Tiểu luận Chẩn đoán virus lở mồm long móng (FMDV) bằng kỹ thuật gene

Chẩn đoán FMD sớm và chính xác là công cụ cần thiết để kiểm soát dịch bệnh. Chiến lược mới dựa vào RT-PCR đang được áp dụng để phát triển phương pháp kiểm tra nhanh và nhạy cho FMDV. Thửthách chính của phương pháp này là phải thiết kế các primer thích hợp cho chẩn đoán đa dạng di truyền của virus. Vì thế đòi hỏi phải sử dụng primer đặc hiệu và sự kết hợp phức tạp của các oligonucleotide và protocol.

pdf30 trang | Chia sẻ: lylyngoc | Lượt xem: 4181 | Lượt tải: 5download
Bạn đang xem trước 20 trang tài liệu Tiểu luận Chẩn đoán virus lở mồm long móng (FMDV) bằng kỹ thuật gene, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   1  Oct. 30  Trường Đại Học Nông Lâm thành phố Hồ Chí Minh Bộ môn Công Nghệ Sinh Học Lớp DH06SH P Tiểu luận: CHẨN ĐOÁN BỆNH GIA SÚC GIA CẦM CHẨN ĐOÁN VIRUS LỞ MỒM LONG MÓNG (FMDV) BẰNG KỸ THUẬT GENE Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   2  Oct. 30  ĐẶT VẤN ĐỀ Bệnh lở mồm long móng (Foot and Mouth Disease – FMD) hiện nay vẫn đang còn gây thiệt hại kinh tế quan trọng ở nhiều nơi trên thế giới, mặc dù nó đã được thanh toán hoặc khống chế thành công tại nhiều nước. Bệnh gây thành dịch ở nhiều loài động vật móng guốc chẵn, chủ yếu là trâu, bò và lợn. Bệnh lở mồm long móng được biết đến như nạn đại dịch của các đàn bò, cừu và lợn tại nhiều nước từ thế kỷ XIX. Bệnh có ở khắp thế giới. Cuối thế kỷ XIX, đại dịch đã hoành hành ở hầu hết châu Âu, kéo dài hơn 10 năm không tắt, gây bệnh cho hàng chục triệu bò, cừu. Nửa đầu những năm 50 của thế kỷ XX, lại có một vụ dịch mới kéo dài gây thiệt hại lớn cho đàn gia súc ở nhiều nước thuộc châu Âu. ở châu Á và châu Phi, bệnh cũng xảy ra trầm trọng như ở châu Âu, hầu hết các nước đã từng có bệnh. Điều làm đau đầu các nhà dịch tễ học là tại nhiều nước và khu vực, sau nhiều năm liên tục tiêm phòng vacxin cho đàn gia súc và áp dụng các biện pháp kiểm soát bệnh nghiêm ngặt, bệnh tưởng như đã hoàn toàn biến mất, nay bỗng nhiên lại bùng phát dữ dội. Điển hình ở Đài Loan năm 1997 từ nguồn dịch là vài con lợn mắc bệnh trên một chiếc thuyền buôn, trong vòng 2 tháng bệnh nhanh chóng lan ra hàng ngàn trại chăn nuôi lợn, làm suy sụp nền kinh tế chăn nuôi, thiệt hại khoảng 2 tỷ USD. Để chẩn đoán lở mồm long móng, đầu tiên căn cứ vào dấu hiệu lâm sàng của bệnh. Tuy nhiên điều này có thể bị nhầm lẫn do những bệnh có triệu chứng tương tự. Ở trâu, bò bệnh viêm miệng mụn nước (vesicular stomatitis, VS) rất giống bệnh lở mồm long móng. Ở lợn, bệnh mụn nước ở lợn (swine vesicular disease, SVD) và bệnh mụn nước ban đỏ (vesicular exanthema ò swine, VES) tuy khác căn nguyên nhưng có triệu chứng giống nhau. Sự phát hiện sớm giai đoạn nhiễm bệnh và xác định đúng bệnh nếu có thể trước khi xuất hiện các dấu hiệu lâm sàng là yếu tố chủ yếu cho sự khống chế bệnh hiệu quả, ngăn chặn bệnh lây lan. Điều đó đòi hỏi phải có phương pháp chẩn đoán nhanh, đặc hiệu, chính xác có thể cho kết quả trong vòng 24g. Hơn nữa, sự xác định kịp thời typ đặc hiệu của virus thuộc địa và đặc Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   3  Oct. 30  tính phân tử của nó là rất cần thiết để thực hiện tiêm phòng khẩn cấp với kháng nguyên tương ứng và để đánh dấu nguồn gốc ổ dịch. Vì thế chẩn đoán bằng kỹ thuật gene là phương pháp đang được nghiên cứu và áp dụng để phát hiện kịp thời để đưa ra những giải pháp xử lý hiệu quả. I. TỔNG QUAN 1.1. FMD (foot and mouth disease) Lở mồm long móng (FMD) là bệnh truyền nhiễm cấp tính nguy hiểm do virus gây ra. Đây là bệnh được tổ chức dịch tể thế giới (Office International des Epizooties _ OIE) xếp vào hàng đầu trong danh mục A gồm 15 bệnh truyền nhiễm nguy hiểm cho các loài móng guốc chẵn: trâu, bò, dê, cừu, heo (Cục thú y, 1993). Năm 2001, một vụ dịch khác xảy ra sau hơn 20 năm vắng bóng tại nước Anh, cũng gây thiệt hại cho ngành chăn nuôi và du lịch khoảng 2 tỷ USD. Ở nước ta bệnh đầu tiên được phát hiện ở Nha Trang (1898) sau đó lang ở cả ba miền. Năm 1995 có 26 tỉnh, thành có bệnh với hàng ngàn ổ dịch (19.883 trâu, bò và 10.293 heo bệnh, chết 384 trâu bò, 5208 heo _ cục thú y Việt Nam) đã gây tác hại lớn đến nền kinh tế cho các trại chăn nuôi (giảm 25% sức sản xuất) và nền kinh tế nước ta. Việt Nam là nước trong vùng Châu Á được báo cáo trên bản đồ dịch tể bệnh lở mồm long móng thế giới là vùng dịch địa phương (endemic) (Gleeson, 2002). Dịch lở mồm long móng đã xảy ra trên trâu bò liên tục suốt thời gian từ 1975-2005, trên lợn 1992-2005 và gây thiệt hại nặng nề nhất vào các năm 1993, 1995, 1999, 2000. Ngoài typ O lưu hành trong nhiều năm qua, typ A cũng đã được phát hiện năm 2004 trên trâu bò và Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   4  Oct. 30  typ Asia 1 trên lợn năm 2005 ở Việt Nam. FMD là một bệnh địa phương và các type huyết thanh phổ biến là O, Asia 1 và A. Các typ huyết thanh có sự phân bố khác nhau trên thế giới. Typ huyết thanh O, A được nhận biết ở nhiều vùng khác nhau trên thế giới. Trái lại các type huyết thanh SAT1, SAT2, SAT3 được giới hạn ở một số nước thuộc châu Phi. Typ huyết thanh Asia 1 được tìm thấy ở nhiều nước thuộc châu Á. Riêng typ huyết thanh C chỉ còn tồn tại một vài nước như Philippine. Trong các ổ dịch, động vật có thể mắc bệnh do một hoặc cùng một lúc nhiều typ huyết thanh. Sự biến đổi của các typ huyết thanh cũng khá phức tạp, đôi khi còn những điều chưa được hiểu biết rõ. Các chủng virus lở mồm long móng biến đổi rất nhiều và do sự phân bố rộng rãi, phức tạp của chúng nên thường gặp rất nhiều khó khăn trong việc xác định nguồn gốc lây lan của chúng. Chỉ riêng typ O người ta đã các định được 8 nhóm với kiểu di truyền sai khác nhau từ 15% trở lên khi so sánh trình tự gene VP1. Virus lở mồm long móng typ A là nhóm có tính đa dạng kháng nguyên cao nhất, typ A có đến 32 subtype. Và hiện nay người ta cũng chưa thống nhất được với nhau về số lượng kiểu di truyền của virus typ A khi giải trình tự gene VP1. Với virus typ C việc giải trình tự gene VP1 cho phép phân chúng thành 8 nhóm di truyền. Typ virus Asia 1 có sự đa dạng di truyền ít nhất, chúng chỉ có 1 nhóm di truyền. Theo kết quả giải trình tự gene VP1 các typ SAT1 có 3 nhóm, SAT2 có 2 nhóm, SAT3 có 3 nhóm di truyền và phân bố theo khu vực địa lý rõ ràng. Ở Việt Nam đã xác định có typ O, A, và Asia 1 ở trâu, bò và typ A, O ở heo. 1.2. Triệu chứng bệnh tích ™ Triệu chứng Ở trâu bò và lợn hoặc các loài vật khác, bệnh có chung đặc điểm là sốt đột ngột 2-3 ngày, viêm dạng mụn nước rồi lở loét ở miệng, vú, vùng móng chân, nước bọt chảy nhiều như Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   5  Oct. 30  bọt bia. Niêm mạc miệng, môi, lợi, chân răng đỏ ửng, khô, nóng. Mụn nước bắt đầu mọc ở bên trong má, mép, chân răng, môi, lợi, và bề mặt lưỡi. Kích thước mụn bằng hạt gạo, hạt ngô hoặc to hơn. Mụn nước phồng lên, có màng bọc mỏng, bên trong chứa nước trong, sau đục dần. Sau 1-2 ngày, mụn nước bị vỡ, lớp niêm mạc tróc ra để lộ mặt dưới đỏ, chạm nhẹ vào dễ chảy máu. Mụn nước thường không có mủ. Do viêm vùng miệng, con vật có chịu, luôn lúc lắc đầu, nhai tóp tép, nước bọt sùi ra đầy mõm miệng, chảy lòng thòng thành sợi dài. Do có viêm mụn nước ở vùng vành móng, kẽ móng chân làm con vật khó chịu, tỏ ra đau đớn, bồn chồn, luôn nhấc chân lên. Dễ thấy nhất là hiện tượng què, không đi cày kéo được trong khoảng 1-2 tuần. Có trường hợp móng chân bị long hẳn ra, phổ biến nhất là ở lợn. Triệu chứng què ở cả đàn trâu bò gây ảnh hưởng xấu đối với vùng dựa vào sức kéo của chúng, làm lỡ thời vụ gieo trồng, có nơi năng suất lúa bị giảm 20%. ở con vật cái đang nuôi con, triệu chứng và bệnh tích ở bầu vú, núm vú cũng tương tự như ở miệng và chân làm con vật giảm tiết sữa, sữa bị giảm phẩm chất. Con mẹ thường không cho con bú vì đau, làm con non thiếu sữa. Hơn nữa chính con non cũng bị viêm lở mồm như mẹ nên không bú được. Hậu quả có tới 50-80% gia súc non bị chết. Ở con vật trưởng thành, tỷ lệ mắc bệnh trong đàn có serotyp đều gây bệnh giống nhau. Súc vật cái mang thai nhiễm virus lở mồm long móng sẽ sẩy thai. Biến chứng: Viên cơ tim ở súc vật non và viêm ruột (bê non, lợn <-2 tháng). Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   6  Oct. 30  . Hình: Triệu chứng FMD ở trâu, bò và heo ™ Bệnh tích Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   7  Oct. 30  Từ miệng tới thực quản, dạ dày, ruột đều có mụn loét với từng mảng xuất huyết hoặc tụ máu. Bộ máy hô hấp cũng bị viêm. Ở trâu bò hay gặp hiện tượng mặt ngoài cơ tim có những vệt hoại tử màu trắng xen kẽ trông giống như da hổ nên gọi là “tim vằn hổ”. Bệnh lở mồm long móng ở người: Lây nhiễm bệnh lở mồm long móng ở người khá hiếm và nhẹ. Đôi khi gặp ở người hay tiếp xúc với gia súc có bệnh hoặc với virus trong phòng thí nghiệm như người chăn nuôi, chăm sóc gia súc, cán bộ thú y, công nhân lò mổ, nhân viên phòng thí nghiệm. Đôi khi do uống sữa nhiễm mầm bệnh không tiệt trùng kỹ, hoặc qua vết trầy xước trên da. Biểu hiện là có mụn nước nổi trên da ở tay, chân và lưỡi, lợi, có cảm giác ngứa ngáy và hơi nóng rát. Mụn nước có thể tự vỡ ra hoặc xẹp đi sau 1.3. Đường lây truyền và thời gian lây truyền ™ Đường lây bệnh Quan trọng là nhiễm virus có trong nước bọt, nước mũi dưới dạng khí dung. Gia súc hít phải virus có khi từ khoảng cách hàng chục km nếu thuận chiều gió thổi, có khi tới 250 km. Điều này giải thích sự lây lan bệnh mạnh và nhanh chóng trong thời gian ngắn trên phạm vi nhiều huyện, tỉnh, thậm chí giữa các quốc gia. Sự lây truyền trực tiếp cũng xảy ra hoặc gián tiếp qua thức ăn, nước uống, bãi chăn, đồng cỏ, dụng cụ, quần áo, tay chân bị nhiễm trùng. ở đây, con người là yếu tố quan trọng làm lây lan bệnh, nhất là khi đưa gia súc có bệnh hoặc các sản phẩm của chúng đến nơi khác. Bệnh có thể truyền qua bào thai. ™ Thời kỳ ủ bệnh Từ 1 – 7 ngày, trung bình 3 – 4 ngày. Trong suốt thời gian từ khi có các triệu chứng đầu tiên đến khi khỏi bệnh. Nhiều trâu bò sau khi khỏi bệnh vẫn còn mang trùng và thải trùng hàng tháng, có trường hợp tới 3 năm. Lợn có vai trò thải trùng rất lớn, gấp nhiều lần trâu Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   8  Oct. 30  bò khi đang có triệu chứng, nhưng sau khi khỏi lâm sàng, lợn vẫn thải virut sau 1-2 tháng, trâu bò sau khỏi lâm sàng vẫn thải virut 6-24 tháng. Đây là đặc điểm quan trọng trong quá trình phòng chống bệnh ở gia súc. Sức đề kháng của mầm bệnh với điều kiện tự nhiên và thuốc sát trùng. II. NỘI DUNG 2.1. Giới thiệu về virus gây lở mồng long móng (FMDV) Do virus Apthovirus gây ra. Aphthovirus thuộc giống Picornaviridae. Có 7 type huyết thanh gồm: A, O, C, SAT1, SAT2, SAT3 và Asia 1 gây bệnh có triệu chứng giống nhau nhưng không gây miễn dịch chéo. Các typ O1, O2, O3 …, A1, A2, A3, C1, C2, C3 … căn cứ vào sự khác biệt về gen và cấu trúc kháng nguyên. Cấu trúc của FMDV (foot and mouth disease virus) là cấu trúc đối xứng khối 20 mặt, gồm 1 sợi RNA mạch đơn chứa 8500 nucleotide được đóng gói trong một vỏ protein được tạo thành từ 60 capsome, không vỏ bọc. Mỗi capsomer gồm 4 loại polypeptide VP (virus protein) ký hiệu VP1(1D), VP2 (1C), VP3 (1B), VP4 (1A). 4 loại VP này đều có nguồn gốc từ VP0, VP1 ở lớp ngoài cùng, là yếu tố cấu trúc, tham gia quá trình cố định virus trên màng tế bào, có tính sinh miễn dịch chủ yếu. Người ta đã ứng dụng phát hiện này để điều chế vacxin cho hiệu quả cao với VP1 (dẫn liệu của Lê Anh Phụng, 1996; Trần Thanh Phong, 1996). Do có đặc điểm của các virus sợi đơn (+) RNA, virus có tính biến dị và truyền nhiễm mạnh. Bộ gene gồm vùng không giải mã (UTR: untranslated region) dài 1200base ở đầu 5’ (5’UTR) (có vai trò quan trọng trong việc giải mã, độc lực, hình thành capsid), vùng này chứa một cấu trúc thứ cấp có thể xoay (clover-leaf secondary structure), và được biết như là vị trí để tiến vào bên trong ribosome (IRES: international ribosome entry site) và đầu 3’ (3’UTR). Phần giải mã protein cấu trúc (1ABCD) và phần giải mã protein không cấu trúc (2ABC và 3ABCD). Chỉ thị phần tử sử dụng nhiều nhất trong định typ và nghiên cứu phả hệ virus lở mồm long móng là 5’UTR và VP1. Cả hai đầu của bộ gene có thể được Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   9  Oct. 30  thay đổi, đầu 5’ tận cùng bởi VPg (genome-linked protein) (khoảng 23 acid amin), đầu 3’ bởi chuổi dài adenyl (King, 2000). Hình: genome FMDV Toàn bộ genome của FMDV mã hóa cho một protein đơn. Sau khi dịch mã, protein này phân cắ thành 4 sản phẩm sơ cấp: Amino terminal L protease, phân cắt ở đầu cuối carboxyl , P1-2A, tiền chất của protein vỏ, sẽ trải qua giai đoạn polyprotein sau dịch mã với sự tham gia của các protease virus để tạo thành 1 protomer. Hạt virus hình thành từ từng đơn vị protomer (hay đơn vị capsid). Từ đơn vị căn bản này, 5 protomer hợp thành 1 5' UTR L VP4 VP2VP3VP12A2B2C3A3B13B23B33C3D3' UTR VP1: xanh dương VP2: xanh lá cây VP3: đỏ VP4: vàng Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   10  Oct. 30  pentamer, 12 pentamer liên kết nhau theo cấu trúc khối đối xứng gồm 3 trục để hình thành 1 sợi RNA, đó là 1 virus. Hình: Cấu trúc của FMDV. Có 3 loại protein bề mặt là VP1, VP2, VP3. Mỗi protein hiện diện với dạng hình thang trên bề mặt. Ba loại protein này nhóm lại tạo thành 1 đơn vị cấu trúc được chỉ ở bên trái. Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   11  Oct. 30  Vỏ protein ngoài của virus được tạo thành từ 60 bản copy của mỗi loại protein 1A (VP4), 1B (VP2), 1C (VP3), và 1D (VP1). 4 loại protein này lắp ráp thành một đơn vị thay thế protein (protein sub-unit) hay một protomer. 5 protomer kết hợp thành 1 pentamer. 12 pentamer đóng gói vào sợi RNA và tạo thành hạt virus.  Hình: cấu trúc FMDV  Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   12  Oct. 30  Thành phần hệ gene của virus luôn biến đổi ngay cả trong một serotyp, các chủng phân lập ở các vùng địa lý khác nhau có mức độ tương đồng về thành phần nucleotide và acid amin cũng khác nhau (Feng và ctv, 2004). ™ Sức đề kháng Tương đối mạnh, chịu lạnh, chịu khô đến 14 ngày (mùa hè), 6 tháng (mùa đông). Trong đất từ 3-28 ngày. Trong nước tiểu virus tồn tại 39 ngày. Virus bền vững ở pH 7,2 và 7,6 nhưng rất mẫn cảm với pH 11. Ở 40C virus có thể sống sót 1 năm, nhưng khi nhiệt độ tăng lên thì thời gian sống sót còn 8-10 tuần ở 280C, 10 ngày ở 370C và ít hơn 30 phút ở 500C. Đun nóng 700C, chết sau 15 phút, 1000C chết ngay. Trong tủ lạnh sống được 425 ngày, trong cỏ khô sống được 8-15 tuần. Trong đất ẩm virut sống hàng năm. Xút 1% Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   13  Oct. 30  diệt virus sau 10 phút, Formol 2% - 6 giờ. Virus trong không khí còn sống tốt nhất ở ẩm độ tương đối RH > 60%. 2.2. Các phương pháp chẩn đoán Các kỹ thuật phân tích khác nhau đã được sử dụng để phát hiện acid nucleic của virus, kháng nguyên và sự đáp ứng miễn dịch của vật chủ gồm: kết hợp bổ thể (complement fixation test_CFT), trung hòa virus (virus neutralization), ELISA (enzyme_linked immunosorbent assay), RT_PCR (reverse transcriptase polymerase chain reaction), xác định trình tự chuổi acid nucleic (nucleic acid sequence_based amplification, NASBA) (Anonymous, 2000; Collins và ctv, 2002; Feng và ctv, 2003). ™ Kết hợp bổ thể: dùng kháng thể chuẩn để phát hiện serotype virus O, A, C trong bệnh phẩm. Phản ứng nhanh chỉ trong 12 giờ, đơn giản giúp khẳng định hoặc loại trừ nghi ngờ bệnh lở mồm long móng (FMD). Phản ứng này cũng đã được hoàn thiện và nếu sử dụng thành thục sẽ là một phương pháp hữu hiệu để chẩn đoán phân biệt giữa virus lở mồm long móng và các virus gây viêm mụn nước khác. ™ Trung hòa virus: phát hiện qua xét nghiệm mẫu bằng phản ứng trung hòa virus dựa trên khả năng bắt cặp đặc hiệu của kháng thể kháng virus (nếu có) trong mẫu bệnh phẩm với virus lở mồm long móng. Đây là phản ứng được dùng làm thí nghiệm kiểm chứng do có tính đặc hiệu cao nhưng phản ứng này không phân biệt được kháng thể có được là do tiêm phòng hay nhiễm bệnh. Phương pháp này sử dụng dòng tế bào mẫn cảm BHK-21, hoặc tế bào sơ cấp của thận heo, cừu. Kháng thể trung hòa được phát hiện sau 4-5 ngày bệnh. ™ ELISA: được dùng phát hiện kháng nguyên và kháng thể virus trong vòng 3-4 giờ, không phụ thuộc môi trường mô, đặc hiệu nhanh, ít (+) tính giả. Hiện bộ kit chẩn đoán đang được sử dụng tại Việt Nam gồm bộ kháng thể chuẩn để phát hiện 4 Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   14  Oct. 30  serotyp kháng nguyên O, A, C, Asia 1, và bộ kháng nguyên chuẩn để chẩn đoán 3 serotyp O, A, C. Phương pháp này chẩn đoán nhanh, đặc hiệu và độ nhạy cao, được dùng trong giám định serotype của virus, thay thế phương pháp kết hợp bổ thể. Có thể đây là 1 kỹ thuật huyết thanh học nhạy nhất với mục đích chẩn đoán và xác định typ. Cả hai phương pháp trung hòa virus và ELISA cạnh tranh trong pha lỏng đều phát hiện kháng thể kháng protein cấu trúc, protein vỏ của virus nhưng không phân biệt được đó là kháng thể của động vật đã tiêm vacxin hay do nhiễm virus. Virus lở mồm long móng (FMDV) khi xâm nhiễm vào tế bào vật chủ sẽ dịch mã để tạo nên các protein cấu trúc và protein không cấu trúc. Các protein không cấu trúc liên quan đến hoạt động của virus và biến đổi chức năng tế bào vật chủ. Một số protein không cấu trúc gây đáp ứng miễn dịch và tạo ra các kháng thể đặc hiệu với chúng. Vacxin chỉ chứa hạt virus tinh sạch với dung dịch đệm và chất bổ trợ nên đáp ứng miễn dịch với vacxin chỉ tạo ra kháng thể kháng protein cấu trúc của virus. Trong trường hợp vacxin không tinh sạch bị nhiễm protein không cấu trúc, cũng xảy ra một đáp ứng miễn dịch yếu và ngắn ngủi đối với loại protein này, vì hàm lượng chúng rất thấp. Do đó nếu phát hiện kháng thể kháng protein không cấu trúc ta có thể kết luận con vật bị nhiễm virus lở mồm long móng (FMDV) chứ không phải do vacxin. Một số protein không cấu trúc của virus gây đáp ứng miễn dịch: 3D, 3A/3AB/3ABC, 2C, 2B, 3C và Lpro. Trong thời gian gần đây một số protein không cấu trúc 2C, 3B, 3AB, 3ABC đã được nghiên cứu và nhiều phương pháp có độ nhạy cao đã được phát triển. ™ RT_PCR: để xác định gia súc nhiễm bệnh đồng thời xác định typ virus gây bệnh FMD dai dẳng ở thực địa thì kỹ thuật PCR rất nhạy, nhanh, chính xác, hiệu quả sẽ Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   15  Oct. 30  cần thiết và được xem như là phương pháp bổ sung hay thay thế cho phương pháp huyết thanh học. Phương pháp kết hợp bổ thể, phương pháp ELISA mới chỉ dừng lại ở việc trả lời câu hỏi type gây bệnh thuộc loại gì. Phương pháp RT- PCR không dừng lại ở đó, chúng còn có thể phân biệt được sự khác biệt biến chủng có trong bệnh phẩm đã xác định có cùng một type huyết thanh, thông qua việc định chuỗi các sản phẩm PCR và so sánh trình tự đoạn DNA với các trình tự DNA khác của virus lở mồm long móng được chứa sẵn trong ngân hàng dữ liệu gen. 9 Ưu điểm của RT-PCR Những mẫu huyết thanh dương tính từ mẫu máu thu nhận có biểu hiện lâm sàn đối với virus thì không đủ cơ sở cho việc chẩn đoán virus. Có thể đó chính là sự hiện diện của kháng thể mẹ truyền cho con. Vì thế việc dùng kỹ thuật PCR để xác định chính xác sự hiện diện của FMDV. Dùng kỹ thuật PCR không cần phân lập virus trong môi trường nuôi cấy tế bào. Vì thế PCR sẽ tốn ít thời gian để phát hiện hơn so với phương pháp nuôi cấy tế bào. PCR còn được coi là phương pháp có độ nhạy và độ đặc hiệu cao. Thông thường thời gian chẩn đoán bệnh phải mất trên 10 giờ đồng hồ đối với kỹ thuật soi bằng mắt, 5- 6 giờ đối với kỹ thuật ELISA (kỹ thuật này độ nhạy còn kém và chi phí khá cao). Áp dụng kỹ thuật RT- PCR vào chẩn đoán thời gian đã được rút ngắn xuống còn 4- 5 giờ với độ chính xác cao, an toàn. TS Tô Long Thành cho biết: "Bình thường để biết con vật có mắc bệnh hay không, chúng ta phải đợi đến khi chúng phát bệnh ra ngoài với các hiện tượng chảy nước bọt ở mồm, mũi hay nứt toác móng chân. Kỹ thuật RT- PCR cho phép phát hiện bệnh ngay trong giai đoạn đầu tiên". Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   16  Oct. 30  Sở dĩ RT- PCR nhận biết được bệnh nhanh như vậy vì nhờ việc kết hợp PCR với cặp mồi 1F/1R khả năng xác định các type O, A, C và ASIA- 1 gây bệnh của virus lở mồm long móng diễn ra rất nhanh. Theo TS. Tô Long Thành, khi tiến hành dùng RT- PCR nhất thiết phải làm trên 14 mẫu RNA vào cùng một thời điểm. Từ đây, chúng ta tiến hành theo dõi các thay đổi của bệnh lý trên phác đồ điều trị. Trong thời gian này chỉ cần một trong số các mẫu có sự thay đổi lên, xuống bất thường là chúng ta đã có thể xác định được nguồn bệnh. 2.3. Chẩn đoán bằng RT-PCR 2.3.1. Nguyên tắc PCR là kỹ thuật invitro dùng để khuếch đại một trình tự DNA dựa trên nguyên tắc của một phản ứng sinh hóa nhờ hoạt động của enzyme polymerase. Về nguyên tắc, bước đầu tiên của phản ứng RT-PCR là quá trình phiên mã ngược từ khuôn mẫu mRNA để tạo ra sợi đơn cDNA. Một primer oligodeoxynucleotide sẽ gắn vào mRNA và sau đó chúng sẽ được kéo dài nhờ một enzyme phiên mã ngược có hoạt tính polymerase để tạo thành bản sao cDNA, bản sao này sau đó sẽ được khuếch đại nhờ vào phản ứng PCR ở bước thứ hai. 2.3.2. Nguyên liệu DNA quan tâm, enzyme tổng hợp DNA chịu nhiệt, 2 đoạn mồi nucleotide, 4 loại dNTP, dung dịch đệm cho phản ứng, Mg2+. ™ Các enzyme sử dụng cho phiên mã ngược Sự phát hiện enzyme phiên mã ngược năm 1970. Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   17  Oct. 30  Nay, có ba loại enzyme phiên mã ngược được sử dụng để tổng hợp cDNA invitro tương ứng với RNA mẫu. 9 Enzyme phiên mã ngược của avian mycloblastosis virus (AMV) và dòng Moloney của virus murine leukemia (Mo-MLV). Cả hai loại enzyme này đều đòi hỏi primer sử dụng cho quá trình phiên mã ngược phải có nhóm 3’OH. Loại enzyme này không có hoạt tính 3’-5’ enxonuclease. Khi sử dụng loại này thì đòi hỏi nồng độ dNTP cao. • Enzyme được mã hóa AMV có hoạt tính RNase nên có thể cắt nửa phần của RNA- DNA và có thể dính chặt vào đầu 3’ của sợi DNA nếu phản ứng phiên mã ngược bị dừng lại trong quá trình tổng hợp (dẫn liệu từ Rotawicz và cộng sự,1988). Vì sự hoạt động ở mức độ cao của RNase H cùng với việc phiên mã ngược có xu hướng ngăn chặn việc tạo ra cDNA và giảm chiều dài của nó. • Enzyme murine phù hợp cho rt-PCR hơn vì hoạt tính RNase của nó yếu hơn. Tuy nhiên, Mo-MLV sẽ hoạt động tối ưu ở điều kiện nhiệt độ thấp (370C) hơn so với emzyme AMV (420C), chính đặc điểm này làm cho Mo-MLV không thuận lợi trong các phản ứng mà RNA có nhiều cấu trúc bậc hai. Những dạng biến thể của enzyme phiên mã ngược Mo-MLV không có hoạt tính RNase. 9 Đối với mẫu RNA khó phiên mã ngược do cấu trúc thứ cấp, ta có thể sử dụng nhiệt độ cao để biến tính trước, nhưng các reverse transcriptase thông thường chỉ hoạt động ở 37-420C. Trong những trường hợp này phải sử dụng reverse transcriptase chịu nhiệt thermoscriptTMRT hoạt động ở 42-650C. ™ Các primer trong phiên mã ngược Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   18  Oct. 30  Mồi là những trình tự oligonucleotide có khả năng bắt cặp chuyên biệt với đầu 5’ hay đầu 3’ của đoạn DNA cần khuếch đại. Mồi là yếu tố quan trọng quyết định tính đặc hiệu của phản ứng PCR. Mồi cũng đóng vai trò khởi động hoạt động của DNA polymerase khi đã ở trạng thái bắt cặp ở đầu 3’ (Mc Pherson và Moller, 2000). Có 3 loại mồi 9 Mồi chuyên biệt (gene specific primer_GSP): có thể giúp giảm hiện tượng bắt cặp không chuyên biệt và tăng hiệu suất tổng hợp DNA bổ sung. Mồi chuyên biệt gene được thiết kế giống mồi ngược antisense của PCR. Để phân biệt sản phẩm khuếch đại từ cDNA hay từ DNA bộ gene, mồi chuyên biệt nên được thiết kế nằm trong đoạn exon, khi đó sản phẩm PCR từ cDNA sẽ ngắn hơn sản phẩm khuếch đại từ DNA bộ gene nhiễm vào. Primer này sẽ lai lên các vị trí có chọn lọc trên một trình tự đặc biệt của mRNA. Tuy nhiên khi sử dụng primer làm mồi cho quá trình phiên mã ngược thì cặp primer sử dụng cho phản ứng PCR sau đó cần được thiết kế sao cho primer trên sợi antisense sẽ bắt cặp ở phía trên đối với vị trí của oligonucleotide sử dụng làm primer cho tổng hợp cDNA. 9 Oligo T (dT): thiết kế dựa vào đặc tính của mRNA là thường tồn tại đuôi polyA tận cùng ở đầu 3’. Primer sẽ bắt cặp với đuôi polyA ở đầu 3’ của hầu hết mRNA của tế bào động vật. Vì đuôi polyA chỉ chiếm 1-2% RNA tổng số nên hàm lượng và độ phức tạp của các sản phẩm cDNA không đáng kể như khi sử dụng mồi ngẫu nhiên. 9 Mồi ngẫu nhiên (Random hexanucleotide): sử dụng khi mRNA đích có kích thước lớn hay có quá nhiều cấu trúc bậc hai. Khi đó việc tổng hợp cDNA không thể thực hiện một cách hiệu quả bằng sử dụng mồi oligo dT hay oligonucleotide antisense (Lee và Caskey, 1990). Tuy nhiên mồi này có tính chuyên biệt thấp vì nó bắt cặp ngẫu nhiên với nhiều vị trí trên RNA khuôn mẫu và nó tạo ra các cDNA ngắn, từng phần. Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   19  Oct. 30  Trong đa số các trường hợp sử dụng RT_PCR những primer chuyên biệt được thiết kế để gắn kết vào vùng 3’ không dịch mã của mRNA đích là những primer được ưu tiên chọn lựa. Primer oligo dT là lựa chọn tốt nhất kế sau và random hexamer là lựa chọn cuối vì không đặc hiệu và tạo ra cDNA có kích thước không đều, chúng thường được sử dụng khi các primer trước sử dụng không thành công. ™ DNA polymerase: kéo dài mạch mới bổ sung với mạch khuôn từ mồi khởi động. Tth polymerase chịu nhiệt được tách chiết từ một loại vi khuẩn chịu nhiệt Thermus aquaticus, không bị biến tính ở nhiệt độ cao, có khả năng xúc tác sự tổng hợp từ đầu đến cuối quá trình phản ứng (Mc Pherson và Moller, 2000). ™ Mg2+: nồng độ Mg2+ là thông số quan trọng trong phản ứng RT-PCR và PCR nó xác định dựa trên lượng RNA tổng số và loại reverse transcriptase sử dụng. Nếu M-MLV RT, nên dùng 3mM Mg2+ cho 1µg RNA tổng số và dùng 5mM Mg2+ cho 1-5µg RNA tổng số. Nếu dùng AMV RT, nồng độ Mg2+ tối ưu là 8mM. Nếu nồng độ Mg2+ thấp sẽ ứu chế hoạt động enzyme nên làm giảm hiệu quả kéo dài mạch. Nếu nồng độ quá cao thì Mg2+ sẽ ức chế sự biến tính hoàn toàn sản phẩm trong mỗi chu kỳ, làm giảm số lượng bản sao của sản phẩm cuối cùng. Dư thừa Mg2+ dẫn đến bắt cặp sai của mồi với DNA mẫu nên sẽ khuếch đại không chuyên biệt cho sản phẩm không đặc hiệu và làm giảm độ chính xác của phản ứng PCR. Nồng độ Mg2+ tối ưu phải được xác định cho từng loại phản ứng qua nhiều thử nghiệm (Mc Pherson và Moller, 2000). ™ Nhiệt độ bắt cặp: to quá cao thì không xảy ra sự bắt cặp, nếu thấp thì sẽ gia tăng sự bắt cặp không đặc hiệu và tạo ra các dimer của mồi. Nhiệt độ bắt cặp thường là 55-700C. Cách tính nhiệt độ bắt cặp thông qua Tm (là nhiệt độ mà ở đó việc lai bắt cặp đúng phân ly). Tm =4* (G + C) + 2* (A + T) Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   20  Oct. 30  G + C: số nucleotide G và C trong trình tự primer. A + T: số nucleotide A và T trong trình tự primer. Tm = 81,5 + 16,6 (log10[Na+]) + 0,41 (%G +%C) – 675/n Với n: số base có trong mồi, [Na+]: nồng độ muối Na+ hay K+. Dãy nhiệt độ cần khảo sát bắt đầu từ nhiệt độ nhỏ hơn Tm 50C và tăng dần thêm 20C (Mc Pherson và Moller, 2000). 2.3.3. Các bước thực hiện PCR • Giai đoạn 1: biến tính (denateration), nhiệt độ 94-950C trong 30-60s. • Giai đoạn 2: bắt cặp (annealation), nhiệt độ 40-700C. • Giai đoạn 3: kéo dài (elongation), nhiệt độ 720C trong 1-2 phút. Một phản ứng PCR bình thường không vượt quá 40 chu kỳ là tốt nhất. Trong phản ứng PCR, sản phẩm được tạo ra theo cấp số nhân trên cơ sở những sản phẩm ban đầu nên nếu số chu kỳ khuếch đại quá lớn sẽ làm cho sản phẩm càng bị sai lệch so với sản phẩm ban đầu. 2.3.4. Quy trình chẩn đoán ™ Lấy mẫu Mẫu huyết thanh, bệnh phẩm, dịch mụn nước thu nhận từ heo/bò trâu có biểu hiện lâm sàn nghi nhiễm virus (hay những mẫu có phản ứng ELISA dương tính với kháng thể kháng virus). ™ Xử lý mẫu: Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   21  Oct. 30  9 Mẫu bệnh phẩm: cho vào nghiền với cát vô trùng hay mảnh thủy tinh và sau đó cho nước muối sinh lý vào tạo huyễn dịch 10-20%, cho vào tủ lạnh rồi rã đông (làm nhiều lần để tách tế bào). Sau đó lọc lấy nước trong cho vào ống khác và cho thêm 2 loại kháng sinh penicillin và streptomycin để trong 30 phút-1 giờ. Lọc qua lọc đường kính 0,2µm rồi đưa vào môi trường nuôi cây tế bào (môi trường Baby Hamster Kidney_BHK 21) 9 Mẫu huyết thanh: Lọc qua lọc đường kính 0,2µm rồi đưa vào môi trường nuôi cây tế bào. (môi trường Baby Hamster Kidney_BHK 21). 9 Thu hoạch virus. 9 Thêm 200 μl mẫu vào 1ml thuốc thử TRIzol® cho vào 1 ống vô trùng. Trữ ở – 70°C cho đến khi li trích RNA. ™ Chẩn đoán RT-PCR: Quy trình được sử dụng tại OIE Reference Laboratory at Pirbright. Chẩn đoán bằng RT- PCR gồm 3 quá trình kế tiếp nhau. • Li trích RNA từ mẫu kiểm tra và mẫu đối chứng. • Tạo cDNA từ RNA đã li trích, khuếch đại bằng PCR. • Phát hiện sản phẩm PCR bằng điện di trên gel agarose. 9 Li trích RNA - Chuyển 1ml dung dịch vào ống vô trùng chứa 200 μl chloroform. Trộn hỗn hợp trong 10-15 giây và giữ ở nhiệt độ phòng trong 3 phút. - Li tâm 15 phút , 200000 vòng. - Chuyển 500 μl pha lỏng vào 1 ống vô trùng chứa 1 μl glycogen (20 mg/ml) và thêm 500 μl iso-propyl-alcohol (propan-2-ol). Trộn hỗn hợp trong vài giây. - Giữ ở nhiệt độ phòng trong 10 phút, sau đó đem li tâm trong 10 phút, 20000 vòng. - Loại bỏ phần lỏng nổi ở trên và thêm 1ml ethanol 70%. Trộn hỗn hợp trong vài giây. Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   22  Oct. 30  - Li tâm 10 phút, 20000 vòng. - Cẩn thận di chuyển phần lỏng nổi phía trên ra và không làm mất kết tủa ở đáy của ống. - Để khô tự nhiên ở nhiệt độ phòng trong 2-3 phút. - Tạo dịch huyền phù bằng cách thêm 20 μl nước cất không chứa enzyme phân giải acid nucleic (Nuclease-free water). - Giữ mẫu RNA đã được li trích trong đá nếu phản ứng RT được thực hiện hoặc trữ ở -70°C. Có thể dùng bộ kit chuyên dùng hoặc các TRIzol để ly trích mẫu. RNA tổng số được trích với thuốc thử TRIzol® từ những tế bào nhiễm virus nổi trên bề mặt (trong môi trường BHK-21) theo sự hướng dẫn của nhà sản xuất. Miếng gạc họng, mũi được thấm với 1ml PBS (phosphate-buffered saline) trước khi ly trích RNA. Mẫu huyết thanh được li trích mà không cần bất kì thao tác bằng tay nào. Như một sự lựa chọn, pha loãng 10 lần trong PBS của những chất đồng chất từ những mô, cơ quan phân tích được li trích. 9 Thiết kế primer • Cặp primer FM1F-FM1R có thể sử dụng để nhân vùng gene không mã hóa 5’UTR từ khuôn RNA của các chủng O, A, C, Asia 1, cho sản phẩm cDNA có độ dài 323- 328nucleotide, có độ dài biến động theo từng chủng/typ. Trình tự primer 1(FM1F): 5’-GCCTG-GTCTT-TCCAG-GTCT-3’ (positive strand) Trình tự primer 2 (FM1R): 5’-CCAGT-CCCCT-TCTCA-GATC-3’ (negative strand) Thông số của chu trình: 94°C for 5 minutes (1 cycle); 94°C for 1 minute, 55°C for 1 minute, 72°C for 2 minutes (30 cycles); 72°C for 7 minutes (1 cycle). Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   23  Oct. 30  Hình : Sản phẩm PCR từ sự khuếch đại của FMDV từ những động vật được lây nhiễm khi sử dụng cặp mồi FM1F-FM1R. Lane M: DNA size maker; lane 1: chuẩn âm; lane 2: chuẩn dương; lane 3: FMDV serotype A; lane 4: FMDV serotype O; lane 5: FMDV serotype C. • Thiết kế primer có khả năng khuếch đại những đoạn gene mã hóa 1D (VP1) của virus FMD liên quan đến các chủng O, A, C, Asia. Đoạn primer sense (+) của virus được thiết kế có trình tự giống đoạn 1C (VP3) của virus. Khi thiết kế đoạn primer antisense (-) NK61 phải dựa vào trình tự của đoạn gene 2B của chủng O, Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   24  Oct. 30  A, C và SAT2. Trình tự của primer NK72 dùng để xác định virus FMD được dùng cho tất cả các nghiên cứu về trình tự RNA trong phòng thí nghiệm. Đoạn mồi trình tự nucleotide (5’-3’) – chiều dài sản phẩm (bp) Positive sense (+) O-1C124 (ARS4) ACCAACCTCCTTGATGTGGCT 1301bp O-1C564 AATTACACATGGCAAGGCCGACGTG 861bp O-1C609 (Ovp3) TAGTGCTGGTAAAGACTTTGAGCT 816bp A-1C562 TACCAAATTACACACGGGAA 863-866bp A-1C612 TAGCGCCGGCAAAGACTTTGA 813-816bp C-1C536 TACAGGGATGGGTCTGTGTGTACC 877-883bp C-1C616 AAAGACTTTGAGCTCCGGCTACC 797-803bp As1-1C505 TACACTGCTTCTGACGTGGC 908-914bp As1-1C616 GGCAAGGACTTTGAGTTTCGC 797-803bp Negative sense (-) FMD-2B58 (NK61) GACATGTCCTCCTGCATCTG FMD-2A34 (NK72) GAAGGGCCCAGGGTTGGACTC Thông số tối ưu cho phản ứng PCR với các cặp mồi tương ứng Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   25  Oct. 30  Serotype Primer pair Cycle Denaturation Annealing Elongation O ARS4/NK61 30 1 phút 45 giây, 600C 2 phút A A-1C526/NK61 30 1 phút 1 phút, 550C 1,5 phút C C-1C536/NK61 25 1 phút 30 giây, 600C 2 phút Asia 1 As 1-1C505/NK61 30 1 phút 1 phút, 550C 1,5 phút • Cặp primer A/B được thiết kế cho sự khuếch đại vùng gene 3D của virus (the viral RNA polymerase 3D) và bao gồm vị trí giới hạn Ahd I (Ahd I restriction site) được bảo tồn cao trong số các thể phân lập mà có thể sử dụng như một bước xác nhận thêm trong chẩn đoán nhanh tiếp theo sự khuếch đại. Không có phản ứng chéo được phát hiện với thể phân lập SVDV (swine vesicular disease Virus), VSV (vesicular stomatitis virus) và BVDV (Bovine viral diarrhea virus). Sử dụng primer A và B để khuếch đại một đoạn 290bp của gene 3Dpol tương ứng với C- terminus của protein. Kết quả của RT-PCR với những thể phân lập khác nhau từ tất cả 7 serotype của FMDV chỉ tạo ra 1 băng duy nhất với kích thước mong muốn được quan sát tương ứng với những thể phân lập FMDV. Không có sản phẩm khuếch đại được quan sát trong mẫu từ SVDV (swine vesicular disease virus), VSV (vesicular stomatitis Virus) hoặc BVDV (Bovine viral diarrhea virus) chỉ ra rằng primer A và B không có phản ứng chéo với genome của những virus có quan hệ lâm sàn này. Primer A (5´-CACACGGCGTTCACCCA(A/T)CGC-3´) Primer B (5´-GACAAAGGTTTTGTTCTTGGTC-3´) Thông số của chu trình được ủ đầu tiên ở 480C trong 30 phút và 950C trong 10 phút, sau đó 35 chu kỳ gồm có 940C trong 30 giây, 600C trong 45 giây và 720C trong 45 giây, và sau cùng ủ ở 720C trong 7 phút. Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   26  Oct. 30  Hình: Sản phẩm PCR từ sự khuếch đại của FMDV từ những động vật được lây nhiễm khi sử dụng cặp mồi A/B. Lane M: DNA size maker. Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   27  Oct. 30  Hình: Giới hạn phát hiện RNA của FMDV bằng RT-PCR với primer A/B. (A) Dãy pha loãng của RNA được li trích từ môi trường nuôi cấy tế bào: 102 to 10–3 PFU của FMDV O1k và 103 to 10–1 PFU của FMDV SAT 1 (2/54). (B) FMDV O1k (GER/60) RNA được li trích độc lập từ dãy pha loãng của virus (104 to 10–4PFU). (C) Dãy pha loãng (từ 103 đến 100fg) của RNA FMDV O1 có chiều dài đầy đủ. Lane (–) RT, reverse transcriptase không được thên vào hỗn hợp phản ứng. Sản phẩm RT-PCR được phân tích bằng điện di trên gel agarose 2%. (N) chuẩn âm (uninfected). (M) maker. 9 Test - Với mỗi mẫu phân tích, thêm 2 μl random hexamers (20 μg/ml) và 5µl nước cất không chứa enzyme phân giải acid nucleic (Nuclease-free water) vào 1 ống li tâm 0,5ml vô trùng. Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   28  Oct. 30  - Cho 5µl RNA được ly trích từ quy tình trên vào ống thể tích 12µl và dùng pipet trộn đều nhẹ nhàng lên xuống. - Ủ ở 70°C trong 5 phút. - Giữ lạnh ở nhiệt độ phòng trong 10 phút. - Chuẩn bị hỗn hợp phản ứng RT cho vào ống vô trùng 1,5ml đối với những mẫu cần phân tích và 1 mẫu đối chứng: Buffer 5x (4 μl); bovine serum albumin (acetylated), 1 mg/ml (2 μl); dNTPs, hỗn hợp dATP, dCTP, dGTP, dTTP 10mM (1 μl); DTT 1mM (0.2 μl); Moloney Murine Reverse Transcriptase ( 200 U/μl (1 μl). - Cho 8µl hỗn hợp phản ứng RT vào 12µl hỗn hợp random primer/RNA. Trộn đều nhẹ nhàng bằng pipet. - Ủ ở 37°C trong 45 phút - Chuẩn bị hỗn hợp phản ứng PCR cho những mẫu cần phân tích và 1 mẫu đối chứng: Nước cất không chứa enzyme phân hủy acid nucleic (Nuclease-free water) (35 μl); buffer, 10x (5 μl); MgCl2 50 mM (1.5 μl); hỗn hợp dATP, dCTP, dGTP, dTTP 10mM (1 μl); primer 1, 10 pmol/μl (1 μl); primer 2, 10 pmol/μl (1 μl); Taq Polymerase, 5 units/μl (0.5μl). - Điện di trên gel agarose. Kết quả: Dương tính (+) nếu có sự hiên diện của băng có kích thước mong muốn. Dung dịch stock: Nước cất không chứa enzyme phân hủy acid nucleic (Nuclease-free water), TRIzol® Reagent, chloroform, glycogen, iso-propyl-alcohol (propan-2-ol), ethanol, random hexanucleotide primers, First strand buffer, BSA (acetylated), dNTPs, DTT, Moloney Murine Reverse Transcriptase, PCR reaction buffer (10x), MgCl2 và Taq Polymerase thương mại. Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   29  Oct. 30  III. KẾT LUẬN Chẩn đoán FMD sớm và chính xác là công cụ cần thiết để kiểm soát dịch bệnh. Chiến lược mới dựa vào RT-PCR đang được áp dụng để phát triển phương pháp kiểm tra nhanh và nhạy cho FMDV. Thử thách chính của phương pháp này là phải thiết kế các primer thích hợp cho chẩn đoán đa dạng di truyền của virus. Vì thế đòi hỏi phải sử dụng primer đặc hiệu và sự kết hợp phức tạp của các oligonucleotide và protocol. Cặp primer đặc hiệu cho các serotype khác nhau được sử dụng cho sự khuếch đại những vùng gene định typ FMDV. Chẩn đoán sớm và chính xác FMDV để có các biện pháp điều trị và phòng chống dịch lở mồm long móng một cách hiệu quả. IV. TÀI LIỆU THAM KHẢO Nguyễn Ngọc Hải, 2007. Công nghệ sinh học trong thú y. Nhà xuất bản nông nghiệp. g=vn Chẩn đoán bệnh lở mồm long móng (FMD)  Nguyễn Thúy Kiều |   30  Oct. 30 

Các file đính kèm theo tài liệu này:

  • pdflmlm1_2671.pdf
Luận văn liên quan