCR, nên không hiện vạch sau khi điện di. Hàm 209 bp PDF created with FinePrint pdfFactory Pro trial version 27 lượng DNA thấp nhất cho phản ứng PCR để có thể phát hiện A. hydrophila là (10-2 = 1 ng/µl). Hình 4.7 Kết quả điện di sản phẩm PCR phát hiện A. hydrophila xác định độ nhạy của phương pháp. Giếng M: thang đo DNA. Giếng 1: đối chứng âm (mẫu nước). Giếng 2: hàm lượng DNA 10o ng/µl (10o = 100 ng/µl). Giếng 3: 10-1; Giếng 4: 10-2; Giếng 5: 10-3; Giếng 6: 10-4; Giếng 7: 10-5; Giếng 8: 10-6; Giếng 9: 10-7; Giếng 10: 10-8; Giếng 11: 10-9. 4.5 Tính đặc hiệu của phương pháp PCR phát hiện A. hydrophila. Tính đặc hiệu của phương pháp là với các hàm lượng của thành phần hóa chất tham gia phản ứng và đoạn mồi đặc trưng thì phương pháp PCR chỉ phát hiện A. hydrophila, không cho kết quả dương tính với các loài vi khuẩn khác. Kết quả được thể hiện ở (hình 4.8). Ở nghiên cứu của Panangala et al., (2007) đã ghi nhận kết quả xác định tính đặc hiệu của phương pháp m-PCR, 10 chủng vi khuẩn phân lập trong 3 loài vi khuẩn (E. ictaluri, Flavobacterium columnare và A. hydrophila) thử với 11 chủng gram âm khác và 2 chủng gram dương có mặt khắp nơi từ môi trường nuôi thủy sản. Hình 4.8 cho thấy với hàm lượng các thành phần hóa chất tham gia và đoạn mồi của phản ứng PCR chỉ cho phép phát hiện DNA của A. hydrophila khi thử với 5 loài vi khuẩn khác (Vibrio alginolyticus, Vibrio harveyi, E. ictaluri, Pseudomonas putida, Eschericchia coli). Kết quả chỉ có giếng 2 (đối chứng 209 bp PDF created with FinePrint pdfFactory Pro trial version 28 dương) là mẫu có DNA của A. hydrophila hiện vạch ở 209 bp, còn 5 giếng thử các chủng vi khuẩn khác không hiện vạch. Giếng 1 (đối chứng âm) không hiện vạch chứng tỏ kết quả chiết tách DNA không nhiễm tạp. Hình 4.8 Kết quả điện di sản phẩm PCR xác định tính đặc hiệu của phương pháp phát hiện A. hydrophila. Giếng M: thang đo DNA Giếng 1: đối chứng âm (nước cất) Giếng 2: đối chứng dương (mẫu DAN của chủng A. hydrophila). Giếng 3: DNA của chủng Vibrio alginolyticus. Giếng 4:DNA của E. ictaluri Giếng 5: DNA của Eschericchia coli. Giếng 6: DNA của Pseudomonas putida Giếng 7: DNA của Vibrio harveyi. Từ kết quả điện di sản phẩm PCR xác định độ nhạy và tính chuyên biệt của phương pháp PCR phát hiện A. hydrophila, cho phép phát hiện nhanh và sớm các mầm bệnh ở dạng tiềm ẩn. Nên có thể kịp thời xử lý ao nuôi hạn chế rũi ro xảy ra. Đây sẽ là hướng đi mới trong việc chẩn đoán bệnh xuất huyết do A. hydrophila gây ra trên cá tra nuôi. Tuy nhiên phương pháp PCR tốn kém và cần thiết phải có máy móc hiện đại hơn phương pháp sinh hóa truyền thống và kít API 20E. 209 bp PDF created with FinePrint pdfFactory Pro trial version 29 Phương pháp m-PCR là phương pháp đầy hứa hẹn cho việc phát hiện nhanh, nhạy và phát hiện đồng thời 3 loài vi khuẩn (E. ictaluri, Flavobacterium columnare và A. hydrophila) gây bệnh trên cá (theo Panangala et al., 2007). PDF created with FinePrint pdfFactory Pro trial version 30 Chương 5 KẾT LUẬN VÀ ĐỀ XUẤT 5.1 Kết luận Đã thực hiện thành công các phản ứng PCR. 1. Có 7 chủng A. hydrophila được chiết tách acid nucleic (Bartie et al., 2006) bằng 2 cách: (1) chiết tách từ vi khuẩn được nuôi trong NB, (2) chiết tách bằng cách pha loãng vi khuẩn với nước muối sinh lý (0,85% NaCl). Khuếch đại DNA (Panangala et al., 2007 có chỉnh sửa bởi Đặng Thị Hoàng Oanh và ctv, 2008), kết quả PCR khẳng định 14 mẫu DNA (từ 2 cách chiết tách) của 7 chủng vi khuẩn đã được định danh là A. hydrophila đều hiện vạch ở 209 bp. Với các thành phần phản ứng PCR: 1X Buffer, 1,5 mM MgCl2, 200 µM dNTPs, 2,5U Taq DNA polymerase, 0,4 µM mồi AeroFd, 0,4 µM mồi AeroRs, 1 µl DNA khuôn, nước cất. Chu kỳ nhiệt thực hiện phản ứng 95oC trong 4 phút; tiếp 30 chu kỳ 95oC trong 30 giây, 60oC trong 45 giây, 72oC trong 30 giây; cuối cùng 72oC trong 10 phút. Kết quả điện di sản phẩm PCR của 7 mẫu vi khuẩn trên, được lấy trực tiếp từ đĩa NA không hiện vạch. Do mẫu vi khuẩn không qua bước chiết tách DNA, nên kết quả điện di sản phẩm PCR không hiện vạch. 2. PCR xác định độ nhạy của phương pháp, phản ứng PCR từ một chủng A. hydrophila pha loãng ra 10 mẫu với hàm lượng DNA giảm dần cho kết quả điện di có 3 mẫu (với hàm lượng DNA 100 ng/µl, 10 ng/µl và 1 ng/µl) hiện vạch ở (209 bp). Vậy hàm lượng DNA thấp nhất có thể phát hiện được là 1 ng/µl mẫu. 3. PCR xác định tính đặc hiệu của phương pháp thử phản ứng PCR chủng A. hydrophila với các chủng Vibrio alginolyticus, Vibrio harveyi, E. ictaluri, Pseudomonas putida, Eschericchia coli . Kết quả chỉ có mẫu DNA của A. hydrophila hiện vach ở vị trí 209 bp, còn lại các mẫu không hiện vạch. Vậy phương pháp PCR này với các thành phần hóa chất tham gia phản ứng và đoạn mồi đặc trưng chỉ để phát hiện DNA của A. hydrophila. 5.2 Đề xuất - Nên ứng dụng phương pháp PCR để phát hiện sớm mầm bệnh A. hydrophila gây bệnh xuất huyết trên cá tra, để hạn chế rủi ro có thể xảy ra. - Thực hiện m-PCR phát hiện đồng thời 2 loại vi khuẩn A. hydrophila (209 bp) và E. ictaluri (407 bp). PDF created with FinePrint pdfFactory Pro trial version 31 TÀI LIỆU THAM KHẢO 1. Báo Cần Thơ. 2007. Để sản phẩm cá tra Việt Nam luôn được tín nhiệm. (Cập nhật 09/08/2007). 2. Bộ Thủy sản, 2008. Phòng trị một số bệnh thường gặp của cá tra và basa. Cập nhật 7/11/2008. 3. Bùi Quang Tề. 2006. Bệnh học thủy sản. 4. Đặng Thị Hoàng Oanh. 2007. Nguyên lý và Kỹ thuật Chẩn đoán Bệnh Thủy sản. Khoa Thủy sản-Đại học Cần Thơ. 5. Đỗ Thị Hòa, Bùi Quang Tề, Nguyễn Hữu Dũng và Nguyễn Thị Muội. 2004. Bệnh Học Thủy Sản. NXB nông nghiệp, 6:218-223. 6. Đoàn Nhật Phương. 2001. Xác đinh LD50 và thử nghiệm vaccine phòng bệnh vi khuẩn (Aeromonas hydrophila) trên cá chép (Cyprinus carpio). Luận văn tốt nghiệp. khoa Thủy sản, ĐHCT. 7. Hồ Huỳnh Thùy Dương. 2003. Sinh học phân tử. NXB giáo dục. 301 trang. 8. Huỳnh Phú Trọng. 2008. Xuất khẩu thủy sản chạy đua cán đích 4,25 tỷ USD. ( truy cập 22/8/2008). 9. Huỳnh Thị Phượng Quyên. 2008.Tiêu chuẩn hóa phương pháp xác định nồng độ ức chế tối thiểu (MIC) của thuốc kháng sinh lên vi khuẩn E. ictaluri & A. hydrophila tại khoa Thủy sản. Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. 10. Inglis, V., R. J. Roberts and N. R. Bromage. 1993. Bacterial Disease Of Fish. Institute of Aquaculture. 312pp. 11. Khuất Hữu Thanh. 2003. Cơ sở di truyền phân tử và kỹ thuật gen. NXB khoa học và kỹ thuật. 12. Lê Minh Đương. 2007. So sánh khả năng xâm nhập của hai dòng vi khuẩn Edwardsiella ictaluri trên cá tra (Pangasius hypophthalmus). Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. 13. Lê Thành Đen. 2006. Sử dụng một số hóa chất trị bệnh trùng quả dưa (Ichthyophthyrius multifiliis) trên cá tra (Pangasius hypophthalmus) giống. Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. 14. Lê Thị Bé Năm. 2002. Xác định tác nhân vi khuẩn gây bệnh đốm trắng ở nội tạng cá tra. Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. PDF created with FinePrint pdfFactory Pro trial version 32 15. Lệ Thu. 2008. Tác động của biến đổi khí hậu đối với ĐBSCL. Báo Cần Thơ. ( Cập nhật 9/10/2008). 16. Lương Trần Thục Đoan. 2006. Khảo sát sự xuất hiện của vi khuẩn gây bệnh mủ gan ( Edwardsiella ictaluri) trên các cơ quan khác nhau của ca tra (Pangasius hypophthamus). Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. 51 trang. 17. Ngô Minh Dung. 2007. nghiên cứu khả năng gây bệnh của vi khuẩn Edwarsiella ictaluri và Aeromonas hydrophila trên cá tra(Pangasius hypophthalmus). Luận văn đại học. Khoa Thủy Sản-Đại học Cần Thơ. 18. Nguyễn Hà Giang. 2008. Tiêu chuẩn hóa phương pháp xác định các chỉ tiêu sinh hóa của vi khuẩn Aeromonas hydrophila tại khoa thủy sản. Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. 19. Nguyễn Trúc Phương. 2008. Tìm hiểu sự khác nhau về các chỉ tiêu sinh lý và sinh hóa giữa các dòng vi khuẩn Edwardsiella ictaluri xác định bằng phương pháp sinh hóa truyền thống và API 20E. Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. 42 trang. 20. Nông nghiệp, nông sản, thủy sản Việt Nam. 2007. Một số bệnh thường gặp trên cá tra. ột số bệnh thường gặp trên cá tra.html. Cập nhật 1/5/2007. 21. Panangala, S.V., C.A. Shoemaker, V.L.V. Santen, K. Dybvig and P.H. Klesius. 2007. Multipex-PCR for simultaneous detection of 3 bacterial fish pathogens, Flavobacterium columnare, Edwardsiella ictaluri, and Aeromonas hydrophila. Díeases of aquatic organisms, 74: 199-208 (2007). 22. Phạm Đình Đôn. 2006. Bảo vệ môi trường trong nuôi trồng thủy sản ở Đồng bằng sông Cửu Long. (Cập nhật 26/11/2006). 23. Phạm Thanh Hương. 2006. xác định một số yếu tố huyết học trên cá tra (Pangasius hypophthalmus) bệnh vàng da ở tỉnh Cần Thơ. Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. 24. Phạm Thị Thu Trang. 2005. Ứng dụng kỹ thuật PCR chuẩn đoán bệnh đốm trắng trên tôm sú (Penaus monodon) và tôm chân trắng (Penaus vannamie). Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. 39 trang. 25. Saitatu, K.S., Wongsawang and K. Poonsuk. 1982. Red sore disease in carp (Cyprinus carpio L) J. Aquat. Animal Dis. 3: 79-86 (In Thai). In Asian PDF created with FinePrint pdfFactory Pro trial version 33 Fish Health Bibliography and Abstracts I: Southeast Asia. Fish Health Section Asian Fisheries Society Manila, Philippines, 1992. 26. Tiết Ngọc Trân. 2007. So sánh khả năng gây bệnh của hai dòng vi khuẩn (Edwardsiella ictaluri) gây bệnh trên cá tra (Pangasius hypophthalmus) và cá nheo mỹ. Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. 27. Trần Khánh Linh. 2007. ĐBSCL: môi trường nuôi thủy sản đang kêu cứu. (Cập nhật 16/11/2007). 28. Trần Thị Ngọc Hân. 2006. Khảo sát mô học cá tra (pangasius hypophthalmus) bị bệnh mủ gan trong điều kiện gây cảm nhiễm. Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. 71 trang. 29. Trần Thị Tuyết Hoa. 2004. Bài Giảng sinh học phân tử. Khoa Thủy Sản- Đại học Cần Thơ. 30. Trần Thị Xô và Nguyễn Thị Lan. 2005. Cơ sở di truyền và công nghệ gen. NXB khoa học và kỹ thuật. 31. Trần Văn Tếch. 2008. Khảo sát ký sinh trùng trên cá tra (Pangasianodon hyphophthalmus) bệnh vàng da. Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. 32. Trần Việt Tiên. 2007. Ứng dụng phương pháp RT-PCR trong chẩn đoán virus gây bệnh đầu vàng (YHV) trên tôm sú (penaeus monodon) ở ĐBSCL. Luận văn tốt nghiệp. Khoa Thủy Sản-Đại học Cần Thơ. 65 trang. 33. Từ Thanh Dung. 2005. Bài Giảng Bệnh Học Thủy Sản Đại Cương. Khoa Thủy sản – Đại học Cần Thơ. 34. Từ Thanh Dung. 2008. Bài giảng Bệnh vi khuẩn trên động vật Thủy sinh. Khoa Thủy sản-Đại học Cần Thơ. 35. Võ Thị Thương Lan. 2006. Giáo trình sinh học phân tử tế bào và ứng dụng. NXB giáo dục. 36. Yang. B, X-L Song, J. Huang, C-Y Shi, Q-H Liu and L. Liu. 2006. A single-step multiplex PCR for simultaneous detection of white spot syndrome virus and infectious hypodermal and haematopoietic necrosis virus in penaeid shrimp. PDF created with FinePrint pdfFactory Pro trial version 34 PHỤ LỤC 1 Bảng các chủng vi khuẩn Aeromonas hydrophila phân lập được từ cá bệnh xuất huyết. Địa điểm Kí hiệu ao Tên hộ nuôi Bệnh Dấu hiệu bệnh lý Chủng vi khuẩn Đồng Tháp SĐ2 Phan Văn Điền Xuất huyết Sưng hầu, phù mắt. Xuất huyết nội quan. Xoang bụng có chứa chất dịch màu hồng. SĐ2.1T SĐ2.2T Vĩnh Long CA1 Huỳnh Văn Khuê Xuất huyết Gan có màu vàng, dịch xoang bụng có mùi hôi. Thành bụng xuất huyết CA1.2T CA1.3TT Cần Thơ CS2 Nguyễn Thị Hoà Xuất huyết Cơ bị loét, vây trắng nhạt và xuất huyết. Xuất huyết mặt trong thành bụng, nội quan. Xoang bụng chứa chất dịch có mùi hôi. CS2.3T TN1 Lê Thành Nhân Xuất huyết Phù mắt, xuất huyết hầu, xuất huyết vi. Xuất huyết cơ bụng. Gan có màu vàng. TN1.1T TN2 Lê Thành Nhân Xuất huyết Xuất huyết vi, hậu môn, hầu. Xuất huyết thành bụng và nội quan. Xoang bụng chứa chất dịch có màu vàng mùi hôi TN2.1G TN2.4TT PDF created with FinePrint pdfFactory Pro trial version 35 PHỤ LỤC 2 Đặc điểm hình thái, sinh lý và sinh hóa của 8 chủng vi khuẩn phân lập Chỉ tiêu kiểm tra A1 A2 A3 A4 A5 A6 A7 A8 Nhuộm Gram - - - - - - - - Hình dạng Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Que ngắn Sinh sắc tố - - - - - - - - Di động + + + + + + + + Sinh catalaza + + + + + + + + Sinh oxidaza + + + + + + + + Phản ứng lên men yếm khí + + + + + + + + Phản ứng lên men hiếu khí + + + + + + + + Arginine + + + + + + + + Lysine + + + + + + + + Ornithine - - - - - - - - Mọc trên môi trường Aeromonas + + + + + + + + Sinh gas từ glucose + + + + + + + + Thuỷ phân aesculin - + + + + - + + Sinh ureaza - - - - - - - - Sử dụng citrate + + + + + + + + Sinh amylaza + + + + + + + + Sinh indole - - - + - + - + Phản ứng VP - - - - - - - - Thuỷ phân tween 80 - - - - - - - - Tạo nitrit từ nitrat + + + + + + + + Mọc ở 0% NaCl + + + + + + + + Mọc ở 3% + + + + + + + + Mọc ở 6% - - - - - - - - Mọc ở 7% - - - - - - - - Mọc ở 10% - - - - - - - - Mọc trên thạch TCBS - - - - - - - - Kháng với 0/129 - - - - - - - - Sử dụng Arabinose - - - - - - - - Cellobiose - - - - - - - - Galactose + + + + + + + + Glycerol + + + + + + + + Lactose + + + + + + + + Mannitol + + + + + + + + Trehalose + + + + + + + + Sucrose + + + + + + + + Glucose + + + + + + + + PDF created with FinePrint pdfFactory Pro trial version 36 Salicin + + + + + + + + Xylose - - - - - - - - Ghi chú: (+): phản ứng dương tính (-): phản ứng âm tính A1: TN1.1T A2: TN2.1G A3: TN2.4TT A4: SĐ2.2T A5: SĐ2.1T A6: CS2.3T A7: CA1.2T A8: CA1.3TT PDF created with FinePrint pdfFactory Pro trial version 37 PHỤ LỤC 3 Kết quả kiểm tra các chỉ tiêu sinh hóa bằng bộ kít API 20E. Ghi chú: (+): Phản ứng dương tính (-): Phản ứng âm tính - A1: TN1.1T - A2: TN2.1G - A3: TN2.4TT - A4: SĐ2.2T - A5: SĐ2.1T - A6: CS2.3T - A7: CA1.2T - A8: CA1.3TT - ONPG: ortho-nitrophenyl galactosidase - GEL: gelatin - ADH: arginine dihydrolase - GLU: glucose - LDC: lysine decarboxylase - MAN: mannitol - ODC: ornithine decarboxylase - INO: inositol - CIT:citrate - SOR: sorbitol - H2S: sinh H2S - RHA: rhamnose - URE: urea - SAC: sucrose - TDA: tryptophane deaminase - MEL: melibiose - IND: indole - AMY: amygdaline - VP: phản ứng Voges-Proskauer - ARA: arabinnose STT Chỉ tiêu A1 A2 A3 A4 A5 A6 A7 A8 1. ONPG + + + + + + + + 2. ADH + + + + + + + + 3. LDC + + + + + + + + 4. ODC - - - - - - - - 5. CIT + + + + + + + + 6. H2S - - - - - - - - 7. URE - - - - - - - - 8. TDA - - - - - - - - 9. IND + + + + + + + + 10. VP - - - - - - - - 11. GEL + + + + + + + + 12. GLU + + + + + + + + 13. MAN + + + + + + + + 14. INO - - - - - - - - 15. SOR - - - - - - - - 16. RHA - - - - - - - - 17. SAC + + + + + + + + 18. MEL - - - - - - - - 19. AMY + + + + + - + + 20. ARA - - - - - - - - PDF created with FinePrint pdfFactory Pro trial version 38 PDF created with FinePrint pdfFactory Pro trial version

Các file đính kèm theo tài liệu này:

  • pdflv_lm_thuan_9933.pdf
Luận văn liên quan