Luận án Nghiên cứu ứng dụng chỉ thị phân tử chọn tạo giống kháng bệnh đạo ôn trên nền di truyền của giống lúa BC15

Tóm lại, kết quả đánh giá và phân tích kiểu gen, kiểu hình và các đặc điểm nông học, tính kháng bệnh đạo ôn trên đồng ruộng đã cho thấy dòng lúa BC15.4.2 mang hai gen kháng bệnh đạo ôn Pik-h và Pi9(t), đã biểu hiện tính kháng bệnh đạo ôn lá và đạo ôn cổ bông tốt hơn rõ rệt so với giống gốc BC15 trên đồng ruộng. Dòng mang các chỉ tiêu nông học, khả năng kháng sâu bệnh hại khác và chất lượng tương đương với giống gốc BC15. Trong vụ Xuân 2020, trong điều kiện không sử dụng thuốc phòng bệnh đạo ôn, năng suất thực thu của dòng BC15.4.2 đạt 7,5 tấn/ha, cao hơn 19% so với giống gốc BC15 nhiễm đạo ôn. Trong các nghiên cứu tương tự trong nước về cải tiến tính kháng bệnh đạo ôn cho giống lúa BC15, một số giống lúa triển vọng đã được các nhà khoa học chọn tạo và đưa vào khảo nghiệm quốc gia: BC15-01, BC15-02, BC15-03, BC15 KĐÔ, AGI-1. Các giống lúa này đều mang đơn gen kháng đạo ôn và vẫn giữ lại được những đặc điểm tốt của giống gốc BC15. Đây chính là những thành tựu đáng ghi nhận cho hướng nghiên cứu ứng dụng sinh học phân tử trong cải tiến tính kháng sâu bệnh cho các giống lúa trồng phổ biến. Nghiên cứu này đã kế thừa được các kết quả nghiên cứu có hệ thống về đánh giá quần thể nấm bệnh đạo ôn ở các vùng trồng lúa chính, qua đó xác định được các gen kháng bệnh đạo ôn còn hiệu quả tại các tỉnh phía Bắc và tích hợp được hai gen kháng bệnh đạo ôn hữu hiệu Pik-h và Pi9(t) vào nền di truyền của giống lúa BC15. Dòng lúa BC15.4.2 được khẳng định tích hợp 2 gen kháng Pik-h và Pi9(t), biểu hiện tính kháng tốt trên đồng ruộng, cần được tiếp tục nhân rộng trong các vụ tiếp theo để phát triển ra ngoài sản xuất.

pdf206 trang | Chia sẻ: trinhthuyen | Ngày: 29/11/2023 | Lượt xem: 208 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận án Nghiên cứu ứng dụng chỉ thị phân tử chọn tạo giống kháng bệnh đạo ôn trên nền di truyền của giống lúa BC15, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
à Nội R S S S S S S S S R R R R R R R R R S R R S R R S R 137 I22 Hà Nội R S S S S S S S S R R R R R R R R R S R R S R R S S 138 I101 Hà Nội R S S S S S S S S R R R R R R R R R S R R S R R S S 139 I11 Hà Nội R S S S S S S S S R R R R R R R R R S R R S S R S S 140 I15 Hà Nội R S S S S S S S S R R R R R R R S R S R R S R R S S 141 I3 Hà Nội R S S S S S S S S R R R R R R R S R S R R S R S R S 142 I7 Hà Nội R S S S S S S S S R R R R R R R S S S R R S R R R S 143 I20 Hà Nội R S S S S S S S R R R R R R R R R R S R R S R R S S 144 I14 Hà Nội S S S S S S S S S R R R R R R R S S R R S R S R S S 145 I23 Hà Nội R S S S S S S S S R R R R R R R R R S R R S R R S S 146 I21 Hà Nội R S S S S S S S S R R R R R R R S R S R R S R R S S 147 I2a Hà Nội R S S S S S S S S R R R R R R R S R S R S S R R R S 148 I12 Hà Nội R S S S S S S S S R S R R R R R S S S R R S R R S S 149 I120 Hải Phòng R S S S S S S S S R R R R R R R R R S R R S R R S S 150 I119 Hải Phòng R S S S S S S S S R R R R R R R R R S R R S R R S S 151 I152 Hải Dương R S S S S S S S S R R R R R R R R R S R R S R R S S 152 I86 Hải Dương R S S S S S S S S R R R R R R R R R S R R S R R S S 153 I88 Hải Dương R S S S S S S S S R R R R R R R R R S R R S R R S S 154 I153 Hải Dương R S S S S S S S S R R R R R R R S R S R R S R S R S 160 155 I87 Hải Dương R S S S S S S S S R R R R R R R S R S R R S R R S S 156 I179 Hà Tĩnh R S S S S R R R S R R R R R R R S R S R R S S R S S 157 I181 Hà Tĩnh R S S S S S S S S R R R R R R R S R R R R S R R S S 158 I202 Hà Tĩnh R S S S S S S S S R R R R R R R S R S R R R R R S S 159 I176 Hà Tĩnh R S S S S S S S S R R R R R R R S R R R R S R R S S 160 I178 Hà Tĩnh R S S S S S S S S R R R R R R R R R S R R S R R S S 161 I29 Hà Nam R S S S S S S R S R R R R R R R R R S S S S S S S R 162 I36 Hà Nam R S S S S S R S S R R R R R R R S R S R R S R R S S 163 I33 Hà Nam R S S S S S S S S R R R R R R R R R S R R S R R S R 164 I25 Hà Nam R S S S S S S S S R R R R R R R R R S R R S R R S S 165 I30 Hà Nam R S S S S S S S S R R R R R R R R R S R R S R R S S 166 I42 Hà Nam R S S S S S S S S R R R R R R R S R S R R S R R S S 167 I26 Hà Nam R S S S S S S S S R R R R R R R R R S R R S R S S S 168 I32 Hà Nam R S S S S S S S S R R R R R R R R R S R R S R R S S 169 I39 Hà Nam R S S S S S S S S R R R R R R R S R S R R R R S S S 170 I142 Điện Biên R S S S S R R S S R R R R R R R S R R S S S R R R R 171 I136 Điện Biên R R S S S S S S S R R R R R R R R R S R R S R R S S 172 I137 Điện Biên S S S S S R R R S R R R R R R R R R S R R S R S S S 161 173 I226 Cao Bằng R S S S S S S S S R R R R R R S S R S R R S S R S S 174 I241 Bắc Ninh R S S S S S S S S R R R R R R R R S R R R S R R R S 175 I211 Bắc Ninh R S S S S S S S S R R R R R R R S R S R R S R R S S 176 I242 Bắc Ninh R S S S S R R S S R R R R R R R R R R R S S R R R S 177 I211a Bắc Ninh R S S S S S S S S R R R R R R R S R S R R S R R S S 178 I236 Bắc Giang R S S S S S S S S R R S R R R R S S R R R R R S S S 179 I225 Bắc Cạn R S S S S S S S S R R R R R R R S R R R R S R R S S 180 I224 Bắc Cạn R S S S S S S S S R R R R R R R S R S R R S R R S S 181 I218 Bắc Cạn R S S S S S S S S R R R R R R R R R S R R S R R S S 182 I219 Bắc Cạn R S S S S S S S S S R R R R R R R R S R R R R S R S 183 I75 Thái Bình R S S S S S S S S R S R R S S R S S S R R S S R S S 184 I95 Sơn La R R S S S S S S S S S S S S S R R S S R R R R S S R 185 I169 Sơn La R S S S S S S S S R R R S S S R S R R R R S S S S S 186 I196 Quảng Trị R S S S S S S S S R R R R S S R S R R R R S S S R R 187 I186 Quảng Trị S S S S R R R S S S S S R S S R R R S S S S R S R S 188 I185 Quảng Bình S S S S R R R S S S S S S R S R R S R S S S R R R S 189 I201 Quảng Bình R S S S S R R R S S S S S R S R R R R S S S R R R S 190 I47 Ninh Bình R R S S S S S S S R R R R S S S S R R R R S S S S S 191 I162 Nam Định R S S S S R S S S R R R R R R R S S S R R S S S S S 162 192 I144 Lai Châu R S S S S S S S S S R R R S S R S R R R R S R S S S 193 I19 Hà Nội R S S S S S S S S S S S S S S R S S S R R S R R S S 194 I175 Hà Tĩnh R S S S S R R R S R S R R S S R S R S R S S R S S S 195 I203 Hà Tĩnh R S S S S R R S S R R R R S S R S R R R R S R S S S 196 I124 Điện Biên R S S S S S S S S R R R R S S R S R R R R S R R S S 197 I129 Điện Biên R S S S S S S S S R R R R S S R S S R R R S R R S S 198 I139 Điện Biên R S S S S S S S S R R R S S S R S R R R R S S S S S 199 I128 Điện Biên R S S S S S S S S S R R S S S R R R R R S S S R S S 200 I130 Điện Biên R S S S S S S S S R R R S S S R S R R R R S R R S S 201 I123 Điện Biên R S S S S S S S S R R R R S S R S R R R R S S S S R 202 I127 Điện Biên R S S S S S S S S S S R S S S S S S S R R S R R S S 203 I126 Điện Biên R S S S S S S S S R S S S S S S S S R R R S R S S S 204 I221 Bắc Cạn R S S S S S S S R R R R S S R S R S R R R S S S S S 205 I222 Bắc Cạn R S S S S S S S S R R R R R R S S S S S S S S S S S 206 I223 Bắc Cạn S S S S S S S S S S S R S S S R S S R R R S R R S S Tổng số nòi kháng 197 18 15 0 20 48 38 24 13 196 195 199 193 173 178 195 105 181 83 197 184 32 172 155 38 28 Tổng số nòi nhiễm 9 188 191 206 186 158 168 182 193 10 11 7 13 33 28 11 101 25 123 9 22 174 34 51 168 178 163 Phụ lục 3. Kết quả định danh các nòi nấm đạo ôn ở các vùng sinh thái trong nghiên cứu TT Tên nòi SL TT Tên nòi SL TT Tên nòi SL 1 U01-i0-k100-z00-ta200 1 46 U63-i3-k100-z04-ta731 1 91 U63-i7-k100-z04-ta422 1 2 U03-i1-k000-z05-ta430 1 47 U63-i3-k100-z05-ta433 1 92 U63-i7-k100-z04-ta423 2 3 U21-i0-k100-z00-ta403 1 48 U63-i3-k100-z06-ta713 1 93 U63-i7-k100-z05-ta003 2 4 U21-i2-k004-z00-ta001 1 49 U63-i3-k104-z01-ta421 1 94 U63-i7-k100-z05-ta023 1 5 U21-i4-k000-z01-ta402 1 50 U63-i4-k100-z00-ta403 1 95 U63-i7-k100-z05-ta402 1 6 U21-i4-k100-z01-ta401 1 51 U63-i4-k100-z00-ta423 1 96 U63-i7-k100-z05-ta403 14 7 U21-i5-k100-z00-ta423 1 52 U63-i4-k100-z00-ta602 1 97 U63-i7-k100-z05-ta422 2 8 U21-i6-k100-z04-ta403 1 53 U63-i4-k100-z01-ta700 1 98 U63-i7-k100-z05-ta602 1 9 U21-i6-k100-z05-ta003 1 54 U63-i4-k100-z05-ta403 1 99 U63-i7-k100-z05-ta603 1 10 U23-i0-k100-z05-ta003 1 55 U63-i4-k106-z01-ta423 1 100 U63-i7-k100-z06-ta403 1 11 U23-i3-k102-z01-ta032 1 56 U63-i5-k000-z03-ta613 1 101 U63-i7-k100-z07-ta402 1 12 U23-i4-k100-z04-ta403 1 57 U63-i5-k100-z01-ta402 1 102 U63-i7-k100-z07-ta403 1 13 U23-i6-k002-z01-ta431 1 58 U63-i5-k100-z05-ta403 3 103 U63-i7-k100-z11-ta223 1 14 U23-i6-k100-z04-ta403 1 59 U63-i6-k005-z03-ta012 1 104 U63-i7-k100-z12-ta222 1 15 U23-i6-k100-z05-ta403 1 60 U63-i6-k100-z00-ta402 1 105 U63-i7-k100-z15-ta413 1 16 U43-i0-k000-z01-ta030 1 61 U63-i6-k100-z00-ta403 1 106 U63-i7-k100-z17-ta733 1 17 U43-i0-k000-z03-ta632 1 62 U63-i6-k100-z01-ta003 1 107 U63-i7-k102-z01-ta403 1 18 U43-i0-k100-z04-ta403 1 63 U63-i6-k100-z04-ta402 1 108 U63-i7-k102-z04-ta003 1 164 19 U43-i1-k100-z00-ta031 1 64 U63-i6-k100-z04-ta403 1 109 U63-i7-k102-z05-ta403 1 20 U43-i3-k100-z00-ta401 1 65 U63-i6-k100-z04-ta733 1 110 U63-i7-k102-z16-ta403 1 21 U43-i5-k100-z00-ta402 1 66 U63-i6-k100-z05-ta000 1 111 U63-i7-k106-z01-ta403 3 22 U43-i7-k100-z00-ta403 1 67 U63-i6-k100-z05-ta403 1 112 U63-i7-k106-z01-ta423 1 23 U43-i7-k100-z01-ta002 1 68 U63-i6-k100-z05-ta413 1 113 U63-i7-k106-z01-ta430 1 24 U43-i7-k100-z01-ta423 1 69 U63-i6-k100-z07-ta433 1 114 U63-i7-k106-z01-ta431 1 25 U43-i7-k100-z05-ta403 1 70 U63-i7-k000-z04-ta403 1 115 U63-i7-k106-z03-ta403 1 26 U43-i7-k100-z14-ta403 1 71 U63-i7-k000-z12-ta201 1 116 U63-i7-k107-z01-ta403 1 27 U43-i7-k102-z05-ta403 1 72 U63-i7-k003-z12-ta433 1 117 U63-i7-k107-z01-ta433 2 28 U43-i7-k106-z11-ta433 1 73 U63-i7-k100-z00-ta010 1 118 U63-i7-k110-z04-ta022 1 29 U43-i7-k177-z06-ta021 1 74 U63-i7-k100-z00-ta402 1 119 U63-i7-k116-z01-ta423 1 30 U61-i0-k000-z03-ta030 1 75 U63-i7-k100-z00-ta403 5 120 U63-i7-k117-z00-ta613 1 31 U61-i0-k102-z01-ta411 1 76 U63-i7-k100-z00-ta423 1 121 U63-i7-k120-z07-ta403 1 32 U61-i4-k100-z1-ta403 1 77 U63-i7-k100-z00-ta702 1 122 U63-i7-k126-z07-ta413 1 33 U61-i5-k100-z04-ta013 1 78 U63-i7-k100-z01-ta401 1 123 U63-i7-k137-z17-ta403 1 34 U61-i5-k102-z04-ta423 1 79 U63-i7-k100-z01-ta402 1 124 U63-i7-k140-z03-ta023 1 35 U61-i6-k100-z04-ta003 1 80 U63-i7-k100-z01-ta403 7 125 U63-i7-k167-z13-ta423 1 36 U61-i6-k100-z05-ta403 1 81 U63-i7-k100-z01-ta423 1 126 U63-i7-k177-z07-ta403 1 37 U61-i7-k100-z04-ta403 1 82 U63-i7-k100-z01-ta431 1 127 U71-i4-k175-z02-ta702 1 38 U61-i7-k100-z04-ta423 1 83 U63-i7-k100-z01-ta603 1 128 U71-i4-k176-z04-ta722 1 165 39 U61-i7-k106-z01-ta423 1 84 U63-i7-k100-z02-ta402 1 129 U73-i0-k100-z04-ta423 1 40 U63-i0-k100-z00-ta402 1 85 U63-i7-k100-z04-ta001 1 130 U73-i6-k000-z01-ta002 1 41 U63-i0-k100-z05-ta413 1 86 U63-i7-k100-z04-ta003 3 131 U73-i7-k100-z01-ta403 1 42 U63-i0-k100-z11-ta031 1 87 U63-i7-k100-z04-ta401 3 132 U73-i7-k100-z03-ta213 1 43 U63-i0-k126-z05-ta623 1 88 U63-i7-k100-z04-ta402 2 133 U73-i7-k100-z04-ta423 1 44 U63-i0-k175-z00-ta702 1 89 U63-i7-k100-z04-ta403 36 134 U73-i7-k100-z04-ta423 1 45 U63-i2-k100-z00-ta430 1 90 U63-i7-k100-z04-ta413 1 135 U73-i7-k137-z03-ta403 1 166 Phụ lục 4. Danh sách các chỉ thị liên kết với các gen kháng bệnh đạo ôn sử dụng trong nghiên cứu TT Tên mồi Loại chỉ thị NST Trình tự mồi xuôi Trình tự mồi ngược 1 RM527 SSR 6 GGCTCGATCTAGAAAATCCG TTGCACAGGTTGCGATAGAG 2 RM541 SSR 6 TATAACCGACCTCAGTGCCC CCTTACTCCCATGCCATGAG 3 pB8 SCAR 6 CCGGACTAAGTACTGGCTTCGATA CCCAATCTCCAATGACCCATAAC 4 RM8225 SSR 6 TGTTGCATATGGTGCTATTTGA GATACGGCTTCTAGGCCAAA 5 RM3330 SSR 6 ATTATTCCCCTCTTCCGCTC AAGAAACCCTCGGATTCCTG 6 RM1233 SSR 11 TTCGTTTTCCTTGGTTAGTG ATTGGCTCCTGAAGAAGG 7 RM224 SSR 11 ATCGATCGATCTTCACGAGG TGCTATAAAAGGCATTCGGG 8 k4731F2/R SNP 11 GCAGATGCATCAGCCAGTGAGTG GTGCAGGACCGGCACGCAG 9 RM206 SSR 11 CCCATGCGTTTAACTATTCT CGTTCCATCGATCCGTATGG 10 RM2136 SSR 11 ATGTTTGAGAAAATGCAGAC CACTAAGCTCGTTTTCAAAG 11 RM144 SSR 11 TGCCCTGGCGCAAATTTGATCC GCTAGAGGAGATCAGATGGTAGTGCATG 12 RM7654B SSR 11 CAAAAGTCTGACCGTTTACC TAAGAGACGGAAGAGTGAGC 13 RM4112 SSR 11 TGGCAAAGTCAGTAGTCCTTCCACAA GCCATTCCCCCAACAGCTCC 14 k6816 Indel 11 TCGCCGATGCGGTTGATTTACTC CGTATTTTGTGTTGTTAGGAGATAAGG 167 Phụ lục 5. Danh sách các chỉ thị sử dụng trong nghiên cứu T Tên chỉ thị NST TT Tên chỉ thị NST TT Tên chỉ thị NST 1 RM3143 1 31 RM1032 1 61 RM10086 1 2 RM5461 1 32 RM6324 1 62 RM10159 1 3 RM3447 1 33 RM8084 1 63 RM10227 1 4 RM11475 1 34 RM8278 1 64 RM10284 1 5 RM1287 1 35 RM8131 1 65 RM10334 1 6 RM6840 1 36 RM3652 1 66 RM10383 1 7 RM5365 1 37 RM6407 1 67 RM10567 1 8 RM3174 1 38 RM6696 1 68 RM10601 1 9 RM1 1 39 RM8133 1 69 RM10708 1 10 RM8137 1 40 RM3426 1 70 RM10757 1 11 RM5638 1 41 RM5552 1 71 RM10806 1 12 RM8111 1 42 RM1387 1 72 RM10870 1 13 RM495 1 43 RM8046 1 73 RM10951 1 14 RM8136 1 44 RM8105 1 74 RM10974 1 15 RM8129 1 45 RM579 1 75 RM10992 1 16 RM8078 1 46 RM529 1 76 RM11019 1 17 RM1282 1 47 RM3627 1 77 RM11060 1 18 RM3252 1 48 RM5302 1 78 RM11142 1 19 RM259 1 49 RM8147 1 79 RM11229 1 20 RM3148 1 50 RM5310 1 80 RM11351 1 21 RM5497 1 51 RM493 1 81 RM11398 1 22 RM5931 1 52 RM581 1 82 RM11438 1 23 RM583 1 53 RM1349 1 83 RM11514 1 24 RM5423 1 54 RM3241 1 84 RM11553 1 25 RM3740 1 55 RM3468 1 85 RM11629 1 26 RM5914 1 56 RM104 1 86 RM11813 1 27 RM8083 1 57 RM3411 1 87 RM11840 1 28 RM7278 1 58 RM10837 1 88 RM11911 1 29 RM3709 1 59 RM10000 1 89 RM12135 1 30 RM7180 1 60 RM10051 1 90 RM12178 1 168 STT Tên chỉ thị NST STT Tên chỉ thị NST STT Tên chỉ thị NST 91 RM12221 1 121 RM5631 2 151 RM13938 2 92 RM12293 1 122 RM6853 2 152 RM13998 2 93 RM3874 2 123 RM6933 2 153 RM14040 2 94 RM266 2 124 RM5356 2 154 RM14080 2 95 RM4499 2 125 RM5472 2 155 RM14141 2 96 RM1313 2 126 RM324 2 156 RM14228 2 97 RM13352 2 127 RM5812 2 157 RM2265 2 98 RM13414 2 128 RM14178 2 158 RM6959 3 99 RM13628 2 129 RM12294 2 159 RM7389 3 100 RM13504 2 130 RM12337 2 160 RM4492 3 101 RM2770 2 131 RM12376 2 161 RM6103 3 102 RM240 2 132 RM12846 2 162 RM14291 3 103 RM5916 2 133 RM12986 2 163 RM3867 3 104 RM262 2 134 RM13072 2 164 RM6676 3 105 RM7562 2 135 RM13101 2 165 RM3601 3 106 RM3302 2 136 RM13114 2 166 RM6849 3 107 RM3515 2 137 RM13141 2 167 RM489 3 108 RM3732 2 138 RM13159 2 168 RM5755 3 109 RM4355 2 139 RM13181 2 169 RM6594 3 110 RM6318 2 140 RM13208 2 170 RM2334 3 111 RM3865 2 141 RM13233 2 171 RM2614 3 112 RM1920 2 142 RM13302 2 172 RM4853 3 113 RM1347 2 143 RM13380 2 173 RM168 3 114 RM7451 2 144 RM13544 2 174 RM569 3 115 RM1367 2 145 RM13577 2 175 RM3126 3 116 RM6378 2 146 RM13603 2 176 RM6329 3 117 RM6275 2 147 RM13663 2 177 RM7117 3 118 RM3512 2 148 RM13746 2 178 RM5924 3 119 RM5862 2 149 RM13821 2 179 RM8203 3 120 RM5427 2 150 RM13871 2 180 RM7000 3 169 STT Tên chỉ thị NST STT Tên chỉ thị NST STT Tên chỉ thị NST 181 RM6987 3 211 RM15303 3 241 RM2275 4 182 RM3329 3 212 RM15325 3 242 RM6997 4 183 RM1221 3 213 RM15351 3 243 RM8213 4 184 RM442 3 214 RM15377 3 244 RM3367 4 185 RM14233 3 215 RM15426 3 245 RM3308 4 186 RM14325 3 216 RM15458 3 246 RM124 4 187 RM14364 3 217 RM15509 3 247 RM3785 4 188 RM14396 3 218 RM15561 3 248 RM1205 4 189 RM14442 3 219 RM15606 3 249 RM1223 4 190 RM14487 3 220 RM15639 3 250 RM5586 4 191 RM14526 3 221 RM15672 3 251 RM5414 4 192 RM14566 3 222 RM15718 3 252 RM1354 4 193 RM14654 3 223 RM15766 3 253 RM1359 4 194 RM14677 3 224 RM15813 3 254 RM3735 4 195 RM14704 3 225 RM15854 3 255 RM5749 4 196 RM14737 3 226 RM15979 3 256 RM3471 4 197 RM14775 3 227 RM16017 3 257 RM3288 4 198 RM14818 3 228 RM16061 3 258 RM7472 4 199 RM14849 3 229 RM16110 3 259 RM7187 4 200 RM14891 3 230 RM16140 3 260 RM1155 4 201 RM14931 3 231 RM16175 3 261 RM5633 4 202 RM14966 3 232 RM16210 3 262 RM6089 4 203 RM15021 3 233 RM16249 3 263 RM3337 4 204 RM15066 3 234 RM8267 3 264 RM5900 4 205 RM15125 3 235 RM7076 3 265 RM3217 4 206 RM15181 3 236 RM5506 4 266 RM3524 4 207 RM15214 3 237 RM2811 4 267 RM5503 4 208 RM15248 3 238 RM16459 4 268 RM7563 4 209 RM15281 3 239 RM16943 4 269 RM3317 4 210 RM15291 3 240 RM17032 4 270 RM3276 4 170 STT Tên chỉ thị NST STT Tên chỉ thị NST STT Tên chỉ thị NST 271 RM3839 4 301 RM16801 4 331 RM3476 5 272 RM5687 4 302 RM17075 4 332 RM3838 5 273 RM5879 4 303 RM17108 4 333 RM592 5 274 RM3687 4 304 RM17162 4 334 RM7446 5 275 RM3843 4 305 RM17239 4 335 RM598 5 276 RM3836 4 306 RM17279 4 336 RM3348 5 277 RM8217 4 307 RM17305 4 337 RM6024 5 278 RM5478 4 308 RM17358 4 338 RM267 5 279 RM1113 4 309 RM17392 4 339 RM3790 5 280 RM6006 4 310 RM17501 4 340 RM1237 5 281 RM280 4 311 RM17598 4 341 RM413 5 282 RM16252 4 312 RM17708 4 342 RM3170 5 283 RM16327 4 313 RM7279 4 343 RM4743 5 284 RM16368 4 314 RM6909 4 344 RM6313 5 285 RM16382 4 315 RM1089 5 345 RM6621 5 286 RM16408 4 316 RM6054 5 346 RM8211 5 287 RM16432 4 317 RM18307 5 347 RM2998 5 288 RM16496 4 318 RM18750 5 348 RM1386 5 289 RM16513 4 319 RM169 5 349 RM516 5 290 RM16550 4 320 RM437 5 350 RM26 5 291 RM16575 4 321 RM3351 5 351 RM17709 5 292 RM16578 4 322 RM5844 5 352 RM17756 5 293 RM16592 4 323 RM3663 5 353 RM17784 5 294 RM16616 4 324 RM6742 5 354 RM17811 5 295 RM16642 4 325 RM4244 5 355 RM17881 5 296 RM16675 4 326 RM6645 5 356 RM17916 5 297 RM16695 4 327 RM3796 5 357 RM17960 5 298 RM16717 4 328 RM6841 5 358 RM17980 5 299 RM16730 4 329 RM3437 5 359 RM18018 5 300 RM16755 4 330 RM7302 5 360 RM18057 5 171 STT Tên chỉ thị NST STT Tên chỉ thị NST STT Tên chỉ thị NST 361 RM18098 5 391 RM225 6 421 RM4128 6 362 RM18124 5 392 RM5463 6 422 RM8112 6 363 RM18160 5 393 RM20589 6 423 RM6782 6 364 RM18176 5 394 RM314 6 424 RM7311 6 365 RM18222 5 395 RM19381 6 425 RM6701 6 366 RM18246 5 396 RM20590 6 426 RM510 6 367 RM18271 5 397 RM8121 6 427 RM6395 6 368 RM18286 5 398 RM3827 6 428 RM3183 6 369 RM18343 5 399 RM539 6 429 RM549 6 370 RM18371 5 400 RM508 6 430 RM3805 6 371 RM18402 5 401 RM4447 6 431 RM7309 6 372 RM18413 5 402 RM6302 6 432 RM7488 6 373 RM18458 5 403 RM3794 6 433 RM204 6 374 RM18496 5 404 RM7399 6 434 RM162 6 375 RM18539 5 405 RM1340 6 435 RM7193 6 376 RM18607 5 406 RM6836 6 436 RM1169 6 377 RM18650 5 407 RM5754 6 437 RM8125 6 378 RM18705 5 408 RM589 6 438 RM3343 6 379 RM18792 5 409 RM6446 6 439 RM5585 6 380 RM18827 5 410 RM2615 6 440 RM8258 6 381 RM18872 5 411 RM586 6 441 RM7555 6 382 RM18915 5 412 RM3272 6 442 RM461 6 383 RM18978 5 413 RM527 6 443 RM8242 6 384 RM19021 5 414 RM276 6 444 RM494 6 385 RM19052 5 415 RM1369 6 445 RM19776 6 386 RM19095 5 416 RM3628 6 446 RM19228 6 387 RM19137 5 417 RM3370 6 447 RM19318 6 388 RM19184 5 418 RM8101 6 448 RM19360 6 389 RM19223 5 419 RM5371 6 449 RM19410 6 390 RM19267 6 420 RM5850 6 450 RM19441 6 172 STT Tên chỉ thị NST STT Tên chỉ thị NST STT Tên chỉ thị NST 451 RM19545 6 481 RM20499 6 511 RM21131 7 452 RM19496 6 482 RM20543 6 512 RM21171 7 453 RM19596 6 483 RM20640 6 513 RM21209 7 454 RM19641 6 484 RM20690 6 514 RM21276 7 455 RM19673 6 485 RM20741 6 515 RM21300 7 456 RM19712 6 486 RM20774 6 516 RM21351 7 457 RM19746 6 487 RM8120 6 517 RM21384 7 458 RM19814 6 488 RM8225 6 518 RM21399 7 459 RM19834 6 489 RM2229 6 519 RM21422 7 460 RM19865 6 490 RM21464 7 520 RM21443 7 461 RM19908 6 491 RM248 7 521 RM21500 7 462 RM19951 6 492 RM6326 7 522 RM21520 7 463 RM19979 6 493 RM5793 7 523 RM21547 7 464 RM19996 6 494 RM427 7 524 RM21579 7 465 RM20005 6 495 RM6344 7 525 RM21615 7 466 RM20019 6 496 RM6767 7 526 RM21649 7 467 RM20064 6 497 RM481 7 527 RM21700 7 468 RM20086 6 498 RM234 7 528 RM21725 7 469 RM20109 6 499 RM11 7 529 RM21767 7 470 RM20132 6 500 RM1353 7 530 RM21781 7 471 RM20158 6 501 RM8261 7 531 RM21826 7 472 RM20194 6 502 RM3404 7 532 RM21854 7 473 RM20233 6 503 RM1134 7 533 RM21920 7 474 RM20266 6 504 RM20775 7 534 RM21955 7 475 RM20294 6 505 RM20847 7 535 RM22041 7 476 RM20319 6 506 RM20889 7 536 RM22065 7 477 RM20353 6 507 RM20934 7 537 RM22092 7 478 RM20385 6 508 RM20972 7 538 RM22160 7 479 RM20422 6 509 RM21030 7 539 RM22188 7 480 RM20462 6 510 RM21092 7 540 RM3395 8 173 STT Tên chỉ thị NST STT Tên chỉ thị NST STT Tên chỉ thị NST 541 RM6948 8 571 RM22916 8 601 RM23711 9 542 RM44 8 572 RM22943 8 602 RM23729 9 543 RM22674 8 573 RM22978 8 603 RM23747 9 544 RM22300 8 574 RM22994 8 604 RM23769 9 545 RM1235 8 575 RM22257 8 605 RM23793 9 546 RM1615 8 576 RM23022 8 606 RM23823 9 547 RM22654 8 577 RM23056 8 607 RM23851 9 548 RM404 8 578 RM23083 8 608 RM23876 9 549 RM342B 8 579 RM23126 8 609 RM23907 9 550 RM8019 8 580 RM23211 8 610 RM23941 9 551 RM4085 8 581 RM23251 8 611 RM23979 9 552 RM310 8 582 RM23285 8 612 RM24004 9 553 RM4815 8 583 RM23330 8 613 RM24032 9 554 RM22335 8 584 RM23364 8 614 RM24076 9 555 RM22380 8 585 RM23420 8 615 RM24144 9 556 RM22442 8 586 RM23171 8 616 RM24195 9 557 RM22476 8 587 RM22189 8 617 RM24225 9 558 RM22516 8 588 RM23605 8 618 RM24309 9 559 RM22558 8 589 RM23653 8 619 RM24353 9 560 RM22597 8 590 RM23510 8 620 RM24451 9 561 RM22628 8 591 RM23555 8 621 RM24490 9 562 RM22703 8 592 RM3919 9 622 RM24537 9 563 RM22739 8 593 RM5786 9 623 RM24579 9 564 RM22774 8 594 RM24674 9 624 RM24628 9 565 RM22806 8 595 RM24254 9 625 RM24716 9 566 RM22831 8 596 RM24763 9 626 RM25319 10 567 RM22847 8 597 RM24102 9 627 RM171 10 568 RM22860 8 598 RM24824 9 628 RM216 10 569 RM22877 8 599 RM215 9 629 RM24852 10 570 RM22901 8 600 RM4405 9 630 RM24899 10 174 STT Tên chỉ thị NST STT Tên chỉ thị NST STT Tên chỉ thị NST 631 RM24918 10 661 RM26622 11 691 RM26885 11 632 RM24957 10 662 RM27150 11 692 RM26952 11 633 RM24992 10 663 RM26821 11 693 RM26987 11 634 RM25019 10 664 RM26119 11 694 RM27027 11 635 RM25066 10 665 RM4862 11 695 RM27098 11 636 RM25092 10 666 RM27389 11 696 RM27185 11 637 RM25108 10 667 RM224 11 697 RM27266 11 638 RM25128 10 668 RM25998 11 698 RM27335 11 639 RM25146 10 669 RM26038 11 699 RM27232 11 640 RM25167 10 670 RM26068 11 700 RM26930 11 641 RM25185 10 671 RM26160 11 701 RM27299 11 642 RM25220 10 672 RM26200 11 702 RM27051 11 643 RM25248 10 673 RM26227 11 703 RM1233 11 644 RM25271 10 674 RM26252 11 704 RM1337 12 645 RM25296 10 675 RM26290 11 705 RM5479 12 646 RM25359 10 676 RM26319 11 706 RM27552 12 647 RM25389 10 677 RM26362 11 707 RM1880 12 648 RM25420 10 678 RM26390 11 708 RM1261 12 649 RM25480 10 679 RM26428 11 709 RM2972 12 650 RM25517 10 680 RM26463 11 710 RM3455 12 651 RM25552 10 681 RM26524 11 711 RM4552 12 652 RM25611 10 682 RM26556 11 712 RM6123 12 653 RM25658 10 683 RM26567 11 713 RM7619 12 654 RM25711 10 684 RM26596 11 714 RM8214 12 655 RM25756 10 685 RM26654 11 715 RM491 12 656 RM25785 10 686 RM26677 11 716 RM1246 12 657 RM25815 10 687 RM26705 11 717 RM1015 12 658 RM25868 10 688 RM26761 11 718 RM1080 12 659 RM25939 10 689 RM26797 11 719 RM1103 12 660 RM5926 11 690 RM26841 11 720 RM1227 12 175 STT Tên chỉ thị NST STT Tên chỉ thị NST STT Tên chỉ thị NST 721 RM5195 12 734 RM27838 12 747 RM27489 12 722 RM7376 12 735 RM27863 12 748 RM28217 12 723 RM19 12 736 RM27888 12 749 RM28303 12 724 RM27402 12 737 RM27941 12 750 RM28339 12 725 RM27447 12 738 RM27955 12 751 RM28374 12 726 RM27515 12 739 RM27962 12 752 RM28405 12 727 RM27613 12 740 RM27982 12 753 RM28456 12 728 RM27659 12 741 RM28029 12 754 RM28495 12 729 RM27709 12 742 RM28050 12 755 RM28610 12 730 RM27735 12 743 RM28070 12 756 RM28665 12 731 RM27774 12 744 RM28095 12 757 RM28731 12 732 RM27801 12 745 RM28112 12 758 RM28794 12 733 RM28148 12 746 RM28828 12 176 Phụ lục 6. Danh sách các chỉ thị phân tử SSR cho đa hình giữa các giống lúa BC15, IRBLkh-K3[CO] và AH3 trên 12 NST TT Tên chỉ thị NST Vị trí (Mb) Trình tự mồi xuôi/ ngược Kích thước sản phẩm PCR 1 RM1287 1 10,84 GTGAAGAAAGCATGGTAAATG CTCAGCTTGCTTGTGGTTAG 162 2 RM5461 1 26,90 GCCTCCCATATAAACCGGC AGCGAAGGGAACACGACAG 134 3 RM11475 1 27,24 GAGGAGCTCATGTTAGTGGAGAAGG TTCAGCTGGAAGCACAACTTCG 278 4 RM3447 1 35,25 AACCAGCAGATCGTCGAAAG GAAATGAGATGGCATCCGAG 187 5 RM2770 2 0,81 TAGGCCCTGATTAGTTTCC ATATATGTGTCCCTTCTCCATAC 184 6 RM13233 2 17,33 CCCATGTATACCTGACTGTAAGAGG ATACTCATCTATGGCGGTTTCC 247 7 RM13352 2 19,49 CAGTCGTTTAGAAAGCGGTTTAGG TGATGTTTCGTGCTCTAGGAAGC 255 8 RM13414 2 20,96 CTTGCTTTCCACAAATTCCTACCC CCAACCCTCGCAAGCTACTCC 173 9 RM1920 2 25,46 CAAACACAGTGTTGACAGAA CTATTGACTTATCCGTTCA 127 10 RM240 2 31,50 CCTTAATGGGTAGTGTGCAC TGTAACCATTCCTTCCATCC 132 11 RM14291 3 0,73 CTGAGGAATCGAATTGAGACTCG ATCAGCAACCAGTCCATTCAGC 170 12 RM6676 3 14,49 AATGTTCACGGTCCAATAAG CATGCATAACACCCAAATG 170 13 RM6959 3 14,51 TCCTATGGAGGATTGTTGCC CGGAGGAGCAGAACAAAAAC 106 14 RM7389 3 36,16 AGCGACGGATGCATGATC TTGAGCCGGAGGTAGTCTTG 111 15 RM5924 3 30,66 CTCCCAAGAAACTGAACCAG AGGATTCGTCGTTGCTCAAC 209 16 RM3867 3 31,75 TTGACTGGAACATCGAGCTC ATCCCCTCTACACCGTACCC 120 17 RM7000 3 33,80 CCCTTCTTTTCAACTGAATA TTGTAACAATGAACTCGTTC 138 177 TT Tên chỉ thị NST Vị trí (Mb) Trình tự mồi xuôi/ ngược Kích thước sản phẩm PCR 18 RM3329 3 35,60 GCACATACAGAAATGGTGAA GGCAAGGGACATGTAGTAAC 120 19 RM1221 3 35,67 GAGTAGAGAGAGATGGCGGC AGGATTAGCAGCGTTAAGCG 182 20 RM442 3 35,79 CTTAAGCCGATGCATGAAGG ATCCTATCGACGAATGCACC 257 21 RM5414 4 2,03 ACCATGGTTCAAGAGTGAAA ACAGCTCAACCTGTTGAGTG 116 22 RM16459 4 5,21 TCCAGGAGTTTGCCTTGTAGTGC TAGCGAAGTCAGGATGGCATAGG 190 23 RM3471 4 6,31 AGATCCCGACAGATGGTGAC AACAGAGGGAGGGAGCAGAG 147 24 RM5633 4 13,07 GTGTAGCTGCTAGGCCGAAC TTCCTTTCGCTACGTTGGAC 211 25 RM7279 4 13,76 TGAAGGAGATACACCGAAAC GGCTTGAGAGCGTTTGTAG 201 26 RM3308 4 19,00 TACTTTTCTCTCCCCCCTCG GGGAGGAGATTGGTTGGC 147 27 RM5506 4 33,31 AGGCGATGTTTGATCTCGAC CTGGACGTACACACACGTACG 150 28 RM18750 5 21,18 AGCCGGGAAGAGACCAAGAGTCC GTGACCTGCGCCATCATCAGG 140 29 RM169 5 7,50 TGGCTGGCTCCGTGGGTAGCTG TCCCGTTGCCGTTCATCCCTCC 167 30 RM437 5 3,88 ACACCAACCAGATCAGGGAG TGCTCGTCAATGGTGAGTTC 275 31 RM6742 5 14,82 CATCCGATACTTCCTCCGAG CGAACGTGATATCTCCGTCC 178 32 RM3838 5 16,50 TTGTAGATGTTGCCAGTTTG TGTTGACATCTGTGAGCCGG 170 33 RM6024 5 17,75 ACATTCGTCCAGGGATTCAC TTGTGGTTGCTCACCTCTTG 178 34 RM19267 6 0,80 GTGCAACGGCGCTAAACTACAGG CCTAGAGAAGAGGAGAGGCCAACG 142 35 RM225 6 3,42 TGCCCATATGGTCTGGATG AAAGTGGATCAGGAAGGC 140 36 RM314 6 4,84 CTAGCAGGAACTCCTTTCAGG AACATTCCACACACACACGC 118 37 RM539 6 8,20 GAGCGTCCTTGTTAAAACCG AGTAGGGTATCACGCATCCG 272 178 TT Tên chỉ thị NST Vị trí (Mb) Trình tự mồi xuôi/ ngược Kích thước sản phẩm PCR 38 RM508 6 0,44 ATAGTTCATGCATTGCGTCT ACGACCAATCTCACCAACTA 129 39 RM589 6 1,38 ATCATGGTCGGTGGCTTAAC CAGGTTCCAACCAGACACTG 186 40 RM5850 6 11,00 TTAGGTGTGTGAGCGTGGC ATACACAGATGACGCACACG 181 41 RM7311 6 11,04 AGTGGTCGTTGAACTCGGAG TCGTGGCGCCTTTAATCTC 147 42 RM204 6 3,17 GTGACTGACTTGGTCATAGGG GCTAGCCATGCTCTCGTACC 169 43 RM19776 6 9,22 ACCTGCTCCATCCATCTCTACGG AGCAACGTGGTACAGATTACAGAAGC 190 44 RM8120 6 0,48 ATTGACCTGATGTATGTAATATATCAAG AGAACAAGAAAGCCTATCACTATATATC 146 45 RM5793 7 17,49 ACTCTCTTGCGCAACTCCTC GATAATGCTAGCTGCTGGCC 127 46 RM3395 8 10,29 ACCTCATGTCCAGGTGGAAG AGATTAGTGCCATGGCAAGG 97 47 RM22674 8 8,50 TCAATCAATGGCATGTCAGACC GTGTTACAGTCTGCATTAACCACACC 124 48 RM24102 9 11,25 GCACCTGAACCTAGACTCGACACG TAGGGAGAGGGCTCTCACATGC 173 49 RM24254 9 14,06 TGCTACTTCGTGCCTCGCTACC AATTGATTAGCGCACGCATCC 184 50 RM3919 9 19,64 GTGAGTGATCTTCATCAGTG CGATGGTTATCTGTAAACAG 201 51 RM24763 9 21,85 AATTTCAGCCACAATGGAGTGTCC CTTCAATGACAGGCACTTTGACG 139 52 RM24824 9 22,61 GGATGAACACAAACACGTATGC GGTAACTGTTGGATGCAAAGAGC 151 53 RM216 10 5,35 GCATGGCCGATGGTAAAG TGTATAAAACCACACGGCCA 146 54 RM25319 10 12,69 AGGGTAGAGTATGTCGGTGTTTCC CCGTGGCAGTAGCAGTAGGC 179 55 RM171 10 19,05 AACGCGAGGACACGTACTTAC ACGAGATACGTACGCCTTTG 328 56 RM26821 11 18,55 CTCGATAGCATCCTCAGAGCAAGG ATCTCCTCCCGGGAAACTGC 125 57 RM224 11 27,58 ATCGATCGATCTTCACGAGG TGCTATAAAAGGCATTCGGG 135 179 TT Tên chỉ thị NST Vị trí (Mb) Trình tự mồi xuôi/ ngược Kích thước sản phẩm PCR 58 RM5926 11 28,43 ATATACTGTAGGTCCATCCA AGATAGTATAGCGTAGCAGC 176 59 RM27389 11 28,44 ACCGACACCGTCTCCATTATCC TTGTTTGCCTCCTCTGCAACG 154 60 RM1337 12 11,93 GTGCAATGCTGAGGAGTATC CTGAGAATCTGGAGTGCTTG 210 61 RM5479 12 24,38 AACTCCTGATGCCTCCTAAG TCCATAGAAACAATTTGTGC 197 PHỤ LỤC 7. DIỄN BIẾN THỜI TIẾT TẠI HÀ NỘI Nhiệt độ trung bình theo ngày từ tháng 6 đến tháng 10 năm 2019 Tháng Ngày VI VII VIII IX X 1 24,6 30,5 28 27 28,6 2 26,6 29,9 27,4 28,8 28,5 3 29,3 30,5 26,4 29,1 26,1 4 30,3 28,1 26,3 29,0 26,5 5 29,5 30,9 27,7 30,5 27,0 6 30,2 32,3 29,9 30,7 28,1 7 30,6 32,4 31,4 31,2 27,6 8 30,5 33,5 30,9 30,9 26,1 9 32,7 32,0 29,3 30,5 24,6 10 33,1 28,8 31,7 27,3 27,4 11 32,1 30,1 31,9 27,5 28,6 12 33,8 32,8 32,2 28,9 28,9 13 31,7 32,9 32,8 29,2 28,3 14 30,8 31,4 34,0 29,7 26,5 15 32,4 30,0 31,9 30,0 25,7 16 32,4 29,7 29,3 28,8 26,3 17 31,2 31,9 28,9 29,2 25,8 18 27,6 32,2 30,8 29,3 24,4 19 29,9 33,6 30,6 26,0 24,9 20 31,6 31,8 28,4 27,6 26,1 21 33,3 29,0 27,2 28,6 27,0 22 33,8 30,4 27,5 27,7 27,6 180 23 32,6 31 27,7 26,7 28,7 24 28,3 30,2 28,1 26,8 23,4 25 29,8 28 29,8 27,2 23,8 26 31,4 30,3 30 27,4 25,3 27 33 31,6 29,4 27,8 26 28 35 31,4 29,1 27,2 22,8 29 34,4 30,2 29,8 27,4 22,9 30 28,7 28,7 28,2 28,1 22,7 31 29,7 26,4 22,5 Độ ẩm trung bình theo ngày từ tháng 6 đến tháng 10 năm 2019 Tháng Ngày VI VII VIII IX X 1 88 75 86 84 67 2 78 82 86 74 79 3 79 81 91 73 89 4 81 88 91 82 86 5 80 79 85 75 76 6 82 71 79 75 79 7 84 70 77 73 74 8 82 67 78 78 86 9 72 74 78 81 92 10 72 83 74 89 82 11 78 80 77 87 78 12 69 66 75 82 78 13 75 67 70 78 78 14 81 78 65 71 80 15 72 78 70 72 76 16 75 80 82 82 81 17 81 78 84 79 85 18 87 79 77 79 76 19 84 72 81 90 73 20 78 68 83 81 78 21 70 76 90 68 79 22 67 74 89 57 78 23 76 66 86 64 80 24 84 73 84 63 85 25 74 86 76 63 82 181 26 71 78 85 68 86 27 66 74 77 64 86 28 60 76 81 67 87 29 64 79 79 65 68 30 80 82 80 65 66 31 77 88 66 Nhiệt độ trung bình theo ngày từ tháng 1 đến tháng 6 năm 2020 Tháng Ngày I II III IV V VI 1 20,6 16,2 24,3 20,1 24,4 30,8 2 21,5 17,6 23,8 19,9 26,7 30,5 3 22,5 18,0 23,4 21,6 28,2 32,1 4 21,9 14,4 19,9 19,5 29,4 32,1 5 21,1 14,4 16,9 18,2 29,4 32,4 6 22,7 16,8 19,7 17,4 29,2 32,3 7 22,2 18,6 21,6 19,7 29,7 34,0 8 23,6 18,1 24,4 20,0 30,1 33,9 9 23,9 15,2 27,4 22,1 29,1 32,9 10 23,7 16,1 25,3 24,3 30,9 30,8 11 22,2 19,3 22,6 25,6 29,6 29,5 12 16,9 20,5 22,8 20,9 27,3 29,4 13 16,9 21,4 24,6 16,9 27,4 31,0 14 19,0 23,6 23,0 18,9 27,7 29,7 15 22,8 25,1 20,2 21,3 29,4 27,6 16 23,1 19,6 20,7 23,5 28,8 30,5 17 17,0 17,8 22,2 24,5 28,9 30,9 18 15,2 18,0 19,4 26,1 29,0 31,6 19 15,1 18,3 19,7 26,3 29,7 30,9 20 14,6 19,0 21,9 27,1 32,1 31,3 21 17,6 18,5 23,8 27,0 34,6 32,3 22 20,4 19,9 25,2 25,5 33,1 33,4 23 23,8 19,7 24,9 21,6 29,6 32,7 24 22,4 21,8 25,7 18,0 30,1 32,9 25 18,8 22,2 25,7 19,1 31,9 31,5 26 15,5 22,6 26,4 20,2 29,0 31,9 27 15,6 23,6 26,9 22,9 27,3 32,2 28 15,1 23,8 26,4 25,1 28,6 32,4 182 29 15,0 23,6 24,8 25,4 29,9 32,0 30 15,2 22,4 25,7 31,1 31,8 31 16,0 18,9 31,1 Độ ẩm trung bình theo ngày từ tháng1 đến tháng 6 năm 2020 Tháng Ngày I II III IV V VI 1 89 86 86 79 92 72 2 88 90 89 95 82 72 3 83 95 88 94 82 69 4 90 95 92 90 82 72 5 93 96 86 78 84 69 6 82 92 84 87 83 70 7 90 93 86 79 83 62 8 80 94 85 88 83 61 9 79 85 74 84 84 63 0 78 83 64 82 75 78 11 80 87 70 84 84 82 12 68 88 80 80 83 78 13 88 96 85 88 87 76 14 91 92 71 74 75 84 15 82 86 83 80 84 88 16 83 53 91 86 79 78 17 77 44 94 93 81 74 18 94 49 96 85 80 72 19 82 72 91 87 84 77 20 87 86 82 85 76 74 21 88 92 86 88 61 72 22 86 86 88 89 70 67 23 80 83 89 82 82 67 24 93 76 80 85 81 63 25 86 82 84 79 76 78 26 66 80 84 80 74 69 27 56 77 82 68 76 70 28 62 78 83 68 75 70 29 62 82 90 72 74 76 30 64 87 82 70 78 31 72 88 75 183 PHỤ LỤC 8. KẾT QUẢ SỬ LÝ SỐ LIỆU THỐNG KÊ Kết quả sử lý số liệu vụ xuân 2019 BALANCED ANOVA FOR VARIATE CCC FILE BC1F3 29/ 7/2019 15:16 ------------------------------------------------------------------ :PAGE 1 VARIATE V003 CCC LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 10 205.840 20.5840 3.90 0.005 3 2 NL 2 11.7751 5.88757 1.11 0.349 3 * RESIDUAL 20 105.678 5.28391 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 32 323.293 10.1029 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE B/KHOM FILE BC1F3 29/ 7/2019 15:16 ------------------------------------------------------------------ :PAGE 2 VARIATE V004 B/KHOM LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 10 1.44242 .144242 0.47 0.888 3 2 NL 2 .220606 .110303 0.36 0.705 3 * RESIDUAL 20 6.09939 .304970 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 32 7.76242 .242576 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE CDB FILE BC1F3 29/ 7/2019 15:16 ------------------------------------------------------------------ :PAGE 3 VARIATE V005 CDB LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 10 14.1152 1.41152 1.13 0.386 3 2 NL 2 1.17515 .587576 0.47 0.635 3 * RESIDUAL 20 24.8848 1.24424 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 32 40.1752 1.25547 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE HATCHA FILE BC1F3 29/ 7/2019 15:16 ------------------------------------------------------------------ :PAGE 4 VARIATE V006 HATCHA LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 10 1547.77 154.777 0.64 0.762 3 2 NL 2 123.324 61.6619 0.26 0.779 3 * RESIDUAL 20 4815.03 240.751 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 32 6486.13 202.691 ----------------------------------------------------------------------------- 184 BALANCED ANOVA FOR VARIATE P1000 HA FILE BC1F3 29/ 7/2019 15:16 ------------------------------------------------------------------ :PAGE 5 VARIATE V007 P1000 HAT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 10 .865454 .865454E-01 0.92 0.532 3 2 NL 2 .806059E-01 .403029E-01 0.43 0.661 3 * RESIDUAL 20 1.87273 .936363E-01 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 32 2.81879 .880871E-01 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE NSTT FILE BC1F3 29/ 7/23 15:16 ------------------------------------------------------------------ :PAGE 6 VARIATE V008 NSTT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 10 2.98061 .298061 0.82 0.616 3 2 NL 2 .182424 .912122E-01 0.25 0.783 3 * RESIDUAL 20 7.27758 .363879 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 32 10.4406 .326269 ----------------------------------------------------------------------------- TABLE OF MEANS FOR FACTORIAL EFFECTS FILE BC1F3 29/ 7/2019 15:16 ------------------------------------------------------------------ :PAGE 7 MEANS FOR EFFECT CT$ ------------------------------------------------------------------------------- CT$ NOS CCC B/KHOM CDB HATCHA B1 3 115.167 6.66667 27.8333 176.700 B2 3 116.667 6.80000 27.0000 176.033 B3 3 119.667 6.53333 28.0000 177.000 B4 3 114.600 6.73333 27.2667 174.533 B5 3 112.200 6.73333 26.8667 171.000 B6 3 113.667 6.86667 27.3333 162.900 B7 3 112.167 6.46667 27.6667 184.800 B8 3 113.567 6.40000 26.5000 180.333 B9 3 109.433 6.26667 26.1000 182.400 B10 3 114.333 6.33333 26.0000 182.133 BC15 3 114.000 6.26667 27.6667 164.067 SE(N= 3) 1.32714 0.318836 0.644009 8.95826 5%LSD 20DF 3.91502 0.940557 1.89981 26.4266 CT$ NOS P1000 HAT NSTT B1 3 23.4000 7.10000 B2 3 23.2667 7.26667 B3 3 23.1667 6.76667 B4 3 23.5000 7.30000 B5 3 23.6667 6.96667 B6 3 23.5333 6.86667 B7 3 23.4667 7.30000 B8 3 23.5333 6.90000 185 B9 3 23.4333 6.83333 B10 3 23.6667 6.86667 BC15 3 23.2000 6.20000 SE(N= 3) 0.176669 0.348271 5%LSD 20DF 0.521169 1.02739 ------------------------------------------------------------------------------- MEANS FOR EFFECT NL ------------------------------------------------------------------------------- NL NOS CCC B/KHOM CDB HATCHA 1 11 114.500 6.45455 26.9091 176.555 2 11 113.291 6.54545 27.0636 177.391 3 11 114.609 6.65455 27.3636 172.936 SE(N= 11) 0.693077 0.166507 0.336323 4.67830 5%LSD 20DF 2.04455 0.491190 0.992141 13.8008 NL NOS P1000 HA NSTT 1 11 23.4091 6.85455 2 11 23.4000 6.93636 3 11 23.5091 7.03636 SE(N= 11) 0.922626E-01 0.181879 5%LSD 20DF 0.272172 0.536537 ------------------------------------------------------------------------------- ANALYSIS OF VARIANCE SUMMARY TABLE FILE BC1F3 29/ 7/2019 15:16 ------------------------------------------------------------------ :PAGE 8 F-PROBABLIITY VALUES FOR EACH EFFECT IN THE MODEL. SECTION - 1 VARIATE GRAND MEAN STANDARD DEVIATION C OF V |CT$ |NL | (N= 33) -------------------- SD/MEAN | | | NO. BASED ON BASED ON % | | | OBS. TOTAL SS RESID SS | | | CCC 33 114.13 3.1785 2.2987 2.0 0.0048 0.3488 B/KHOM 33 6.5515 0.49252 0.55224 8.4 0.8884 0.7054 CDB 33 27.112 1.1205 1.1155 4.1 0.3862 0.6354 HATCHA 33 175.63 14.237 15.516 8.8 0.7617 0.7793 P1000 HAT 33 23.439 0.29679 0.30600 1.3 0.5319 0.6610 NSTT 33 6.9424 0.57120 0.60322 8.7 0.6156 0.7834 Kết quả sử lý số liệu vụ Mùa 2019 BALANCED ANOVA FOR VARIATE CCC FILE B7 20/ 12/2019 9:39 ------------------------------------------------------------------ :PAGE 1 VARIATE V003 CCC LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 3 19.3333 6.44444 2.94 0.121 3 2 NL 2 .166667 .833334E-01 0.04 0.963 3 * RESIDUAL 6 13.1667 2.19444 ----------------------------------------------------------------------------- 186 * TOTAL (CORRECTED) 11 32.6667 2.96970 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE B/KHOM FILE B7 20/ 12/2019 9:39 ------------------------------------------------------------------ :PAGE 2 VARIATE V004 B/KHOM LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 3 1.24250 .414167 1.70 0.266 3 2 NL 2 .395000 .197500 0.81 0.491 3 * RESIDUAL 6 1.46500 .244167 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 11 3.10250 .282045 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE CDB FILE B7 20/ 12/2019 9:39 ------------------------------------------------------------------ :PAGE 3 VARIATE V005 CDB LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 3 7.60917 2.53639 5.96 0.032 3 2 NL 2 2.40667 1.20333 2.83 0.136 3 * RESIDUAL 6 2.55333 .425555 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 11 12.5692 1.14265 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE HC/B FILE B7 20/ 12/2019 9:39 ------------------------------------------------------------------ :PAGE 4 VARIATE V006 HC/B LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 3 205.643 68.5475 0.64 0.621 3 2 NL 2 394.912 197.456 1.83 0.239 3 * RESIDUAL 6 646.735 107.789 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 11 1247.29 113.390 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE P1000 HA FILE B7 20/ 12/2019 9:39 ------------------------------------------------------------------ :PAGE 5 VARIATE V007 P1000 HAT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 3 .115833 .386111E-01 0.48 0.709 3 2 NL 2 .105000 .525002E-01 0.65 0.557 3 * RESIDUAL 6 .481667 .802779E-01 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 11 .702501 .638637E-01 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE NSTT FILE B7 20/ 12/2019 9:39 ------------------------------------------------------------------ :PAGE 6 187 VARIATE V008 NSTT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 3 .696667 .232222 0.40 0.761 3 2 NL 2 .816667E-01 .408334E-01 0.07 0.933 3 * RESIDUAL 6 3.49833 .583055 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 11 4.27667 .388788 ----------------------------------------------------------------------------- TABLE OF MEANS FOR FACTORIAL EFFECTS FILE B7 20/ 12/2019 9:39 ------------------------------------------------------------------ :PAGE 7 MEANS FOR EFFECT CT$ ------------------------------------------------------------------------------- CT$ NOS CCC B/KHOM CDB HC/B 1 3 120.000 7.90000 27.3667 191.667 2 3 117.667 7.13333 26.0000 198.367 3 3 116.667 7.73333 28.2333 187.067 BC15 3 119.000 7.93333 27.2333 194.667 SE(N= 3) 0.855267 0.285287 0.376632 5.99414 5%LSD 6DF 2.95850 0.986855 1.30283 20.7347 CT$ NOS P1000 HA NSTT 1 3 23.4333 7.80000 2 3 23.3667 7.26667 3 3 23.3333 7.43333 BC15 3 23.1667 7.83333 SE(N= 3) 0.163583 0.440854 5%LSD 6DF 0.565859 1.52498 ------------------------------------------------------------------------------- MEANS FOR EFFECT NL ------------------------------------------------------------------------------- NL NOS CCC B/KHOM CDB HC/B 1 4 118.500 7.42500 27.0250 199.900 2 4 118.250 7.75000 26.7750 193.075 3 4 118.250 7.85000 27.8250 185.850 SE(N= 4) 0.740683 0.247066 0.326173 5.19108 5%LSD 6DF 2.56214 0.854641 1.12828 17.9568 NL NOS P1000 HAT NSTT 1 4 23.3000 7.60000 2 4 23.2250 7.67500 3 4 23.4500 7.47500 SE(N= 4) 0.141667 0.381790 5%LSD 6DF 0.490048 1.32067 ------------------------------------------------------------------------------- ANALYSIS OF VARIANCE SUMMARY TABLE FILE B7 20/ 12/2019 9:39 188 ------------------------------------------------------------------ :PAGE 8 F-PROBABLIITY VALUES FOR EACH EFFECT IN THE MODEL. SECTION - 1 VARIATE GRAND MEAN STANDARD DEVIATION C OF V |CT$ |NL | (N= 12) -------------------- SD/MEAN | | | NO. BASED ON BASED ON % | | | OBS. TOTAL SS RESID SS | | | CCC 12 118.33 1.7233 1.4814 1.3 0.1211 0.9635 B/KHOM 12 7.6750 0.53108 0.49413 6.4 0.2660 0.4912 CDB 12 27.208 1.0689 0.65235 2.4 0.0319 0.1359 HC/B 12 192.94 10.648 10.382 5.4 0.6206 0.2392 P1000 HAT 12 23.325 0.25271 0.28333 1.2 0.7092 0.5566 NSTT 12 7.5833 0.62353 0.76358 10.1 0.7609 0.9328 Kết quả sử lý số liệu vụ xuân 2020 BALANCED ANOVA FOR VARIATE CCC FILE BC15 3/ 8/2020 7:56 ------------------------------------------------------------------ :PAGE 1 VARIATE V003 CCC LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 1 1.50000 1.50000 0.75 0.479 3 2 NL 2 12.0000 6.00000 3.00 0.250 3 * RESIDUAL 2 4.00000 2.00000 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 5 17.5000 3.50000 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE B/KHOM FILE BC15 3/ 8/2020 7:56 ------------------------------------------------------------------ :PAGE 2 VARIATE V004 B/KHOM LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 1 .166667 .166667 25.00 0.035 3 2 NL 2 1.48000 .740000 111.00 0.007 3 * RESIDUAL 2 .133332E-01 .666659E-02 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 5 1.66000 .332000 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE CDB FILE BC15 3/ 8/2020 7:56 ------------------------------------------------------------------ :PAGE 3 VARIATE V005 CDB LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 1 1.70667 1.70667 7.37 0.113 3 2 NL 2 .143333 .716664E-01 0.31 0.763 3 * RESIDUAL 2 .463334 .231667 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 5 2.31333 .462666 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE HC/B FILE BC15 3/ 8/2020 7:56 189 ------------------------------------------------------------------ :PAGE 4 VARIATE V006 HC/B LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 1 1574.64 1574.64 59.06 0.013 3 2 NL 2 7.31999 3.65999 0.14 0.878 3 * RESIDUAL 2 53.3201 26.6600 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 5 1635.28 327.056 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE P1000 HA FILE BC15 3/ 8/2020 7:56 ------------------------------------------------------------------ :PAGE 5 VARIATE V007 P1000 HAT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 1 .600001E-01 .600001E-01 0.43 0.580 3 2 NL 2 .840000 .420000 3.00 0.250 3 * RESIDUAL 2 .280000 .140000 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 5 1.18000 .236000 ----------------------------------------------------------------------------- BALANCED ANOVA FOR VARIATE NSTT FILE BC15 3/ 8/2020 7:56 ------------------------------------------------------------------ :PAGE 6 VARIATE V008 NSTT LN SOURCE OF VARIATION DF SUMS OF MEAN F RATIO PROB ER SQUARES SQUARES LN ============================================================================= 1 CT$ 1 2.04167 2.04167 306.24 0.002 3 2 NL 2 .213333 .106667 16.00 0.058 3 * RESIDUAL 2 .133336E-01 .666678E-02 ----------------------------------------------------------------------------- * TOTAL (CORRECTED) 5 2.26833 .453667 ----------------------------------------------------------------------------- TABLE OF MEANS FOR FACTORIAL EFFECTS FILE BC15 3/ 8/2020 7:56 ------------------------------------------------------------------ :PAGE 7 MEANS FOR EFFECT CT$ ------------------------------------------------------------------------------- CT$ NOS CCC B/KHOM CDB HC/B 1 3 101.000 7.46667 27.0333 177.400 2 3 100.000 7.13333 28.1000 145.000 SE(N= 3) 0.816496 0.471402E-01 0.277889 2.98105 5%LSD 2DF 4.89957 0.282875 1.66754 17.8885 CT$ NOS P1000 HAT NSTT 1 3 23.3000 7.46667 2 3 23.1000 6.30000 SE(N= 3) 0.216025 0.471409E-01 5%LSD 2DF 1.29630 0.282880 190 ------------------------------------------------------------------------------- MEANS FOR EFFECT NL ------------------------------------------------------------------------------- NL NOS CCC B/KHOM CDB HC/B 1 2 102.500 6.60000 27.7000 162.600 2 2 99.5000 7.60000 27.3500 161.100 3 2 99.5000 7.70000 27.6500 159.900 SE(N= 2) 1.00000 0.577347E-01 0.340343 3.65103 5%LSD 2DF 6.00073 0.346450 2.04231 21.9088 NL NOS P1000 HA NSTT 1 2 22.7000 6.75000 2 2 23.6000 7.15000 3 2 23.3000 6.75000 SE(N= 2) 0.264575 0.577355E-01 5%LSD 2DF 1.58764 0.346455 ------------------------------------------------------------------------------- ANALYSIS OF VARIANCE SUMMARY TABLE FILE BC15 3/ 8/2020 7:56 ------------------------------------------------------------------ :PAGE 8 F-PROBABLIITY VALUES FOR EACH EFFECT IN THE MODEL. SECTION - 1 VARIATE GRAND MEAN STANDARD DEVIATION C OF V |CT$ |NL | (N= 6) -------------------- SD/MEAN | | | NO. BASED ON BASED ON % | | | OBS. TOTAL SS RESID SS | | | CCC 6 100.50 1.8708 1.4142 1.4 0.4788 0.2504 B/KHOM 6 7.3000 0.57619 0.81649E-01 1.1 0.0346 0.0072 CDB 6 27.567 0.68020 0.48132 1.7 0.1130 0.7633 HC/B 6 161.20 18.085 5.1633 3.2 0.0132 0.8784 P1000 HAT 6 23.200 0.48580 0.37417 1.6 0.5798 0.2504 NSTT 6 6.8833 0.67355 0.81650E-01 1.2 0.0020 0.0582

Các file đính kèm theo tài liệu này:

  • pdfluan_an_nghien_cuu_ung_dung_chi_thi_phan_tu_chon_tao_giong_k.pdf
  • pdfQĐ cấp Viện Nguyễn Thị Nhài.pdf
  • pdfTóm tắt luận án . EN.pdf
  • pdfTóm tắt Luận Án. VN.pdf
  • pdfTRANG TIN VỀ ĐÓNG GÓP MỚI CỦA LUẬN ÁN (VN, EN).pdf
  • docxTRANG TIN VỀ ĐÓNG GÓP MỚI CỦA LUẬN ÁN.docx
Luận văn liên quan