Nghiên cứu phân loại, khả năng phân hủy DDT và sinh laccase của chủng nấm sợi phân lập từ đất ô nhiễm hỗn hợp thuốc trừ sâu

1. Dựa trên các đặc điểm hình thái khuẩn lạc, bào tử và so sánh một phầ n trình tự gen mã hóa 18S rRNA, chủng nấm sợi FNA1 đƣợc xác định thuộc chi Aspergillus và đƣợc đặt tên là Aspergillus sp. FNA1. Trình tự đoạn gen mã hóa 18S rRNA của chủng Aspergillus sp. FNA1 đƣợc đăng ký trên Genbank với mã số GQ906535. 2. Cả 3 chủng FNA1, FNA2 và FNA3 đều có khả năng sinh laccase và MnP, chủng FNA1 không sinh LiP. Trên môi trƣờng sàng lọc, hoạt tính laccase lần lƣợt là 5,4; 2,9; 3,3 (U/l), hoạt tính MnP lần lƣợt là 26,9; 6,05; 13,4 (U/l), hoạt tính LiP c ủa FNA2 và FNA3 là 4,15 và 2,07 (U/l).

pdf117 trang | Chia sẻ: lylyngoc | Lượt xem: 2787 | Lượt tải: 8download
Bạn đang xem trước 20 trang tài liệu Nghiên cứu phân loại, khả năng phân hủy DDT và sinh laccase của chủng nấm sợi phân lập từ đất ô nhiễm hỗn hợp thuốc trừ sâu, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
là 50, 100, 200, 300 ppm chủng FNA1 đều sinh trƣởng tốt, sự chênh lệch khối lƣợng khô và hoạt tính laccase không Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 70 nhiều, dao động trong khoảng 6 - 7 U/l. Tuy nhiên ở nồng độ 200 ppm DDT chủng FNA1 phát triển tốt hơn ( Hình 3.10). 50 ppm 100 ppm 200 ppm 300 ppm Hình 3.10 Ảnh hƣởng của nồng độ DDT lên khả năng sinh trƣởng của FNA1 4.2.2 Ảnh hưởng của nồng độ glucose Để tìm hiểu chủng FNA1 chuyển hóa chất độc theo cơ chế nào, đồng trao đổi chất hay sử dụng DDT làm nguồn carbon và năng lƣợng duy nhất, glucose đã đƣợc sử dụng để thực hiện nghiên cứu này. Sau 5 ngày nuôi cấy FNA1 trên môi trƣờng muối khoáng chứa 200 ppm DDT và glucose ở các nồng độ khác nhau kết quả đƣợc trình bày trong hình 23. Ở nồng độ glucose 0 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 71 % chủng FNA1 hoàn toàn không phát triển, 0,1 % phát triển yếu, nồng độ glucose càng cao thì FNA1 phát triển càng mạnh và màu môi trƣờng thay đổi càng rõ rệt dần chuyển sang mầu nâu đỏ (Hình 3.11). Kết quả này chứng tỏ chủng FNA1 phân hủy DDT theo cơ chế đồng trao đổi chất, sử dụng cả 2 nguồn carbon là đƣờng và chất độc DDT, đây là cơ chế phổ biến ở các vi sinh vật phân hủy chất độc. Trong khi đó chủng nấm Aspergillus sp.FNA33 đƣợc phân lập từ cùng vùng ô nhiễm có thể phát triển trên môi trƣờng muối khoáng không bổ sung glucose hay nguồn carbon khác ngoài chất độc là HCH. Dịch nuôi cấy sau 5 ngày đƣợc sử dụng để xác định hoạt tính laccase, kết quả trình bày tại hình 3.12. Hoạt tính đạt cao nhất là 7,47 U/l ở 0,1 % glucose và giảm dần khi nồng độ glucose tăng. Trong dải nồng độ khảo sát thì chủng FNA1 phát triển tốt nhất ở nồng độ 3% glucose nhƣng tại đây không phát hiện đƣợc laccase (Hình 3.12). Để giải thích và chứng mình đặc điểm này cần nhiều nghiên cứu khác nhƣ động thái sinh tổng hợp laccase ở các nồng độ glucose khác nhau và cơ chế trao đổi chất .v.v nhƣng do thời gian và điều kiện không cho phép nên thí nghiệm dừng ở bƣớc đầu khảo sát nhƣ trên. Glucose (%) 0 0.1 0.5 1 2 3 Hình 3.11 Ảnh hƣởng của nồng độ glucose lên khả năng sinh trƣởng của FNA1 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 72 Hình 3.12 Ảnh hƣởng của nồng độ glucose lên khả năng sinh laccase của FNA1 4.3 Ảnh hưởng của các chất cảm ứng 4.3.1 Guaiacol, veratyl alcohol, CuSO4 Khả năng sinh laccase bởi nấm sợi ngoài sự phụ thuộc vào các yếu tố nhƣ nhiệt độ, pH, thành phân môi trƣờng, thời gian nuôi c ấy .v.v còn phụ thuộc rất nhiều vào sự có mặt và nồng độ các chất cảm ứng nhƣ Cu2+, veratryl alcohol (VA), gallic acid, guaiacol, catechol, hydroxybenzoic acid, vanillin .v.v [43]. Ba loại chất cảm ứng là guaiacol (0,01 %), CuSO4 (1 mM) và VA (1 %) đã đƣợc lựa chọn để khảo sát ảnh hƣởng của chúng lên khả năng sinh tổng hợp laccase. Vẫn sử dụng môi trƣờng Czapek nghèo và dịch nuôi cấy sau 5 ngày để xác định hoạt tính enzyme. Kết quả cho thấy môi trƣờng có bổ sung thêm chất cảm ứng hoạt tính laccase tăng không đáng kể so với môi trƣờng không bổ sung, môi trƣờng có chƣa CuSO4 đạt cao nhất là 11,04 U/l (Hình Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 73 3.13). Các chất cảm ứng này có thể không phải là chất cảm ứng sinh laccase phù hợp với chủng nấm sợi FNA1, với mỗi chủng giống khác nhau thì chất cảm ứng thích hợp và nồng độ tối ƣu của chất đó là không giống nhau, nhƣ Trichoderma harzianum WL1 hoạt tính laccase đạt tới 4,36 U/ml sau 4 ngày khi có bổ sung 1mM CuSO4, hoạt tính laccase của Trametes sp. AH28-2 đạt cao nhất với cảm ứng O-toluidine 1 mM sau 72 giờ là 504 U/l trong khi với cảm ứng guaiacol 1 mM chỉ đạt 287 U/l [49,61]. Hình 3.13 Ảnh hƣởng của chất cảm ứng đến khả năng sinh laccase của FNA1 4.3.2 Các chất ô nhiễm khác Để tìm hiểu khả năng phát triển của chủng FNA1 trên các môi trƣờng có mặt các chất ô nhiễm khó phân hủy khác ngoài DDT nhƣ 2,4-D, 2,4,5-T, 3 đại diện của PAH và đặc biệt là dịch chiết đất chứa 2,3,7,8-TCDD đã đƣợc sử dụng để đánh giá. Kết quả sau 5 ngày nuôi cấy đƣợc trình bày ở hình 3.14 và 3.15. Trên tất cả các bình thí nghiệm chủng FNA1 đều sinh trƣởng phát triển tốt, điều này chứng tỏ ngoài khả năng phát triển trên môi trƣờng chứa nguồn Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 74 carbon là DDT chủng nấm sợi này còn có thể sinh trƣởng đƣợc trong môi trƣờng chứa các chất ô nhiễm khác. Chủng FNA1 có sử dụng các chất ô nhiễm này làm nguồn carbon hay không cần tiếp tục nghiên cứu nhƣng bƣớc đầu đã mở ra khả năng ứng dụng của chủng FNA1 trong xử lý các vùng ô nhiễm khác không chỉ riêng vùng ô nhiễm DDT. Cơ chất thƣờng đóng vai trò là chất cảm ứng cho quá trình sinh tổng hợp một loại enzyme tƣơng ứng nào đó. Khi bổ sung cơ chất vào môi trƣờng nuôi cấy có sự tác động đến khả năng sinh enzyme ngoại bào của FNA1, trong môi trƣờng có chứa 2,4-D, 2,4,5-T, 3 đại diện của PAH và dịch chiết hoàn toàn không phát hiện thấy sự có mặt của laccase, chỉ trong môi trƣờng chứa DDT là có sự sinh tổng hợp laccase. Đây là đặc tính khá đặc hiệu, chủng nấm sợi này chỉ tạo laccase khi có mặt của DDT và DDT chính là chất cảm ứng để chủng nấm này sinh tổng hợp laccase. 2,4-D 2,4,5-T DDT pyren anthracene phenanthren dịch chiết Hình 3.14 Ảnh hƣởng của các chất độc khác nhau lên sự sinh trƣởng của FNA1 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 75 Hình 3.15 Khối lƣợng khô sinh khối trên các nguồn chất ô nhiễm khác nhau 4.4 Ảnh hưởng của chất hoạt động bề mặt Đối với đất bị nhiễm độc, đặc biệt là ô nhiễm DDT các chất hoạt động bề mặt đóng vai trò quan trọng nhƣ giảm độc tố do các chất độc gây lên. Các chất hoạt động bề mặt làm tăng khả năng sẵn sàng phân hủy sinh học của các chất thuộc POPs, và DDT cũng là một trong 12 chất POPs. Quá trình phân hủy sinh học DDT có thể tăng lên khi bổ sung tỷ lệ hợp lý chất hoạt động bề mặt sinh học. Ví dụ sử dụng enzyme MnP và Lac để xử lý methoxychlor (MC-một loại thuốc trừ sâu đƣợc sự dụng khá rộng rãi) với sự kết hợp lần lƣợt của Tween 80 và 1-hydroxybenzotriazole (HBT) đã chuyển đổi MC thành olefin methoxychlor (MCO) và 4,4 '-dimethoxybenzophenone. Trong Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 76 trƣờng hợp kết hợp MnP và Tween 80 sau 24 giờ xử lý 65 % MC đã bị loại bỏ [27]. Do vậy để khử độc môi trƣờng bị ô nhiễm với nguồn nguyên liệu rẻ tiền nghiên cứu ảnh hƣởng của chất hoạt động bề mặt nhƣ tween 80 và nƣớc quả bồ kết lên khả năng sinh trƣởng và sinh laccase của chủng FNA1 đã đƣợc tiến hành. Kết quả cho thấy FNA1 đều phát triển tốt trên 2 loại chất hoạt động bề mặt này nhƣng khả năng sinh enzyme thì hoàn toàn khác nhau (Hình 3.16). Trên môi trƣờng có bổ sung bồ kết lƣợng laccase sinh ra không đáng kể, trong khi bổ sung tween 80 hoạt tính laccase đo đƣợc lên đến 2608,33 U/l sau 1 ngày. Hoạt tính laccase của chủng FNA1 là khá cao so với 1 vài chủng khác nhƣ chủng Marasmius quercophilus có hoạt tính laccase cao nhất là 0,8 U/ml sau 5 ngày nuôi cấy trong môi trƣờng có bổ sung 0,1 % Tween 80 và đồng [50]. Hình 3.16 Ảnh hƣởng của chất hoạt động bề mặt lên khả năng sinh laccase của FNA1 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 77 Kết quả trên cho thây môi trƣờng Czapek có bổ sung 0,2 % Tween 80 là môi trƣờng nấm sợi FNA1 cho hoạt tính laccase cao, và môi trƣờng này đã đƣợc sử dụng để tiếp tục tìm hiểu động thái sinh tổng hợp laccase của chủng FNA1. Thí nghiệm đƣợc theo dõi trong 10 ngày, kết quả trình bày trong hình 3.17. Hoạt tính laccase đạt cao nhất sau 1 ngày nuôi cấy và giảm mạnh ở các ngày sau đó. Hình 3.17 Động thái sinh tổng hợp laccase 4.5 Ảnh hưởng của nguồn carbon, nitơ và môi trường thay thế 4.5.1 Ảnh hưởng của nguồn carbon Việc sử dụng một số nguồn carbon thay thế saccharose trong môi trƣờng Czapek nghèo cho thấy nguồn carbon thích hợp nhất cho sinh tổng hợp enzyme của chủng FNA1 vẫn là saccharose, tiếp theo là glucose đạt 40 % so với nguồn carbon là sacchrose. Trên các nguồn carbon khác chủng FNA1 vẫn có khả năng sinh laccase nhƣng hoạt tính laccase rất thấp (Hình 3.19), Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 78 khác với một số chủng khác đã đƣợc công bố nhƣ Trichoderma viride và Trichoderma longibrachiatum đều có khả năng sinh tổng hợp laccase rất tốt trên cả 3 nguồn carbon là glucose, saccharose và CM-cellulose [22]. Trong khi đó khả năng sinh trƣởng của FNA1 cũng rất khác nhau, chủng này phát triển tạo sinh khối yếu trên các nguồn carbon nhƣ lactose, cellulose và dịch chiết khoai tây. Nguồn carbon thich hợp nhất cho FNA1 phát triển là saccharose, glucose và cao malt (Hình 3.18). Glucose saccharose lactose tinh bột cellulose khoai tây cao malt Hình 3.18 Ảnh hƣởng của nguồn carbon lên khả năng sinh trƣởng của FNA1 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 79 Hình 3.19 Ảnh hƣởng của nguồn carbon lên khả năng sinh laccase của FNA1 4.5.2 Ảnh hưởng của nguồn nitơ Tƣơng tự nhƣ nghiên cứu ảnh hƣởng của nguồn carbon lên sinh trƣởng và sinh tổng hợp laccase của FNA1, để nghiên cứu ảnh hƣởng của nguồn nitơ môi trƣờng Czapek nghèo vẫn đƣợc sử dụng và thay thế nguồn nitơ trong môi trƣờng bằng các nguồn khác. Kết quả cho thấy trên nguồn urê chủng FNA1 phát triển yếu và phát triển tốt trên các nguồn còn lại (Hình 3.20). Lƣợng sinh khối lớn trên các nguồn cao thịt, cao men và bột đậu tƣơng không đồng nghĩa với khả năng sinh tổng hợp laccase tốt, trên các nguồn nitơ này hoạt tính laccase rất thấp và giao động trong khoảng 1 U/l (Hình 3.21). Chủng FNA1 sinh trƣởng và sinh tổng hợp laccase tốt nhất trên môi trƣờng Czapek nghèo vơi nguồn nitơ vô cơ là NaNO3 và KNO3 khác với đa số chủng nấm sinh laccase thích hợp với nguồn nitơ hữu cơ nhƣ Pleurotus ostreatus 32, Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 80 Trametes pubescens MB 89 thích hợp với peptone, Agaricus bisporus, Trametes versicolor thích hợp với nguồn cao malt v.v. [16,18,28,46]. Urê NH4NO3 Czapek nghèo cao men cao thịt bột đậu tƣơng Hình 3.20 Ảnh hƣởng của nguồn nitơ lên khả năng sinh trƣởng của FNA1 Hình 3.21 Ảnh hƣởng của nguồn nitơ lên khả năng sinh laccase của FNA1 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 81 4.5.3 Ảnh hưởng của môi trường thay thế Để lựa chọn môi trƣờng thích hợp cho sản xuất laccase với lƣợng lơn chúng tôi đã tiến hành thí nghiệm với các môi trƣờng MEG, YS, PG và SG (thành phân nhƣ đƣợc mô tả trong phần phƣơng pháp). Kết quả cho thấy chủng FNA1 phát triển rất tốt trên cả 4 loại môi trƣờng này nhƣng hoạt tính laccase đạt cao nhất trên môi trƣờng SG (21,3 U/l) (Hình 3.22). Môi trƣờng SG là môi trƣờng có thành phân chủ yếu là bột đậu tƣơng, đây là điều thuận lợi vì là nguồn nguyên liệu sẵn có và rẻ tiền, có thể áp dụng trên quy mô lớn để sản xuất lƣợng lớn enzyme. Một số chủng nấm và xạ khuẩn trên thế giới cũng sử dụng môi trƣờng có thành phần chính là đậu tƣơng để sản xuất laccase với lƣợng lớn nhƣ Peniophora sp, Pleurotus, Trametes versicolor, Coprinopsis cinerea, Fomes sclerodermeus và Streptomyces cyaneus CECT 3335 v.v. [19,37]. Dựa trên kết quả nghiên cứu ảnh hƣởng của chất hoạt động bề mặt, Tween 80 đƣợc bổ sung vào môi trƣờng SG. Tuy nhiên trên môi trƣờng có bột đậu tƣơng hoạt tính laccase không tăng lên nhƣ trên môi trƣờng Czapek nghèo. Vậy đối với chủng nấm sợi FNA1 môi trƣờng thích hợp nhất để sản xuất laccase với lƣợng lớn là môi trƣờng Czapek nghèo có bổ sung Tween 80. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 82 Hình 3.22 Ảnh hƣởng của môi trƣờng thay thế đến khả năng sinh laccase của FNA1 5 MỘT SỐ TÍNH CHẤT CỦA LACCASE THÔ 5.1 pH tối ưu và độ bền pH 5.1.1 pH tối ưu Đô pH môi trƣờng ảnh hƣớng rất lớn đến vận tốc phản ứng enzyme. Bởi pH ảnh hƣởng đến trạng thái ion hóa các gốc R của các gốc axit amin trong phân tử enzyme, ion hóa các nhóm chức trong trung tâm hoạt động và ion hóa cơ chất. Để tìm ra khoảng pH tối ƣu cho hoạt động của laccase từ chủng FNA1 hoạt tính enzyme đã đƣợc xác định thông qua việc sử dụng dịch lên men chủng FNA1 trong môi trƣờng Czapek nghèo có bổ sung 0,2 % Tween 80 và các đệm có pH khác nhau. Trên hình 3.23 thể hiện kết quả định tính, hoạt tính laccase đƣợc thể hiện thông qua mức độ xanh đậm hay nhạt của sản phẩm tạo thành do ABTS bị oxy hóa. Enzyme do FNA1 sinh ra hoạt động Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 83 xúc tác phản ứng mạnh nhất trong khoảng pH rất thấp từ pH 1 – 2. Kết quả xác định hoạt tính trong hình 3.24 thể hiện rõ hơn kết luận trên, laccase này hoạt động ở khoảng pH 1,5 là thích hợp nhất, tại đây hoạt tính laccase đo đƣợc lên đến 2802,8 U/l. Laccase của chủng FNA1 có thể hoạt động trong khoảng pH thấp nhƣ trên là một đặc tính rất quý vì trong công nghệ xử lý môi trƣờng có rất nhiều nguồn ô nhiễm có điều kiện khắc nghiệt nhƣ pH rất thấp hoặc rất cao. pH hoạt động tối ƣu của laccase từ chủng này là thấp hơn so với một số chủng nấm khác nhƣ Trametes trogii, Trametes versicolor, Melacarpus albomyces, Marasmius quercophilus .v.v, pH hoạt động tối ƣu của laccase từ các chủng nói trên lần lƣợt là pH 2; 3; 3,5 và 4,5 [39]. pH 5 4,5 4 3,5 3 2,5 2 1,5 1 Hình 3.23 pH tối ƣu của laccase từ chủng FNA1 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 84 Hình 3.24 Ảnh hƣởng của pH lên hoạt tính của laccase từ chủng FNA1 5.1.2 Độ bền pH Do pH môi trƣờng có ảnh hƣởng đến độ bền của protein cho nên việc xác định độ bền pH của enzyme có ý nghĩa quan trọng trong quá trình thu nhận, tinh sạch, nghiên cứu và bảo quản enzyme. Laccase thô của FNA1 bền ở khoảng pH 4 – 5 (Hình 3.25), khoảng pH bền này khá thấp so với một số chủng nấm đảm khác nhƣ nấm đảm Sclerotium rolfsii chỉ còn 50 % hoạt tính khi đƣợc ủ ở pH 5,0 và 30 0C trong vòng 65 phút [33]. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 85 Hình 3.25 Độ bền pH của laccase từ chủng FNA1 5.2 Nhiệt độ thích hợp cho hoạt động của laccase và độ bền nhiệt 5.2.1 Nhiệt độ thích hợp cho hoạt động của laccase Nhiệt độ tối ƣu cho hoạt động của laccase đƣợc xác định qua việc đo hoạt độ enzyme ở các nhiệt độ phản ứng khác nhau từ nhiệt độ phòng (32oC) đến 90 oC. Kết quả trên hình 3.26 cho thấy khi nhiệt độ tăng dần từ 32 oC đến 50 o C hoạt tính laccase cũng tăng dần từ 53,4 % (1354,2 U/l) đến 100%, nhiệt độ thích hợp nhất cho laccase hoạt động khoảng 50 oC (2732 U/l) và giảm nhẹ khi nhiệt độ tăng lên 60 oC. Ở 90 oC enzyme vẫn còn khả năng hoạt động nhƣng hoạt tính giảm mạnh chỉ còn 35,7 % (905,1 U/l). Nhiệt độ thích hợp cho hoạt động của laccase từ nấm sợi FNA1 thấp hơn so với 1 số chủng nấm đảm khác nhƣ Pycnoporus sanguineus là 55 oC, 3 loại laccase của C. micaceus là pool 1; pool 2; pool 3 tƣơng ứng là 65, 60, 65 oC [33]. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 86 Hình 3.26 Ảnh hƣởng của nhiệt độ phản ứng lên hoạt tính laccase từ chủng FNA1 5.2.2 Độ bền nhiệt Do bản chất hóa học của enzyme là protein nên dƣới ảnh hƣởng của nhiệt độ, enzyme đều bị biến tính ít nhiều và ảnh hƣởng tới hoạt độ, mức độ ảnh hƣởng tùy thuộc vào nhiệt độ và thời gian ủ enzyme. Để xác định khoảng nhiệt độ bền của laccase từ FNA1 dịch enzyme thô đƣợc ủ ở các nhiệt độ 50, 60, 80, và 90 o C, hoạt tính enzyme đƣợc xác định sau các khoảng thời gian nhất định. Laccase thô của FNA1 bền nhiệt ở khoảng nhiệt độ dƣới 50 oC. Khi xử lý enzyme ở 60 oC sau 40 phút hoạt tính laccase giảm còn một nửa so với ban đầu (Hình 3.27), thời gian này là 200 phút đối với laccase của P. sanguineus và dƣới 5 phút đối với các laccase của C. micaceus khi xử lý ở 65 o C. Xử lý ở nhiệt độ cao 80 và 90 oC hoạt tính enzyme sau 10 phút đã giảm mạnh xuống khoảng 50 % hoạt tính ban đầu và duy trì ổn định trong thời gian ủ tiếp theo [33]. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 87 Hình 3.27 Ảnh hƣởng của nhiệt độ lên độ bền laccase từ FNA1 6 PHÂN LOẠI CHỦNG NẤM SỢI FNA1 BẰNG PHƢƠNG PHÁP SO SÁNH TRÌNH TỰ ĐOẠN GEN MÃ HÓA 18S rRNA Hiện nay, phƣơng pháp sử dụng kỹ thuật sinh học phân tử trong nghiên cứu phân loại dựa vào trình tự đoạn gen mã hóa 18S rRNA đƣợc sử dụng rất rộng rãi và kết quả phản ánh nhanh chóng và chính xác vị trí phân loại của các chủng nấm sợi. Do đó chúng tôi tiến hành tách dòng gen mã hóa 18S rRNA của chủng nấm sợi FNA1 để xác định và so sánh trình tự nucleotide của chủng nấm này với các chủng nấm khác trên ngân hàng gen thế giới nhằm phân loại định tên chủng này. 6.1 Tách chiết DNA tổng số Để tiến hành các nghiên cứu tiếp theo, việc thu đƣợc DNA tổng số không bị đứt gãy, có độ tinh sạch cao là rất quan trọng. Kết quả điện di kiểm Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 88 tra trên gel agaroza 1% ở hình 3.28 cho thấy DNA tổng số thu đƣợc không bị đứt gãy, băng gọn, sạch có thể đƣợc sử dụng cho các nghiên cứu tiếp theo. 6.2 Nhân đoạn gen 18S rRNA bằng kỹ thuật PCR Phản ứng PCR đƣợc tiến hành sử dụng DNA tổng số của chủng FNA1 làm sợi khuôn, cặp mồi đặc hiệu Fung5r và EF4f và chu trình nhiệt nhƣ đã nêu ở phần phƣơng pháp. DNA tổng số Hình 3.28 Điện di đồ sản phẩm tách DNA tổng số chủng FNA1 Khoảng 550bp 1 2 750bp Hình 3.29 Sản phẩm PCR 18S rRNA chủng FNA1 Kênh 1: Marker 1kb, kênh 2: Sản phẩm PCR Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 89 Sản phẩm PCR nhân đoạn gen 18S rRNA chủng FNA1 đƣợc kiểm tra bằng điện di trên gel agaroza 1% (Hình 3.29). Kết quả này cho thấy, băng của sản phẩm PCR là băng đơn, sắc nét và có kích thƣớc khoảng 550 bp phù hợp với tính toán lý thuyết, chứng tỏ đoạn gen mong muốn có thể đã đƣợc nhân lên đặc hiệu. 6.3 Tách dòng gen 18S rRNA trong vectơ pTZ57R/T Sau khi thu đƣợc sản phẩm PCR, tiến hành gắn vào vectơ pTZ57R/T nhờ enzym T4 ligase, và biến nạp vào tế bào khả biến E. coli. Sau khi nuôi tĩnh qua đêm ở 37oC, trên đĩa biến nạp xuất hiện các khuẩn lạc trắng và khuẩn lạc xanh xen kẽ (Hình 3.30). Một số khuẩn lạc trắng đƣợc lựa chọn để tiến hành tách DNA plasmid. Sản phẩm DNA plasmid thu đƣợc ở các dòng chọn lựa đƣợc điện di kiểm tra trên gel agaroza 1% (Hình 3.31), mẫu DNA plasmid ở các kênh 1, 3 nằm ở vị trí cao hơn so với mẫu đối chứng có khả năng mang sản phẩm mong muốn. Để kiểm tra dòng plasmid lựa chọn có mang sản phẩm mong muốn hay không, phản ứng PCR kiểm tra có sử dụng khuôn là DNA plasmid của các dòng 1, 3 đã đƣợc thực hiện. Tại các kênh 1, 2 hình 3.32 xuất hiện băng DNA có kích thƣớc khoảng 550bp, vậy có thể các dòng này đã mang sản phẩm PCR mong muốn. Hai dòng này đã đƣợc lựa chọn để tách và làm sạch DNA plasmid với số lƣợng lớn phục vụ cho việc xác định trình tự (Hình 3.33). Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 90 Hình 3.30 Khuẩn lạc vi khuẩn E. coli trên môi trƣờng LB chứa X-Gal sau khi biến nạp vector pTZ57R/T C 1 2 3 Hình 3.31 Phổ điện di sản phẩm tách DNA plasmit Kênh C: Đối chứng (khuẩn lạc màu xanh) Kênh 1, 2, 3: DNA plasmit của các dòng khuẩn lạc màu trắng Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 91 M 1 2 Hình 3.32 Sản phẩm PCR từ DNA plasmit với cặp mồi EF4f và fung5r Kênh M: Marker 1kb Kênh 1, 2: Sản phẩm PCR kiểm tra dòng 1 và 3 1 2 C Hình 3.33 DNA plasmit mang gen 18S rRNA của chủng FNA1 Kênh 1, 2: DNA plasmit sau khi làm sạch Kênh C: Đối chứng Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 92 6.4 So sánh trình tự đoạn gen mã hóa 18S rRNA của chủng FNA1 Trình tự đoạn gen 18S rRNA (534 nucleotid) của chủng FNA1 đã đƣợc xác định, kết quả đƣợc trình bày ở hình 3.34. Trình tự đoạn gen mã hoá 18S rRNA của chủng FNA1 đƣợc đăng ký trên Genbank với mã số GQ906535. So sánh với các trình tự gen 18S rRNA của các chủng vi nấm đã công bố trên các ngân hàng dữ liệu Genbank, EMBL cho thấy chủng FNA1 có mức tƣơng đồng cao với các chủng vi nấm thuộc ngành nấm nang Ascomycetes, ngành phụ Pezizomycotina, chi Aspergillus. Dựa trên cơ sở so sánh mức độ tƣơng đồng một phần trình tự gen mã hóa 18S rRNA chủng FNA1 với một số chủng vi nấm đại diện, sử dụng phần mềm Clustal X để xây dựng cây phát sinh chủng loại để thấy rõ đƣợc mối quan hệ phát sinh chủng loại của chủng nấm sợi FNA1(Hình 3.35). Nhƣ vậy, dựa trên các đặc điểm hình thái khuẩn lạc, bào tử và so sánh một phần trình tự gen mã hóa 18S rRNA của chủng FNA1 thì ch ủng này thuộc chi Aspergillus và đƣợc đặt tên là Aspergillus sp. FNA1. GGAAGGGGTGTATTTATTAGATAATCTGTGCTCCTTCTTCGAGCTCCTTGGTGATTCATAA TAACTTAACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTC GATGGTAGGATAGTGGCCTACCATGGTGGCAACGGGTAACGGGGAATTAGGGTTCGATTCCGGA GAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCC CGACACGGGGAGGTAGTGACAATAAATACTGATACGGGGCTCTTTTGGGTCTCGTAATTGGAAT GAGTACAATCTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGG TAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGG TCTGGCTGGCCGGTCCGCCTCACCGCGAGTACTGGTCCGGCTGGACCTTTCCTTCTGGGGAACCT CATGGCCTTCACTGGCTGTGGGGGGAACCAGGGACTTTTACA Hình 3.34 Trình tự đoạn gen mã hóa 18S rRNA của chủng FNA1 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 93 Hình 3.35 Cây phát sinh chủng loại của chủng Aspergillus sp. FNA1 Nấm thuộc chi Aspergillus có nhiều chủng có khả năng phân hủy DDT hay các chất có cấu trúc tƣơng tự. Aspergillus conicus làm biến đổi 55,1% bis(4-chlorophenyl)acetic acid (DDA) thành các sản phẩm hòa tan trong nƣớc chƣa xác định và chƣa chiết tách đƣợc. Aspergillus niger và Penicillium brefeldianum chuyển hóa lần lƣợt 12,4 và 24,6% DDT thành các sản phẩm không xác định và hòa tan trong nƣớc. Aspergillus niger Aspergillus sp. FNA1 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 94 phân hủy 4, 4’-dichlorobenzophenone (DBP) thành 4-chlorobenzophenone và methylated 4-chlorobenzophenone [47]. Các minh chứng trên cho thấy vai trò rất qua n trọng của nấm sợi , đặc biệt là các đại diện của chi Aspergillus trong phân hủy sinh học DDT và các sản phẩm trong chu trình khoáng hóa DDT . Trên cây phát sinh chủng loại cho thấy chủng Aspergillus sp. FNA1 có quan hệ gần gũi với một số chủng nhƣ Aspergillus sp. FNA4, Aspergillus sp. FNA33, Aspergillus sp. FBH11, đây đều là các chủng có khả năng phân hủy các chất thuộc POPs. Đặc biệt 2 chủng Aspergillus sp. FNA4, Aspergillus sp. FNA33 là 2 chủng đƣợc phân lập cùng địa điểm ô nhiễm với chủng FNA1, các chủng này có khả năng phân hủy lần lƣợt 94,48 % hỗn hợp DDT trong 14 ngày và 88 % HCH, trong khi chủng FNA1 phân hủy 97,23 % DDT; 97,19 DDD; và 92,69 % DDE trong 7 ngày nuôi cấy. Cả 3 chủng FNA4, FNA33 và FBH11 đều đƣợc mô tả là có khả năng sinh laccase, chủng FNA4 sinh laccase với hoạt tính 15,4 U/l, chủng FNA33 là 4,3 U/l [3,4,5], chủng FBH11 có độ tƣơng đồng 98 % đƣợc phân lập từ đất ô nhiễm thuốc diệt cỏ/dioxin sinh laccase với hoạt tính cao. Một số chủng nấm sợi thu ộc chi Aspergillus đƣợc công bố là có khả năng sinh enzyme ngoại bào là Aspergillus terreus LD-1 và Aspergillus nidulans. Chủng Aspergillus tereus sinh ra hai loại enzyme ngo ại bào là MnP và Laccase trong điều kiện kiềm (pH từ 11 đến 12.5), hoạt tính enzyme trung bình của hai loại enzyme này là 0,384 U/mg [40]. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 95 KẾT LUẬN 1. Dựa trên các đặc điểm hình thái khuẩn lạc, bào tử và so sánh một phần trình tự gen mã hóa 18S rRNA, chủng nấm sợi FNA1 đƣợc xác định thuộc chi Aspergillus và đƣợc đặt tên là Aspergillus sp. FNA1. Trình tự đoạn gen mã hóa 18S rRNA của chủng Aspergillus sp. FNA1 đƣợc đăng ký trên Genbank với mã số GQ906535. 2. Cả 3 chủng FNA1, FNA2 và FNA3 đều có khả năng sinh laccase và MnP, chủng FNA1 không sinh LiP. Trên môi trƣờng sàng lọc, hoạt tính laccase lần lƣợt là 5,4; 2,9; 3,3 (U/l), hoạt tính MnP lần lƣợt là 26,9; 6,05; 13,4 (U/l), hoạt tính LiP của FNA2 và FNA3 là 4,15 và 2,07 (U/l). 3. Aspergillus sp. FNA1 phân hủy DDT theo cơ chế đồng trao đổi chất, sau 7 ngày nuôi cấy chủng này loại bỏ DDE, DDD và DDT lần lƣợt là 92,69 %, 97,19 % và 97,23 % so với mẫu đối chứng. 4. Aspergillus sp. FNA1 phát triển tốt nhất ở 37oC, pH 5, nồng độ NaCl 0,1 %, nồng độ DDT 200 ppm, ngoài ra còn phát triển tốt trên môi trƣờng chứa 2,4-D, 2,4,5-T, pyren, phenanthren, anthracene và dịch chiết. Chủng FNA1 không phát triển trên nguồn carbon là lactose và cellulose, phát triển yếu trên nguồn nitơ là urê. 5. Aspergillus sp. FNA1 sinh tổng hợp laccase trong điều kiện 30oC, pH 5, nồng độ NaCl 0,1 %, glucose 0,1 %, CuSO4 1 mM và nguồn chất ô nhiễm là DDT, nguồn carbon là saccharose, nguồn nitơ là NaNO3 và KNO3. 6. Môi trƣờng thích hợp nhất để Aspergillus sp. FNA1 sinh tổng hợp laccase là môi trƣờng Czapek nghèo có bổ sung Tween 80 0,2 %, hoạt tính laccase đạt 2608,3 U/l sau 1 ngày nuôi cấy. 7. Laccase từ chủng FNA1 có pH tối ƣu 1,5, nhiệt độ tối ƣu 50oC, bền trong khoảng pH 4 – 5 và nhiệt độ dƣới 50 oC. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 96 KIẾN NGHỊ 1. Nghiên cứu các gen chức năng tham gia quá trình phân hủy DDT và gen mã hóa laccase. 2. Nghiên cứu khả năng phân hủy sinh học các loại thuốc trừ sâu khác của chủng FNA1, đồng thời nghiên cứu khả năng sử dụng enzyme ngoại bào trong việc loại bỏ thuốc nhuộm màu và phân hủy các chất ô nhiễm. 3. Tối ƣu các điều kiện lên men để sản xuất laccase với lƣợng lớn. 4. Tiếp tục nghiên cứu các đặc tính hóa sinh của laccase từ chủng FNA1. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 97 TÀI LIỆU THAM KHẢO Tài liệu Tiếng Việt 1. Lê Trần Bình, Phan Văn Chi, Nông Văn Hải, Trƣơng Nam Hải, Lê Quang Huấn, 2003. áp dụng các kỹ thuật phân tử trong nghiên cứu tài nguyên sinh vật Việt Nam. Nxb KH&KT Hà Nội: 325- 329 2. Hoàng Thị Mỹ Hạnh, Nguyễn Đƣơng Nhã, Đặng Thị Cẩm Hà, 2004. Nấm sợi phân hủy hydrocarbon thơm đa nhân phân lập từ cặn dầu thô của giếng khai thác dầu, Vũng Tàu. Tạp chí Công nghệ Sinh học, số I(tập 2): 255- 264. 3. Hoàng Thị Mỹ Hạnh, Nguyễn Thanh Thủy, Ngô Xuân Quý, Nghiêm Xuân Trƣờng, Nghiêm Ngọc Minh, Đặng Thị Cẩm Hà (2004) Khả năng phân hủy 2,4-D và dibenzofuran của chủng nấm sợi FDN20. Tạp chí công nghệ sinh học 2 (4): 517-528 4. Trần Thị Nhƣ Hòa, Nghiêm Ngọc Minh, Đặng Thị Cẩm Hà (2008), “Phân loại hai chủng vi sinh vật từ đất nhiễm chất diệt cỏ/dioxin khử độc trong bioreactor hiếu khí”, Tạp chí công nghệ sinh học, tập(số), trang. 5. Nghiêm Ngọc Minh, Vũ Mạnh Chiến, Đặng Thị Cẩm Hà (2006), “Nghiên cứu phân loại và khả năng sử dụng DDT của chủng XKNA21 đƣợc phân lập từ đất ô nhiễm DDT”, Tạp chí công nghệ sinh học, 4(2), 257-264 6. Nguyễn Nguyên Quang, Đặng Thị Cẩm Hà (2009), “Phân lập, phân loại và khả năng phân hủy DDT, DDD, DDE của một số chủng vi sinh vật”, Tạp chí công nghệ sinh học, đang in. 7. Mai Thanh Truyết. Ô nhiễm thuốc sát trùng: DDT. 8. Mai Thanh Truyết, Nguyễn Minh Quang. Phát triển và môi trường bền vững ở Việt Nam. Tài liệu Tiếng Anh 9. Adinarayana Kunamneni et al (2008), “Engineering and Application of fungal laccase for organic synthesis”, Microbial Cell Factories. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 98 10. Aislabie J, Davison A D, Boul H L, Franzmann P D, Jardine D R, and Karuso P (1999), “Isolation of Terrabacter sp. Strain DDE-1, Which metabolizes 1,1-dichloro-2,2-bis (4-chlorophenyl) ethylene when induced with biphenyl”, Appl and Environ Microbiol, 65, pp. 5607-561. 11. Andrea Zille (2005), Laccase reactions for textile applications, Doctor thesis, University of Minho, Italia 12. Ben- Dyke R., Sanderson D., Noakes D., (1970), ”Acute toxicity data for pesticides”, World Rev Pestic Cont, 9, pp.119- 127. 13. Bidleman T., Christensen E., Billings W. et al., (1981). Atmospheric transport of organochlorines in the North Atlantic gyre, J. Mar Res 39, pp.443- 464. 14. Bononi, V. L. R., Machado, K. M. G., Matheu, D. R. (2005), “Ligninolytic enzymes production and Remazol Brilliant Blue R decolorization by tropical Brazilian Basidiomycetes fungi”, Brazilian journal of microbiology 36, pp.246-252. 15. Bumpus and Aust (1987), “Biodegradation of DDT [1,1,1- trichloro - 2,2- bis (4-chlorophenyl) ethane] by the white rot fungus Phanerochaete chrysosporium”, Appl Environ Microbiol, 53(9), pp.2001–2008. 16. Christiane Galhaup, Harald Wagner Barbara, Hinterstoisser and Dietmar Haltrich (2002), “Increased production of laccase by the wood-degrading basidiomycete Trametes pubescens”, Enzyme and Microbial Technology, 30(4), pp.529-536. 17. Crawford, D.L. and Crawford, R.L. (1978), “Microbial degradation of lignocellulose the lignin component”, Appl. Env. Microbiol, 31(5), pp.714-717. 18. D. A. Wood (1980), “Production, Purification and Properties of Extracellular Laccase of Agaricus bisporus”, Journal of General Microbiology 117, pp.327-338. 19. Gerd J. Mander, Huaming Wang, Elizabeth Bodie, Jens Wagner, Kay Vienken, Claudia Vinuesa, Caroline Foster, Abigail C. Leeder, Gethin Allen, Valerie Hamill, Giselle G. Janssen, Nigel Dunn-Coleman, Marvin Karos, Hans Georg Lemaire, Thomas Subkowski, Claus Bollschweiler, Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 99 Geoffrey Turner, Bernhard Nüsslein, and Reinhard Fischer (2006), “Use of Laccase as a Novel, Versatile Reporter System in Filamentous Fungi”, Applied and Environmental Microbiology, 72(7), pp.5020-5026. 20. Giraud, Guiraud P., Kadri M., Blake G., Steiman S., (2001), “Biodegradation of phenanthrene and fluoranthene by fungi isolated from an experimental constructed wetland for wastewater treatment”, Wat. Res., 35(17), pp.4126-4136. 21. Gladys Alexandr, Igor B. Zhulin (2000), “Laccases are widespread in bacteria”, Trend in Biotechnology, 18(2), pp.41-42. 22. Gochev, V. K., A. I. Krastanov (2007), “Isolation of Laccase Producing Trichoderma Spp”, Bulg. J. Agric. Sci., 13, pp.171-176 23. Guarro Josep, Josepa Gene, và Alberto M. Stchigel. Developments in Fungal Taxonomy. Unitat de Microbiologia Spain. 24. Hans E. Schoemaker, Klaus Piontek (1996), “On the interaction of lignin peroxidase with lignin”, Pure & Appl. Chem, 68(11), pp.2089-2096. 25. Harald Claus (2003), “Laccase and their occurrence in prokaryotes”, Arch Microbiol, 179, pp.145-150. 26. Hestbjerg Helle, Willumsen Pia Arentsen, Christensen Mette, Andersen Ole and Jacobsen Carsten Suhr (2003), “Bioaugmentation of tar- contaminated soils under field conditions using Pleurotus ostreatus refuse from commercial mushroom production”. Environmental Toxicology and Chemistry 22(4), pp.692-98. 27. Hirofumi Hirai , Sawako Nakanishi, Tomoaki Nishida (2004), “Oxidative dechlorination of methoxychlor by ligninolytic enzymes from white-rot fungi”, Chemosphere, 55(4), pp.641-645 28. Hongman Hou, Jiti Zhou, Jing Wang, Cuihong Du, Bin Yan (2004), “Enhancement of laccase production by Pleurotus ostreatus and its use for the decolorization of anthraquinone dye”, Process Biochemistry, 39(11), pp.1415-1419 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 100 29. J.M. Aislabie, N.K.Richards, H.L.Boul (1997), “Microbial degradation of DDT and its residues- a review”, New Zealand Journal of Agricultural Research, pp.271- 275. 30. Jan D. V. E., Gabriela F. D., Anneke K. – W., Eric S (2000), “Analysis of the dynamics of fungal communities in soil via fungal – specific PCR of soil DNA followed by denaturing gradient gel electrophoresis”, Journal of Microbiological Methods, 43, pp.133 – 151. 31. Johnson B. Thomas and Jack O. Kennedy (1973), “Biomagnification of p, p'-DDT and Methoxychlor by Bacteria”, Appl Environ Microbiol, 26(1), pp.66-71. 32. José Renato P . Cavallazzi, Catarina M. Kasuya, Marcos A. Soares, (2005), “Screening of inducers for laccase production by Lentinula edodes in liquid medium”, Brazillan Journal of Microbiology 36, pp.383-387. 33. Kizhekkedathu Narayanan Niladevi, Parukuttyama Prema (2005), “Mangrove Actinomyces as the source of Ligninolytic Enzymes” Actinomycestologica, 19, pp.40 –47. 34. Klaus Piontek, Matteo Antorini, Thomas Choinowski Crystal (2002), “Structure of a Laccase from the FungusTrametes versicolor at 1.90-Å Resolution Containing a Full Complement of Coppers”, The Journal of Biological Chemistry, 277,pp.37663-37669. 35. Laura-Leena Kiiskinen (2005), “Characteration and heterologuos production of novel laccase from Melanocarpus albomyces”, Doctor Thesis, Helneski University of Technology. 36. Lucier G.W., Trischer A. M., Van den Heuvel J.P., et al., (1992), “Organohalogen compounds: Extended abstracts of 12th Intern. Symp. On dioxins and related compounds”, Tampere: Finish Institute of occupational heath, 10, pp.3-6. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 101 37. M. Enriqueta Arias, María Arenas, Juana Rodríguez, Juan Soliveri, Andrew S. Ball, and Manuel Hernández (2003), “Kraft Pulp Biobleaching and Mediated Oxidation of a Nonphenolic Substrate by Laccase from Streptomyces cyaneus CECT 3335”, Applied and Environmental Microbiology, 69(4), pp.1953-1958. 38. Marie-Francois Hullo, Ivan Moszer, Antoine Danchin and Isabelle Martin-verstraete (2001), “Cot A of Bacillus subtilis is a copper-depedent laccase”. Journal of Bacteriology, pp.5426-5430. 39. Marièlle Bar (2001), “Kinetics and physico-chemical properties ò white- rot fungal laccases”, doctor thesis. 40. Mario Scherer, Reinhard Fischer (2001), “Molecular characterization of a blue-copper laccase, TILA, of Aspergillus nidulans”, FEMS Microbiology Letters, 199, pp.207-213. 41. Nadeau Lloyd J, Sayler Gary S and Spain J C (1998), “Oxidation of 1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) by Alcaligenes eutrophus A5”, Archives of Microbiology, 171(1), pp.44-49. 42. Nadeau, L. J.; Menn, F- M.; Breen, A.; Sayler, G.S., (1994). “Aerobic degradation of DDT by Alcaligenes eutrophus A5”, Applied and environmental microbiology 60: 51- 55. 43. O. V. Morozova, G. P. Shumakovich, M. A. Gorbacheva, S. V. Shleev, and A. I. Yaropolov (2007), ““Blue” Laccases”, Biochemistry (Moscow), 72(10), pp.1136-1150. 44. P. Sharma, R. Goel, N. Capalash (2007), “Bacterial laccase”, World J Microbiol Biotechnol, 23, pp.823-832. 45. Pereira W., Domagalski J., Hostettler F., et al., (1996), “Occurrence and accumulation of pesticides and organic contaminants in river sediment, water and clam tissues from the San Joaquin River and tributaries, California”, Environ Toxicol Chem, 15(2), pp.172- 180. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 102 46. PJ Collins, MJJ Kotterman, JA Field and ADW Dobson (1996), “Oxidation of Anthracene and Benzo[a]pyrene by Laccases from Trametes versicolor”, Appl. Environ. Microbiol.,62(12), pp.4563-4567. 47. R V Subba-Rao and M Alexander (1985) “Bacterial and fungal cometabolism of 1,1,1-trichloro-2,2-bis(4-chlorophenyl)ethane (DDT) and its breakdown products”, Applied and Environmental Microbiology 49(3), pp.509-516. 48. Rochkind- Dubinsky, M.L.; Sayler, G.S.; Blackburn, J.W., 1987. Microbiological decomposition of chlorinated aromatic compounds. Microbiology series, vol. 18, New York, Marcel Dekker: pp. 153- 162. 49. S. Sadhasivam, S. Savitha, K. Swaminathan, Feng-Huei Lin (2008), “Production, purification and characterization of mid-redox potential laccase from a newly isolated Trichoderma harzianum WL1”, Process Biochemistry 43, pp.736–742. 50. S. Tagger, C. Périssol, G. Gil, G. Vogt and J. Le Petit (1998) “Phenoloxidases of the white-rot fungus Marasmius quercophilus isolated from an evergreen oak litter (Quercus ilex L.)”, Enzyme and Microbial Technology, 23(6), pp.372-379. 51. Sambrook J., Russell D.W. (2001), Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 52. Sergio Riva (2006), “Laccases: Blue enzymes for green chemistry”, Trends in Biotechnology, 24(5), pp.219-226. 53. Shah, M. M.; Barr, D. P.; Chung, N.; Aust S.D., (1992),“ Use of white rot fungi for the degradation of environmental cheicals”, Toxicology letters, 64/65, pp.493- 501. 54. Staples C., Werner A., Hoogheem T., (1985) “Assessment of priority pollutant concentrations in the United States using STORET database”, Environ Toxicol Chem 4, pp.131- 142. 55. Susana Rodríguez Couto and José Luis Toca-Herrera (2009), “Lacasses in the textile industry”, Biotechnology and Molecular Biology Reviews, 1(4), pp.115-120. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 103 56. Tereza Skálová et al, (2009), “The structure of small laccase from streptomyces coelicolor reveals a link between laccase and nitrite reductases”, Journal of Molecular Biotechnology, 385, pp.1165-1178. 57. The Use and Effectiveness of Phytoremediation to Treat Persistent Organic Pollutants (2005), Kristi Russell Environmental Careers Organization. 58. Timothy P.Ruggaber, Jeffrey W. Talley (2006), “Enhancing Bioremediation with enzymatic Processes”, Practice periodical of hazardous, toxic, and radioactive waste management. 59. Toxicology profile for DDT, DDE, DDD, pp. 1- 231. 60. Xiaohu Shao et al (2009), “Deletion and site-directed mutagnesis of laccase from Shigella dysenteriae results in enhanced enzymatic activity and thermostability”, Enzyme and Microbial Technology, 44, pp.274-280. 61. Y. Z. Xiao, Q. Chen, J. Hang, Y. Y. Shi1, Y. Z. Xiao, J. Wu, Y. Z. Hong, Y. P. Wang (2004), “Selective induction, purification and characterization of a laccase isozyme genes from Trametes sp. AH28-2 and analyses of their differential expression”, Applied Microbiology and Biotechnology 71, pp.493-501. 62. Yi Huang, Xi Zhao and Shengji Luan (2007), “Uptake and biodegradation of DDT by 4 ectomycorrhizal fungi”, Sicence of the total enviroment 358, pp.235-241. 63. Zaidi R., Baquar. And Imam H. S., (1999), “Factors affecting microbial degradation of polycyclic aromatic hydrocacbon phenanthrene in the Caribbean coastal water”, Marine Pollution Bulletin, 38, pp.737- 742. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 104 PHỤ LỤC Phụ lục 1. Đặc tính lý - hóa một số đồng phân của DDT Đặc tính p,p,-DDT p,p,-DDE p,p,-DDD o,p,- DDT o,p,-DDE o,p-DDD Khối lƣợng phân tử 354.5 318.03 320.05 354.49 318.03 320.05 Màu Tinh thể bé,bột trắng Tinh thể bé, bột trắng Tinh thể bé, bột trắng Tinh thể bé, bột trắng ND ND Trạng thái vật lý Rắn Rắn Rắn Rắn Rắn ND Nhiệt độ sôi Phân hủy 336 0C 3500C ND ND ND Khối lƣợng riêng d(g/cm 3 ) 0.98-0.99 ND 1.385 0.98-0.99 ND ND Mùi Nhẹ ND ND ND ND ND Độ tan trong nƣớc 0.025mg/l (25 0 C) ND ND 0.085mg/l (25 0 C) 0.14mg/l (25 0 C) 0.1mg/l (25 0 C) Độ tan trong dung môi hữu cơ Ít tan trong etanol, tan tốt trong etylete và acetone Tan tốt trong chất béo và các dung môi hữu cơ khác ND ND ND Tan trong etanol, iso octan, cacbon- tetraclorit Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 105 Áp suất bay hơi 1.6x10 -7 20 0 C,torr 6x10 -6 25 0 C,torr 1.35x10 6 25 0 C,torr 1.1x10 -7 20 0 C,torr 6.2x10 -6 25 0 C,torr 1.94x10 6 30 0 C,torr Phụ lục 2. Các vi sinh vật sử dụng DDT Phụ lục 3. Vi sinh vật sinh laccase Nấm đảm Nấm sợi Xạ khuẩn Vi khuẩn Phanerochaete chrysosporium Melanocarpus albomyces Streptomyces lavendulae Bacillus licheniformis Pycnoporus cinnabarinus Fusarium oxysporum Streptomyces psammoticus Bacillus halodurans Rhizotonia solani Aspergillus nidulans Streptomyces Thermus Vi khuẩn Nấm Xạ khuẩn Alcaligenes eutrophus A5 Nocardia .sp Streptomyces aureofaciens Arthrobacter. Sp Phanerochaete chrysosporium Streptomyces viridochromogenes Bacillus. Sp Trichoderma viridae Streptomyces annamoneus Cylindrotheca closterium Sacharomyces cerevisiae Streptomyces chromofuscus Enterobacter aerogenes Fusarium solami Enterobacter cloacae Aspergillus conicus Eschrichia coli Aspergillus niger Klebsiella pneumoneae Leccinum scabrum Klebsiella pneumoniae Gloeophyllum trabeum Pseudomonas putida Penicillium brefeldianum Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 106 viridosporus thermophilus Trametes villosa Trichoderma harzianum Streptomyces coelicolor Escherichia coli Trametes versicolor Aspergillus niger Bacillus subtilis Pleurotus ostreatus Aspergillus terreus Lentinula edodes Pholiota spp. Agaricus bisporus Peniophora spp. Botrytis cinerea Mauginiella sp. Phụ lục 4. Gene mã hóa laccase Tên chủng Tên gene laccase Tên chủng Tên gene laccase Bacillus subtilis cotA Basidiomycete PM1 lac1 Ceriporiopsis subvermispora Ics-1 Podospora anserina lac2 Coprinus cinereus lcc1 Populus euramericana lac90 Cryptococcus neoformans CNLAC1 Rhizoctonia solani lcc4 Gaeumannomyces graminis var. tritici LAC2 Trametes pubescens lap2 Marasmius quercophilus lac1 Trametes trogii lcc1 Myceliophthora thermophila lcc1 Trametes versicolor lccI Neurospora crassa SalI Trametes versicolor lcc2 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 107 Phlebia radiata lac1 Trametes villosa lcc1 Pleurotus ostreatus poxa1b Trametes villosa lcc2 Pleurotus ostreatus Poxc Streptomyces lavendulae Poxb Phụ lục 5. Một số kỹ thuật phân loại hiện đại Thành phần tế bào Phƣơng pháp phân tích Phạm vi phân loại DNA nhiễm sắc thể Thành phần Bazơ (%G+C) Chi Biến tính DNA : DNA Loài Các phần DNA đƣợc cắt bằng enzym giới hạn Loài và dƣới loài Đa hình chiều dài các đoạn giới hạn của RNA riboxom RNA riboxom Trình tự nucleotit Loài, chi và trên chi Lai DNA : rRNA Protein Trình tự axit amin Loài, chi và trên chi So sánh bằng phản ứng huyết thanh Loài và chi Các kiểu điện di Điện di enzym đa vị trí Các dòng trong loài Thành tế bào Cấu trúc peptidoglucan Loài và chi Polysaccharid Axít teichoic Màng Axít béo Loài và chi Lipid phân cực Axít mycolic Isoprenoid quinones Các sản phẩm trao đổi chất Axít béo Loài và chi Toàn bộ tế bào Sắc kí lỏng pyrolysis Pyrolsis khối phổ Loài và dƣới loài Phụ lục 6. Xác định hoạt tính LiP, MnP Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 108 Xác định hoạt tính enzyme LiP Thành phần phản ứng: Thành phần phản ứng Mẫu đối chứng Mẫu thí nghiệm Đệm kali phosphate PPB (50 mM, pH = 7) 500 µl 500 µl 4-aminoantipyrine, 0,164 mM 50 µl 50 µl 2,4-DCP 3 mM 200 µl 200 µl Dịch enzyme 200 µl 200µl H2O2 4 mM 0 µl 50 µl Nƣớc khử ion 50 µl 0 µl Phản ứng diễn ra khi cho H2O2 vào hỗn hợp, giá trị OD đo sau 1 phút. Công thức tính:    E fpuCM V DVODOD U 610)( Trong đó: U: Hoạt độ enzym (U/l) ε: hệ số hấp thụ, ε510 = 21647 M -1 cm -1 Vpu: Tổng thể tích phản ứng (1 ml) VE: Thể tích enzyme (0,2 ml) ODM: Giá trị OD đo đƣợc của mẫu thí nghiệm ODC: Giá trị OD đo đƣợc của mẫu đối chứng Df: Độ pha loãng Xác định hoạt tính MnP Thành phần phản ứng: Thành phần phản ứng Mẫu đối chứng Mẫu thí nghiệm Đệm kali phosphate PPB (100 mM, pH = 7) 3 ml 3 ml MnSO4 0,1 mM 200 µl 200 µl Phenol đỏ 0,1 mM 300 µl 300 µl Dịch enzyme 1 ml 1 ml H2O2 50 mM 0 µl 500 µl Nƣớc khử ion 500 µl 0 µl Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 109 Phản ứng diễn ra khi cho H2O2 vào hỗn hợp, sau 1 phút 30 giây dừng phản ứng bằng cách cho 40 µl NaOH 5M vào 1 ml mẫu, xác định giá trị OD ở bƣớc sóng 610 nm. Công thức tính:    5,1 10)( 6 E fpuCM V DVODOD U Trong đó: U: Hoạt độ enzyme (U/l) ε: hệ số hấp thụ, ε610 = 4460 M -1 cm -1 Vpu: Tổng thể tích phản ứng (5 ml) VE: Thể tích enzyme (1 ml) ODM: Giá trị OD đo đƣợc của mẫu thí nghiệm ODC: Giá trị OD đo đƣợc của mẫu đối chứng Df: Độ pha loãng Phụ lục 7. Phƣơng pháp chiết dịch chiết từ đất ô nhiễm Cân khoảng 10g đất nhiễm chất độc hóa học (1,5DN5) thu nhận từ sân bay Đà Nẵng đã đƣợc làm khô vào bình tam giác, bổ sung 15g Na2SO4 để tiếp tục làm khô mẫu. Sau khi mẫu khô hoàn toàn bổ sung 45ml dung môi Methanol : Toluen = 1 : 4 để chất độc khuếch tán ra ngoài, siêu âm mẫu đất 30 phút, đậy nắp và lắc 2 giờ hoặc hơn, sau đó để lắng, ly tâm tách dịch, bổ sung H2SO4 với tỉ lệ 1 : 1 về thể tích so với tổng thể tích dung dịch trên để oxy hóa. Khi dung dịch tách làm hai pha thì dùng phễu chiết để lấy pha trên và bảo quản trong lọ tối màu. Phụ lục 8. Quy trình biến nạp DNA tái tổ hợp vào tế bào E. coli Các bƣớc thực hiện theo quy trình và hóa chất của “PCR cloning kit” hãng Fermentas. Chuẩn bị tế bào khả biến và môi trường nuôi cấy: Ngày trước biến nạp: Nuôi 1 khuẩn lạc vi khuẩn E.coli (bất kì chủng nào) trong môi trƣờng C, lắc 37oC qua đêm. Ngày biến nạp: Làm ấm môi trƣờng C trong tube ở 37oC ít nhất 20 phút và làm ấm đĩa thạch LB có bổ sung kháng sinh ampicilin (100 µl/ml) ở 37oC ít nhất 20 phút trƣớc khi gạt. Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 110 Quy trình biến nạp: Bƣớc 1: Bổ sung 150 µl dịch nuôi qua đêm vào 1,5 ml môi trƣờng C đã làm ấm. Lắc ở 37 oC trong 20 phút. Bƣớc 2: Ly tâm 6000 vòng trong 4 phút ở 4 oC, loại dịch nổi Bƣớc 3: Trộn đều tế bào trong 300 µl dung dịch T. Ủ 5 phút trong đá. Bƣớc 4: Ly tâm 6000 vòng trong 4 phút ở 4 oC, loại dịch nổi Bƣớc 5: Trộn đều tế bào trong 120 µl dung dịch T. Ủ 5 phút trong đá. Bƣớc 6: Lấy 2,5 µl sản phẩm ligation vào ống mới làm lạnh trong đá 2 phút. Bƣớc 7: Bổ sung 50 µl tế bào đã chuẩn bị vào ống chứa sản phẩm ligation trên, ủ trong đá 5 phút Bƣớc 8: Gạt ngay ra đĩa LB-ampicillin, có bổ sung thêm X-gal và IPTG. Ủ 37 oC qua đêm. Phụ lục 9. Hoạt tính laccase Ảnh hƣởng của nhiệt độ Nhiệt độ (oC) 28 30 37 42 Hoạt tính (U/l) 7 12.2 10.7 1.3 Ảnh hƣởng pH môi trƣờng nuôi cấy pH 2 3 4 5 6 7 8 9 Hoạt tính (U/l) 0 2.6 3.2 111.1 100 3.4 1.4 3.5 Ảnh hƣởngnồng độ NaCl NaCl % 0 0.1 1 5 10 Hoạt tính 5.8 10.4 2.6 1.4 0.04 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 111 (U/l) Ảnh hƣởng của nồng độ DDT DDT ppm 50 100 200 300 Hoạt tính (U/l) 7 6,6 7,1 6,8 Ảnh hƣởng của nồng độ glucose Glucose % 0 0,1 0,5 1 2 3 Hoạt tính (U/l) 0 7,5 6,5 6 0,2 0 Ảnh hƣởng của các chất cảm ứng Chất cảm ứng guiaiacol veratyl alcohol CuSO4 Hoạt tính (U/l) 7,6 2,9 11 Ảnh hƣởng của chất hoạt động bề mặt Chất hoạt động bề mặt Tween 80 Nƣớc bồ kết Hoạt tính (U/l) 1 ngày 2608,3 0,4 2 ngày 0,4 0,5 4 ngày 6,5 3,8 6 ngày 4,8 3,1 Động thái sinh tổng hợp laccase Ngày 0 1 2 3 4 5 6 7 8 9 10 Hoạt tính (U/l) 0 2608,3 0,4 2,5 6,5 194,4 4,8 2,6 7,5 6,3 2,25 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 112 Ảnh hƣởng của nguồn carbon Carbon Glucose Saccharose lactose Tinh bột Khoai tây Cao malt Cellulose Hoạt tính (U/l) 8,6 22,2 1,8 4,3 3,7 1,1 3,3 Ảnh hƣởng của nguồn nitơ Nitơ NaNO₃+KNO₃ Cao men Cao thịt Đậu tƣơng Urê NH₄NO₃ Hoạt tính (U/l) 22,2 1,5 1,1 1,7 0,6 0,9 Môi trƣờng thay thế Môi trƣờng MEG YS SG PG Hoạt tính (U/l) 11,3 6,2 21,3 5,8 pH tối ƣu pH 5 4,5 4 3,5 3 2,5 2 1,5 1 Hoạt tính (U/l) 0,02 3,2 7,5 28,2 503,1 1552,8 2355,6 2802,8 1969,4 Nhiệt độ tối ƣu Nhiệt độ (oC) 32 40 50 60 70 80 90 Hoạt tính (U/l) 1354,2 1877,3 2532,4 2307,9 1289,3 914,4 905,1 Đào Thị Ngọc Ánh Luận văn Thạc sĩ Sinh học Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 113 Độ bền pH pH 1 2 3 4 5 6 7 8 9 10 Hoạt tính (U/l) 650 1075 1472 2100 1825 1416,7 1386 1425 1472 1425 Độ bền nhiệt Nhiệt độ (oC) 50 60 80 90 Hoạt tính (U/l) 10 phút 2508 2370.37 1333.333 1370.37 20 phút 2394 1958.333 1120.37 1212.963 40 phút 2453 1287.037 1263.889 1018.519 60 phút 2409 1259.259 1185.185 1074.074

Các file đính kèm theo tài liệu này:

  • pdfdoc_1_3634.pdf
Luận văn liên quan