Ứng dụng kỹ thuật multiplex – Pcr để phát hiện một số gen độc lực của nhóm escherichia coli sản sinh độc tố shiga (stec) phân lập được từ phân bò, heo tiêu chảy và thịt bò

Và để bước đầu tầm soát các gen độc lực của E. coli STEC trong thực phẩm, chúng tôi tiến hành khảo sát bề mặt thịt bò, vì hầu hết các trường hợp ngộ độc thực phẩm là do người ăn phải thịt bò trong các sản phẩm có nguồn gốc từ thịt bò bị nhiễm E. coli nhóm STEC (Keskimaki, 2001). Kết quả phát hiện các gen độc lực của 9 mẫu E. coli phân lập từ thịt bò được ghi nhận ở bảng 4.5. Trong 9 mẫu bề mặt thịt bò khảo sát, không có mẫu nào phát hiện được E. coli có mang gen độc lực. Nếu nói về khía cạnh ngộ độc thực phẩm thì kết quả này thật sự đáng mừng. Điều này hoàn toàn hợp với luật pháp không cho phép STEC hiện diện trong thực phẩm (Paton và Paton, 1998). Tuy nhiên, nguyên nhân của sự vắng mặt những dòng E. coli mang gen độc lực được phân lập từ thịt bò có thể do:  Số mẫu khảo sát còn ít nên chưa đủ để phát hiện các gen độc lực.  Khuẩn lạc trắng trên môi trường CT - SMAC có thể không phải là khuẩn lạc điển hình của E. coli O157:H7. Theo Fujisawa và ctv (2002), trên môi trường CT - SMAC, vi khuẩn hiếu khí Pseudomonas spp. cũng có khuẩn lạc không màu, cũng không lên men sorbitol.

doc43 trang | Chia sẻ: lvcdongnoi | Lượt xem: 3386 | Lượt tải: 1download
Bạn đang xem trước 20 trang tài liệu Ứng dụng kỹ thuật multiplex – Pcr để phát hiện một số gen độc lực của nhóm escherichia coli sản sinh độc tố shiga (stec) phân lập được từ phân bò, heo tiêu chảy và thịt bò, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
chỉ ra rằng gen ehxA của những dòng STEC có trình tự giống nhau trên 98%, nhưng vẫn có sự khác nhau lớn ở một số đoạn trình tự chuyên biệt (Feng và Monday, 2000). Beutin và ctv (1989) đã khảo sát và khẳng định rằng đa số các dòng STEC đều cho kiểu dung huyết alpha (a-Hly). Các dòng sản sinh độc tố này thì không gây dung huyết trên thạch máu nhưng tạo thành vòng dung huyết nhỏ, mờ trên thạch máu cừu (có bổ sung Ca2+) sau khi ủ qua đêm. Hiện tại, phương thức tham gia gây bệnh của enterohaemolysin vẫn chưa được biết rõ. Chính sự dung huyết trở thành nguồn cung cấp Fe kích thích sự phát triển STEC trong ống tiêu hoá (Law và Kelly, 1995). 2.2.2.3. Yếu tố bám dính Yếu tố bám dính của STEC đã được chứng minh đóng vai trò quan trọng trong sự định vị vi khuẩn ở ruột. Đó là intimin, một protein màng ngoài có trọng lượng phân tử 94-97 kDa. Intimin được mã hóa bởi gen eae (E. coli attaching and effacing). Intimin gây tổn thương dạng bám dính và phá hủy, gọi là bệnh tích A/E (attaching and effacing) ở ruột già do vi khuẩn bám chặt vào tế bào biểu mô (Donnerberg và ctv, 1993). Có 4 loại intimin, được kí hiệu là a, b, g, và e. Trong đó: a-intimin thường được tìm thấy ở những dòng E. coli thuộc nhóm EPEC ở người và chó. b-intimin có ở những dòng E. coli thuộc nhóm EPEC và EHEC ở người và thỏ. g-intimin chủ yếu ở nhóm STEC của người và động vật, ở EPEC của người. e-intimin hiện diện trong những dòng E. coli thuộc nhóm EHEC ở bò và người (Oswald và ctv, 2000). Có sự liên quan chặt chẽ giữa gen eae và khả năng gây bệnh trầm trọng của các dòng STEC trên người như HC và HUS. Nhiều nghiên cứu chỉ ra rằng tỉ lệ của các dòng mang gen eae ở bệnh phẩm người cao hơn trên gia súc. Hơn nữa, sự hiện diện dòng STEC mang gen eae trên gia súc thường liên quan đến các dòng vi khuẩn E. coli độc lực trên người mà khoa học đã từng biết, chúng thuộc serotype O157, O26, O111, … (Sandhu và ctv, 1996). Ngoài ra còn có các yếu tố liên quan đến sự bám dính của các tác nhân khác gây bệnh đường ruột bao gồm fimbriae, OMPs (outer membrance proteins) và LPS (lipopolysaccharide). 2.2.3. Cách sinh bệnh Cách sinh bệnh là một quá trình gồm nhiều bước, liên quan đến sự tương tác phức tạp giữa số lượng vi khuẩn và các yếu tố của vật chủ. Cấp STEC qua đường miệng (chỉ cần liều rất thấp) thì vi khuẩn phải sống sót trong điều kiện môi trường khắc nghiệt của dạ dày và chúng phải cạnh tranh với các vi khuẩn khác ở đường ruột để thiết lập sự định cư. Vi khuẩn STEC sống sót trong đường ruột, nhân lên và sản sinh Stx rồi được hấp thu qua tế bào biểu mô ruột, dẫn truyền vào dòng máu. Điều này cho phép toxin đặc hiệu đến bề mặt tế bào đích gồm cả tế bào ruột lẫn các nội quan khác (Paton và Paton, 1998). Định cư vào ống tiêu hoá: vi khuẩn có khả năng bám vào tế bào biểu mô ruột và định cư trong ống tiêu hoá người là một trong những yếu tố quyết định độc lực. Người ta ước tính liều gây nhiễm của vài dòng STEC (O111:H- và O157:H7) khoảng 1–100 CFU (colony forming unit) (Paton và ctv, 1996). Sức đề kháng acid của STEC: Nét đặc trưng của các dòng STEC là khả năng định cư ở ống tiêu hóa người, với số lượng cảm nhiễm thấp. STEC đề kháng được pH acid của dạ dày. Do đó, dòng STEC O157:H7 vẫn còn sống sót trong các thực phẩm acid cao (Leyer và ctv, 1995). Tính trạng này được điều hòa bởi gen rpoS. Gen này có khả năng giúp vi khuẩn E. coli kéo dài thời gian sống sót ở pH dưới 2,5 (Paton và Paton, 1998). Gần đây, Waterman và Small (1996) báo cáo tình trạng đột biến của gen này. Điều này góp phần giải thích những dòng STEC có khả năng gây cảm nhiễm khác nhau. Kiểu bám vào tế bào biểu mô ruột: STEC có khả năng sống sót trong điều kiện khắc nghiệt của dạ dày. Chúng phải thiết lập sự định cư này bằng cách bám vào các tế bào biểu mô ruột. STEC định cư được ở đoạn kết tràng (colon) và có lẽ cũng ở đoạn xa ruột non người; mặc dù hiện tượng này chưa được chứng minh trực tiếp. Ngay cả những dòng trong serotype O157:H7 vẫn có sự bám dính khác nhau, điều này phản ánh nhiều cơ chế bám khác nhau. Vai trò của plasmid 60 MDa (pO157) cho STEC bám dính: Hầu hết các dòng STEC đều chứa pO157 này. Nhiều nghiên cứu đã phát hiện sự hiện diện của plasmid liên quan đến yếu tố bám (fimbriae) và sự bám dính với tế bào Henle 407 nhưng không bám vào tế bào HEp-2. Theo Tzipori và ctv (1987), có hiện diện plasmid hay không có đều không ảnh hưởng đến khả năng định cư ở kết tràng của STEC và khả năng gây bệnh tích A/E trên heo con sinh ra bằng cách mổ lấy thai. 2.2.4. Khía cạnh lâm sàng Ngày nay, người ta công nhận rằng có sự phân bố rất rộng về bệnh ở người liên quan đến các vi khuẩn sản sinh độc tố Stx. Những bệnh liên quan tới STEC thường gắn liền với những ổ dịch nhỏ rải rác lẫn những ổ dịch lớn có nguồn gốc ngộ độc thực phẩm. Nhiều bệnh nhân nhiễm STEC với triệu chứng đầu tiên là tiêu chảy, một số trường hợp thì sau một hay hai ngày thì tiêu chảy lẫn máu và HC. Đau bụng dữ dội cũng thường xảy ra. Đối với những bệnh nhân nhiễm STEC gây tình trạng HUS thì dễ để lại di chứng do sự tổn thương cấp tính ở thận, sự thiếu máu do dung huyết và giảm tiểu cầu. Vài cá thể bị HUS thì có triệu chứng thần kinh như bơ phờ, nhức đầu dữ dội, co giật và đau não. Mặc dù HUS xảy ra trên tất cả các nhóm tuổi nhưng tỉ lệ mắc bệnh do STEC ở trẻ em và người già thường cao hơn, điều này có thể do sự đáp ứng miễn dịch kém ở hai lứa tuổi này. Sự cải thiện trong kiểm soát lâm sàng và kỹ thuật thẩm tách thận đã làm giảm tỉ lệ chết do HUS từ 50% xuống hơn 10% trong hai – ba thập niên vừa qua. Tuy nhiên, số lượng người sống sót (khoảng 30%) phải chịu đựng ốm yếu triền miên, bao gồm suy thận mãn tính, tăng huyết áp và suy yếu hệ thần kinh. Tiến trình bệnh do STEC gây ra có hay không có biến chứng tùy thuộc vào sự tác động qua lại giữa vi khuẩn và vật chủ. Trong một ổ dịch, tuổi của người bệnh ảnh hưởng đến tỉ lệ mắc cũng như tỉ lệ chết. Những nghiên cứu gần đây về các ổ dịch lớn gây ra bởi STEC thuộc serotype O157:H7 cho thấy khoảng 5 – 10% bệnh nhân tiêu chảy tiến triển để hình thành HUS do STEC (Paton và Paton, 1998). 2.2.5. Dịch tễ học Trong nhiều năm qua, người ta thừa nhận rằng những dòng STEC gây bệnh trên người thuộc các tuýp huyết thanh O:H phổ rộng. Karmali (1989) đã liệt kê 32 serogroup O (tương đương với 60 tuýp O:H khác nhau). Trên khắp thế giới, các dòng STEC thuộc serotype O157:H- là nguyên nhân chính gây bệnh cho người. Việc phân lập các serotype này thường dựa vào khả năng không lên men sorbitol nên đã góp phần đánh giá quá cao tỉ lệ mắc phải nhóm này so với các serotype khác. Khi một tuýp được phân lập là O157, có lẽ có khuynh hướng bỏ qua tầm quan trọng tiềm năng gây bệnh của các tuýp khác. Trong khi đó, các serotype STEC không thuộc O157:H7 cũng là nguyên nhân nổi bật gây bệnh cho người. Nguồn lây nhiễm: Nhiều cuộc điều tra dịch tễ đã chứng minh rằng các dòng STEC hiện diện trong đường ruột của nhiều loài vật nuôi như bò, cừu, heo, dê, chó, mèo (Beutin và ctv, 1995) và cả ngựa (Chalmer và ctv, 1997). Do đó, STEC tồn lưu trong gia súc chính là nguồn quan trọng gây bệnh cho người, và nguồn quan trọng nhất là từ trâu bò. STEC lây truyền qua người chủ yếu bằng con đường thực phẩm, nước và từ người qua người. Cụ thể, STEC có thể xâm nhập vào chuỗi sản xuất thực phẩm cho con người từ nguồn gốc vật nuôi, vấy nhiễm thông thường nhất cho thịt là phân hoặc các thành phần trong ruột sau khi hạ thịt (Paton và Paton, 1998). Truyền lây STEC giữa người và người xảy ra trong các đợt bộc phát bệnh. Thời gian bài thải O157 qua phân là 2 – 4 tuần, nhưng khoảng 13% bệnh nhân thải O157 hơn một tháng và triệu chứng bệnh không biểu hiện trong giai đoạn sau. Như vậy nguy cơ truyền lây giữa người – người là cao (Keene và ctv, 1994). 2.2.6. Chẩn đoán Có những khó khăn liên quan đến chẩn đoán cảm nhiễm do STEC. Trong giai đoạn đầu, STEC tồn tại nhiều trong phân; có nhiều trường hợp, STEC chiếm trên 90% quần thể vi sinh vật hiếu khí (Paton và ctv, 1996). Tuy nhiên, lúc bệnh thuyên giảm, số lượng này giảm nhanh cực kỳ. Đối với những bệnh nhân HUS, triệu chứng dạ dày ruột có thể chỉ xuất hiện một tuần hoặc nhiều tuần, và ở thời điểm này số lượng STEC hiện diện trong phân rất ít. Trong vài trường hợp, tiêu chảy không kéo dài và nếu lấy bệnh phẩm qua trực tràng thì số lượng sẽ hạn chế. Vì những lí do này, yêu cầu của phương pháp chẩn đoán thích hợp phải nhạy, nhanh và đòi hỏi khối lượng mẫu tối thiểu. Các qui trình chẩn đoán thường tập trung vào việc phát hiện Stx, đặc biệt là Stx trong phân. Do các qui trình khác nhau về tính phức tạp, thời gian, độ nhạy, tính chuyên biệt và giá thành, vì vậy phải có chiến lược chẩn đoán thích hợp tùy hoàn cảnh và nguồn mẫu (Paton và Paton, 1998). 2.2.7. Phòng ngừa E. coli gây bệnh theo phân ra ngoài và phát tán trong đất, nước, không khí. Ngoài ra, bệnh có thể lây truyền từ người sang người do tay bẩn, thực phẩm và nước uống bị nhiễm. Do đó, bệnh có thể gây thành dịch, đặc biệt ở nhà trẻ, khoa nhi của bệnh viện và người già. Vì vậy, phòng bệnh chủ yếu là tuân thủ nghiêm ngặt qui chế vệ sinh, chú ý xử lý phân và dụng cụ của bệnh nhân. Không nên ăn những loại thực phẩm không đảm bảo chất lượng, đặc biệt là sản phẩm từ thịt chưa nấu chín vì chúng có thể là nguồn truyền nhiễm STEC. Có thể xác định chỉ số E. coli trong nước để xem nước có nhiễm bẩn hay không. 2.3. Serotype O157:H7 Theo thống kê về tình hình các ổ dịch bệnh do nhiễm phải STEC thì hầu hết các trường hợp đều do serotype O157:H7 gây ra (Nataro và Kaper, 1998). Điều này cho thấy serotype này nguy hiểm hơn, dễ lây lan bệnh hơn so với các serotype khác. Lần đầu tiên, serotype O157:H7 được phân lập và định danh vào năm 1982. E. coli O157:H7 ngày càng có tác động lớn ở Mỹ và châu Âu. Hàng năm, ở Mỹ có trên 73000 ca ngộ độc thực phẩm do nhiễm phải O157:H7, trong đó có 61 trường hợp tử vong. Nguyên nhân do ăn phải thịt bò chưa nấu chín hay đã bị vấy nhiễm, do uống sữa tươi hay do truyền lây giữa người và người sau khi đi bơi trong các hồ đã bị nhiễm (USA Department of Agriculture’s Food safety and Inspection Service, 2004). Từ đó, người ta xem O157:H7 là nguyên nhân phổ biến nhất cho HC và HUS. Serotype này có một số đặc điểm khác biệt so với các serotype E. coli khác: - Nhạy cảm với nhiệt độ, không phát triển được ở nhiệt độ 44 – 44,50C (Jay, 2000). - Không có khả năng lên men D-sorbitol trong 24 giờ. Trong khi đó có đến 75 – 94% những dòng E. coli khác lại lên men sorbitol. Do đó, người ta thay thế môi trường MacConkey có lactose bằng SMAC chọn lọc chứa 1% sorbitol để phân lập (Smith và Scotland, 1993). - Không biểu hiện hoạt tính b-D-glucuronidase (GUD): Điểm khác biệt về sinh hóa của dòng O157:H7 là không cho GUD dương tính, trong khi đó khoảng 90 – 95% chủng E. coli cho GUD dương tính. Và người ta dựa vào đặc tính này để phân biệt O157:H7 với các dòng E. coli khác (Monday và ctv, 2001). GUD là enzyme xúc tác sự thủy phân b-D-glucuronide thành rượu và glucuronate. Mặc dù không biểu hiện GUD nhưng các serotype O157:H7 vẫn mang đoạn gen uid hoàn chỉnh (gồm cả vùng điều hòa) trên nhiễm sắc thể. Kiểu hình đặc trưng này là do đã xảy ra các đột biến trên gen uid. Hầu hết các đột biến trên uid ở O157:H7 là đột biến thoái hóa, ví dụ như đột biến điểm thay thế T bằng G ở vị trí 92 so với E. coli thuộc chủng hoang dại (wild-type) (Feng và Lampel, 1994) hay đột biến do sự chèn thêm hai base G-G ở vị trí +686 trên uid ở serotype O157:H7 (Monday và ctv, 2001). Tóm lại, những đột biến này có thể ảnh hưởng đến khả năng hoạt động của GUD, O157:H7 vẫn sản sinh GUD nhưng GUD bị bất hoạt, không thực hiện chức năng thủy phân của nó được. Và điều này vẫn chưa được làm sáng tỏ hoàn toàn. - Kháng kháng sinh: cefixime, sulfivoxazol, tetracycline, streptomycine và các tác nhân ức chế khác như potassium tellurite (ức chế các VSV thông thường) (Kim và ctv, 1994). - Tính kháng acid (acid resistance - AR) đóng vai trò quan trọng cho khả năng sống sót của vi khuẩn trong môi trường acid. E. coli O157:H7 có khả năng sống sót trong môi trường acid từ pH = 2 đến pH = 7. Chẳng hạn, O157:H7 sống đến 56 ngày ở pH >= 4 trong môi trường TBS (Tryptic Soybean Broth), ngoài ra nó không phát triển ít nhất 5 giờ ở pH 3 -2,5 khi nhiệt độ 37oC trong môi trường canh Luria có điều chỉnh pH bằng HCl (trích dẫn bởi Jay, 2000). Đặc tính kháng acid này do gen rpoS qui định. Có 3 hệ thống AR khác nhau (Foster, 2004): (1) Hệ thống AR1: chỉ hoạt động khi tế bào tăng trưởng trong môi trường yếm khí với sự vắng mặt của glucose. (2) Hệ thống AR2: hoạt động phụ thuộc vào sự có mặt của glutamate. (3) Hệ thống AR3: hoạt động phụ thuộc vào sự có mặt của arginine. Ba hệ thống này hoạt động suốt quá trình tăng trưởng ở pha cân bằng (stationery phase) của vi khuẩn. - Khả năng chịu mặn: Trong canh khuẩn 4,5% NaCl, vi khuẩn tăng số lượng gấp 3 lần khi tăng thời gian lên 2 lần, và không phát triển khi ³8,5% NaCl (Jay, 2000). 2.4. Kỹ thuật PCR 2.4.1. Khái niệm Phương pháp PCR (Polymerase Chain Reaction) do Kary Mullis và cộng sự phát minh năm 1985 đã và đang được sử dụng rộng rãi. Đây là một phương pháp tạo dòng in vitro, không cần sự hiện diện của tế bào. 2.4.2. Nguyên tắc Phản ứng PCR được thực hiện trên cơ sở phản ứng sinh tổng hợp DNA, là phản ứng gồm nhiều chu kì nối tiếp nhau. Mỗi chu kì gồm 3 bước: Bước 1: là giai đoạn biến tính (denaturation), nhiệt độ thường sử dụng là 94 – 950C Bước 2: là giai đoạn lai (hybridization), nhiệt độ dao động trong khoảng 400C – 700C. Bước 3: là giai đoạn kéo dài (elongation hay extension), thường ở nhiệt độ 720C. Một chu kì gồm 3 bước trên sẽ được lặp đi lặp lại nhiều lần, và sau mỗi lần lặp lại sẽ làm tăng gấp đôi lượng DNA của lần trước. Số chu kì thường theo kinh nghiệm và có thể trong khoảng 25 – 30 chu kì, tùy theo lượng của mẫu DNA lúc bắt đầu và độ nhạy mong muốn. 2.4.3. Các thành phần cần thiết của phản ứng PCR - Dung dịch đệm: thành phần của dung dịch đệm có thể thay đổi tùy loại enzyme sử dụng, quan trọng nhất là ion Mg2+. Nó hình thành một phức hợp hòa tan với dNTP, rất cần cho quá trình liên kết các dNTP, xúc tác cho enzyme polymerase, làm tăng nhiệt độ nóng chảy (Tm) của DNA mạch đôi. Nồng độ MgCl2 trong hỗn hợp phản ứng cuối cùng thường biến thiên từ 0,5 – 5 mM (Hồ Huỳnh Thùy Dương, 1998). - Các dNTP (deoxyribonucleotide triphosphate): là hỗn hợp 4 loại dATP, dTTP, dCTP, dGTP làm nguyên liệu cho phản ứng tổng hợp DNA. - Mồi (primer): là những oligonucleotide mạch đơn, có trình tự bổ sung với trình tự base của hai đầu mạch khuôn để khởi đầu quá trình tổng hợp DNA. Các chuỗi primer nên được thiết kế để nhân một đoạn DNA sao cho đạt chiều dài tối hảo là 100 – 1000 bp mặc dù trong vài trường hợp sản phẩm chỉ 10 bp. - Taq polymerase: là DNA polymerase chịu nhiệt, được chiết tách từ vi khuẩn Thermus aquaticus ở suối nước nóng. Taq không bị phá hủy ở nhiệt độ cao và xúc tác tổng hợp từ đầu đến cuối quá trình phản ứng dưới sự hiện diện của Mg2+. Hoạt lực của Taq bị ảnh hưởng rất lớn bởi nồng độ Mg2+. Nồng độ tối hảo Mg thường là 1,5 mM (Trần Thị Dân, 2001). - DNA mẫu xét nghiệm. 2.4.4. Phân tích kết quả PCR Sau khi thực hiện phản ứng PCR, tùy vào mục đích mà người ta sử dụng nhiều kỹ thuật sinh học phân tử khác nhau để phân tích sản phẩm của phản ứng PCR như đọc trình tự sản phẩm PCR, tạo dòng sản phẩm PCR … Tuy nhiên, công việc đầu tiên sau khi thực hiện phản ứng PCR là phát hiện sản phẩm PCR bằng phương pháp điện di. Sau khi điện di, các DNA trong gel sẽ hiện hình dưới tia tử ngoại (UV) nhờ ethidium bromide, chất này có khả năng gắn xen vào các base của các nucleotide và phát huỳnh quang dưới tác dụng của tia UV. Và để ước lượng kích thước DNA trên gel, người ta sử dụng một “yếu tố đánh dấu trọng lượng phân tử “ (molecular weight marker - MWN) hay còn gọi DNA ladder (thang chuẩn). 2.4.5. Multiplex – PCR Là phản ứng PCR sử dụng đồng thời nhiều cặp mồi để khuếch đại nhiều đoạn DNA trong cùng một phản ứng PCR. Phương pháp này được thử nghiệm thành công vào năm 1988 và được áp dụng vào nhiều công trình nghiên cứu. Cho đến nay, vẫn chưa có nguyên tắc chung hay thành phần chuẩn nào cho việc tối ưu hóa phản ứng multiplex – PCR. Do vậy, ứng với mỗi một điều kiện phản ứng, cần phải điều chỉnh cho phù hợp với mục đích mong muốn. 2.4.6. Ứng dụng Hiện nay, thành tựu của PCR mở ra nhiều triển vọng cho sinh học phân tử, với nhiều ứng dụng trong sinh học, y khoa, nông nghiệp, khảo cổ, pháp y và hình sự. Trong nghiên cứu genome, PCR được ứng dụng trong nhân bản vô tính, multiplex PCR, cloning cDNA bằng PCR đảo (inverse PCR), recombinant PCR,... Trong y khoa và thú y, PCR được sử dụng để chẩn đoán các mầm bệnh virus, vi khuẩn, protozoa lẫn ký sinh trùng đa bào. Trong nông nghiệp và công nghiệp thực phẩm, sử dụng PCR để phát hiện gen halothan, gen thụ thể estrogen, gen thụ thể prolactin … trong công tác chọn giống vật nuôi, phát hiện các vi khuẩn gây ngộ độc thực phẩm : E. coli, Salmonella, Staphylococcus aureus, Campylobacter, ... Phần 3. NỘI DUNG VÀ PHƯƠNG PHÁP TIẾN HÀNH 3.1.Thời gian và địa điểm thực hiện 3.1.1. Thời gian Đề tài được thực hiện từ ngày 1/03/2005 đến ngày 30/07/2005. 3.1.2. Địa điểm - Mẫu phân được lấy từ các hộ hoặc trại chăn nuôi ở Đồng Nai, TP. HCM và Tiền Giang. - Mẫu bề mặt thịt bò được lấy ở lò mổ Dĩ An-Bình Dương. - Nuôi cấy, phân lập vi khuẩn được thực hiện tại Phòng thực hành Kiểm nghiệm thú sản và Môi trường sức khỏe vật nuôi, Khoa Chăn nuôi – Thú y, Trường Đại học Nông Lâm Thành phố Hồ Chí Minh. - Xác định các gen độc lực của E. coli được thực hiện tại Trung tâm Phân tích Thí nghiệm Hóa sinh, Trường Đại học Nông Lâm Thành phố Hồ Chí Minh. 3.2. Nội dung thực hiện - Phân lập vi khuẩn E. coli trong phân bò, heo và bề mặt thịt bò. - Li trích DNA của E. coli phân lập được. - Thực hiện phản ứng multiplex – PCR để phát hiện các gen eae, ehxA, stx1, stx2 và uid của E. coli. 3.3. Phương pháp thực hiện 3.3.1. Vật liệu thí nghiệm cơ bản Dụng cụ lấy mẫu: tăm bông, đèn cồn, chai cồn, môi trường chuyên chở Carry Blair, ... Mẫu vi khuẩn đối chứng dương: EDL933. ... 3.3.2. Cách lấy mẫu và bảo quản mẫu - Dùng muỗng vô trùng lấy phần giữa cục phân (khoảng 10 -12 g) mà bò, heo vừa mới thải ra, cho vào túi nylon vô trùng, buộc kỹ, bảo quản 4 - 80C và chuyển về phòng thí nghiệm càng nhanh càng tốt. Phân tiêu chảy có thể được lấy bằng cách dùng tăm bông, cho vào môi trường chuyên chở Carry Blair, chuyển về phòng thí nghiệm. - Quét bề mặt thịt bò bằng gạc hoặc tăm bông vô trùng, cho vào ống nghiệm chứa sẵn nước pepton đệm. 3.3.2. Nuôi cấy và phân lập E. coli 3.3.2.1. Môi trường nuôi cấy Môi trường tăng sinh Do số lượng E.coli nhóm STEC, đặc biệt là E. coli gây bệnh hiện diện trong thực phẩm rất ít, cho nên trước khi phân lập chúng tôi sử dụng môi trường tăng sinh pepton đệm có bổ sung kháng sinh cefixime (0,0125mg/L) và vancomycin (8mg/L) (FDA, 2002) để ức chế các vi khuẩn gram dương và vi khuẩn sống hoại sinh khác. Môi trường phân lập Để xác định môi trường nào cho kết quả tốt khi phân lập E. coli nhóm STEC mang gen độc lực, chúng tôi sử dụng 3 loại môi trường MAC, SMAC và CT - SMAC. Môi trường phân lập là môi trường MacConkey (MAC), Sorbitol MacConkey (SMAC), và Sorbitol MacConkey (CT - SMAC) có bổ sung kháng sinh cefixime (0,05mg/L) và tellurite (2,5mg/L) (FDA, 2002). Khoảng 90% E. coli đều lên men đường lactose, trên môi trường MAC, E. coli điển hình có khuẩn lạc màu đỏ hồng. Trên môi trường SMAC và CT - SMAC, E. coli không lên men đường sorbitol nên cho khuẩn lạc màu trắng, những dòng E. coli lên men sorbitol cho khuẩn lạc màu hồng. Việc tầm soát E. coli nhóm STEC trên phân, bệnh phẩm trên thạch SMAC, CT - SMAC là công cụ ban đầu phát hiện serotype O157 thuộc nhóm STEC. 3.3.2.2. Qui trình phân lập, định tính (1) Nuôi cấy và phân lập E. coli hiện diện trong phân với số lượng lớn, nên phân heo hoặc bò sau khi thu thập và chuyển về phòng thí nghiệm được tiến hành ria trực tiếp trên môi trường thạch đĩa MAC và SMAC, ủ 370C trong 18 - 24giờ, chọn và thu khuẩn lạc điển hình, giữ gốc. Li trích DNA rồi thực hiện multiplex – PCR để phát hiện các gen độc lực. Riêng đối với mẫu bề mặt thịt, do lượng E. coli hiện diện trên bề mặt thịt thường thấp so với mẫu phân, ngoài ra những dòng E. coli gây bệnh hiện diện trong phân, thực phẩm với tần số thấp hơn nhiều so với nhóm E. coli STEC không thuộc O157 (Paton và Paton, 1998). Đây chính là trở ngại cho việc phát hiện E. coli O157:H7, nên việc phết và ria trực tiếp trên môi trường MAC, SMAC thường gặp nhiều khó khăn. Vì vậy, để cải thiện khả năng phát hiện STEC có mang gen độc lực từ thịt, sử dụng môi trường pepton đệm có bổ sung vancomycin và cefixime (PVC) nhằm hạn chế sự cạnh tranh phát triển của những vi khuẩn khác để STEC có cơ hội tăng sinh tốt hơn. Sau khi ủ 370C trong 24h, canh khuẩn này được cấy ria trở lại trên môi trường thạch CT - SMAC để chọn lọc chuyên biệt nhóm STEC. (2) Chọn khuẩn lạc E. coli Trên từng loại môi trường MAC, SMAC, CT - SMAC, chọn ngẫu nhiên 6 – 10 khuẩn lạc rời rạc đại diện cho mỗi nhóm hình thái: Khuẩn lạc hồng trên môi trường MAC được kí hiệu HM. Khuẩn lạc hồng hoặc trắng trên môi trường SMAC được kí hiệu lần lượt là HS hoặc TS. Khuẩn lạc trắng hoặc hồng trên môi trường CT - SMAC kí hiệu lần lượt là TCT hoặc HCT. Dùng que cấy chạm nhẹ trên từng khuẩn lạc rời rạc rồi chuyển vào từng ống NA riêng biệt để giữ gốc riêng lẻ. Thu phần khuẩn lạc còn lại của mỗi nhóm, gom chung vào 1 eppendorf chứa sẵn 0,4 – 0,5 ml nước cất khử ion vô trùng. (3) Thử sinh hóa Sử dụng nghiệm pháp IMViC (FAO, 1992) cho từng khuẩn lạc riêng lẻ thuộc nhóm đó để xác định E. coli . 3.3.3. Li trích DNA Theo Cebula và ctv (1995), kết hợp với ý kiến của Cerna (2003) và Botteldoorn (2003), việc ly trích DNA được thực hiện như sau: thu khoảng 6 -10 khuẩn lạc E. coli trên môi trường thạch (MAC hoặc SMAC hoặc CT - SMAC hoặc NA) cho vào eppendorf đựng sẵn 0,4 - 0,5 ml nước cất hai lần vô trùng, đun sôi 10 phút, lấy ra và chuyển vào tủ âm -700C giữ trong 10 phút. Sau khi rã đông hoàn toàn, ly tâm 13000 vòng trong 3 phút. Để yên và hút phần dung dịch ở phía trên làm DNA khuôn mẫu (DNA xét nghiệm). Mẫu Thịt Phân Pepton (vancomycin, cefixime) (37oC/24h) SMAC (37oC/24h) MAC (37oC/24h) CT - SMAC (37oC/24h) Chọn 6 - 10 khuẩn lạc đỏ hồng Chọn 6 - 10 khuẩn lạc theo từng nhóm riêng: trắng hoặc đỏ hồng hoặc cả hai Cấy từng khuẩn lạc được chọn vào từng ống thạch nghiêng NA (37oC/24h) Thử IMViC (+/-;+;-;-) Thu tất cả phần còn lại của những khuẩn lạc đã chọn theo từng nhóm riêng và mỗi nhóm cho vào mỗi eppendorf chứa sẵn 0,4 - 0,5 ml H2O cất khử ion 2 lần Ly trích DNA (DNA nhóm khuẩn lạc) (+)) (-) Ly trích DNA riêng theo từng ống NA Multiplex - PCR Loại bỏ ống NA đã giữ gốc Multiplex- PCR Sơ đồ 3.1. Qui trình phân lập, định tính và phát hiện gen độc lực E. coli 3.3.4. Qui trình multiplex – PCR (1) Trình tự các đoạn mồi sử dụng trong multiplex – PCR Bảng 3.1 Trình tự các đoạn mồi sử dụng trong phản ứng multiplex - PCR Mồi (primer) Trình tự oligonucleotide (5’"3’) Kích cỡ DNA được khuếch đại (bp) Eae – F Eae – R ATTACCATCCACACAGACGGT ACAGCGTGGTTGGATCAACCT 397 EhxA – F EhxA –R GTTTATTCTGGGGCAGGCTC CTTCACGTCACCATACATAT 158 Stx1 - F Stx1 - R CAGTTAATGTGGTGGCGAAGG CACCAGACAATGTAACCGCTG 348 Stx2 - F Stx2 - R ATCCTATTCCCGGGAGTTTACG GCGTCATCGTATACACAGGAGC 584 Uid - F Uid - R GCGAAAACTGTGGAATTGGG TGATGCTCCATCACTTCCTG 252 (Feng và Monday, 2000) (2) Các thành phần của phản ứng PCR: (Feng và Monday, 2000) Mỗi phản ứng là 25 ml, gồm các thành phần sau: PCR buffer 1,1X; MgCl2 3mM; mỗi dNTP 200 mM; mỗi loại primer 7,5 pmol; Taq 2,5 ml; DNA 2 ml; và nước cất vừa đủ 25 ml. (3) Chu kỳ nhiệt (Feng và Monday, 2000) - Tiền biến tính 950C/5 phút - Biến tính 940C/1 phút - Ủ bắt cặp 610C/1 phút 25 chu kỳ - Kéo dài 720C/1 phút - Kéo dài chuỗi 720C/7 phút Điện di, đọc kết quả Lấy 10 ml sản phẩm PCR cùng với 2 ml loading dye được điện di trên gel agarose 1,6% trong TBE. Thang chuẩn (ladder) cũng được điện di đồng thời. Thời gian điện di 30 – 35 phút ở 90 V và 250 mA. Sau khi điện di, gel được ngâm trong dung dịch ethidium bromide khoảng 30 phút. Sau đó rửa sạch bằng nước và chụp hình gel với tia UV bằng máy chụp gel (phần mềm Quality One 2000, Bio-Rad). Các sản phẩm PCR được xác định bằng cách so với các băng của đối chứng dương và thang ladder 100 bp. Phần 4. KẾT QUẢ VÀ THẢO LUẬN 4.1. Kết quả phát hiện các gen độc lực của E. coli phân lập được từ phân bò tiêu chảy Kết quả phát hiện gen độc lực của E. coli trong từng nhóm khuẩn lạc phân lập được từ phân bò tiêu chảy được ghi nhận ở bảng 4.1. Trong 10 mẫu phân bò tiêu chảy có 5/10 mẫu (50%) phát hiện E. coli mang gen độc lực thuộc nhóm stx. Gen ehxA được phát hiện với tỉ lệ cao nhất (100%); kế đến là stx2 (4/10 mẫu – 40%), stx1 (1/10 mẫu – 10%); và không phát hiện được gen uid và eae. Như vậy, phân bò tiêu chảy là nguồn lưu cữu STEC mang gen stx2. Theo Paton và Paton (1998) đã nhận định rằng những dòng STEC mang stx2 thì thường liên kết bệnh nặng hơn so với những dòng STEC chỉ mang stx1. Do kinh phí hạn chế, mỗi loại môi trường phân lập chúng tôi chỉ chọn 2 khuẩn lạc riêng lẻ nhưng có kiểu hình giống nhau để xác định gen độc lực (li trích DNA từ gốc khuẩn lạc riêng lẻ đã nhân và giữ gốc trên thạch NA), kết quả được trình bày ở bảng 4.2. Kết quả ở bảng 4.2 cho thấy: (1) Ở mẫu số 1, chọn 2 khuẩn lạc hồng rời rạc (khuẩn lạc được đánh số thứ tự số 6 – HM6 và khuẩn lạc số 8 – HM8 trong nhóm khuẩn lạc HM) trên thạch MAC, multiplex - PCR đều phát hiện được gen stx2. Tương tự, 2 khuẩn lạc hồng trên thạch SMAC và 2 khuẩn lạc trắng trên thạch SMAC cũng đều mang gen stx2. Tương tự, đối với gen ehxA đều hiện diện cho mỗi khuẩn lạc riêng lẻ này. (2) Ở mẫu số 2, chọn 2 khuẩn lạc hồng rời rạc trên thạch MAC, multiplex - PCR đều phát hiện được gen ehxA nhưng không phát hiện được gen stx. Tương tự, 2 khuẩn lạc trắng trên thạch SMAC chỉ phát hiện một mẫu mang gen ehxA lẫn stx2. (3) Đối với mẫu phân số 3, chọn 2 khuẩn lạc hồng rời rạc trên môi trường MAC, 2 khuẩn lạc trắng trên SMAC, multiplex – PCR phát hiện 100% E. coli mang gen ehxA nhưng không có gen stx. Tóm lại, nhóm khuẩn lạc (gồm 6 – 10 khuẩn lạc) có mang gen độc lực thì chưa chắc từng khuẩn lạc riêng lẻ đều mang gen độc lực đó. Cho nên chọn từng khuẩn lạc để nghiên cứu là công việc cần thiết để xác định serotype của mỗi khuẩn lạc phân lập được. Nếu mục tiêu này không được đề cập thì việc thu hết các loại khuẩn lạc với các kiểu hình khác nhau để phát hiện sự hiện diện các gen độc lực của E. coli trong mẫu khảo sát là bước đi thích hợp. Bảng 4.1 Kết quả phát hiện gen độc lực của E. coli trong từng nhóm khuẩn lạc (HM, TS, và HS) ở phân bò tiêu chảy Mẫu Loại khuẩn lạc, môi trường Gen độc lực eae ehxA stx1 stx2 uid 1 HM _ + _ + _ HS _ + _ + _ TS _ + _ + _ 2 HM _ + _ + _ HS _ + _ _ _ TS _ + _ + _ 3 HM _ + _ + _ HS _ + _ _ _ TS _ + _ + _ 4 HM _ + _ _ _ HS _ + _ _ _ HCT _ _ _ _ _ 5 HM _ + _ _ _ HS _ + _ _ _ 6 HM _ + _ _ _ HS _ + _ + _ 7 HCT _ + _ _ _ 8 HCT _ + + _ _ 9 HM _ + _ _ _ TS _ + _ _ _ 10 HM _ + _ _ _ HS _ + _ _ _ TS _ + _ _ _ Bảng 4.2 Kết quả phát hiện gen độc lực E. coli từng khuẩn lạc riêng lẻ ở phân bò tiêu chảy Mẫu Loại khuẩn lạc, môi trường Gen độc lực eae ehxA stx1 stx2 uid 1 HM6 _ + _ + _ HM8 _ + _ + _ HS4 _ + _ + _ HS6 _ + _ + _ TS4 _ + _ + _ TS5 _ + _ + _ 2 HM1 _ + _ _ _ HM3 _ + _ _ _ TS1 _ _ _ _ _ TS2 _ + _ + _ 3 HM1 _ + _ _ _ HM3 _ + _ _ _ TS3 _ + _ _ _ TS7 _ + _ _ _ 4.2. Kết quả phát hiện gen độc lực của E. coli phân lập được từ phân heo con cai sữa tiêu chảy Kết quả phát hiện gen độc lực của E. coli từ 9 mẫu phân heo cai sữa tiêu chảy được trình bày ở bảng 4.3. Bảng 4.3 cho ta thấy có 4/9 mẫu (44,4%) mang gen stx, trong đó có ¼ mẫu mang gen stx1 (25%) và ¾ mẫu mang gen stx2 (75%), không có mẫu nào mang gen uid và eae, 9/9 mẫu (100%) mang gen ehxA. Blanco và ctv (1997) kết luận rằng gen stx1 thường hiện diện tỉ lệ thấp trên heo. Có 6/25 (24%) nhóm khuẩn lạc được phân lập từ 9 mẫu phân heo cai sữa tiêu chảy, cùng lúc mang 2 gen độc lực (ehxA và stx1 hoặc ehxA và stx2). Điều này sẽ làm tăng khả năng gây bệnh của E. coli đối với heo. Người ở mọi lứa tuổi đều có thể bị nhiễm STEC với những serotype khác nhau (Beutin và ctv, 1995). Bảng 4.3 Kết quả phát hiện gen độc lực của nhóm khuẩn lạc đại diện cho E. coli trong phân heo cai sữa tiêu chảy Mẫu Loại khuẩn lạc, môi trường Gen độc lực eae ehxA stx1 stx2 uid 1 HM _ + _ _ _ HS _ + _ _ _ TS _ + _ _ _ 2 HM _ + _ _ _ HS _ + + _ _ TS _ + _ _ _ 3 HS _ + _ _ _ TS _ + _ _ _ 4 HM _ + _ _ _ HS _ + _ _ _ TS _ + _ + _ 5 HS _ + _ + _ TS _ + _ + _ 6 HM _ + _ + _ HS _ + _ _ _ TS _ + _ + _ 7 HM _ _ _ _ _ HS _ + _ _ _ TS _ + _ _ _ 8 HM _ _ _ _ _ HS _ + _ _ _ TS _ + _ _ _ 9 HM _ _ _ _ _ HS _ + _ _ _ TS _ + _ _ _ 4.3. Kết quả phát hiện các gen độc lực của E. coli phân lập được từ phân bê tiêu chảy Ban đầu, đề tài chỉ tiến hành cấy ria trực tiếp mẫu phân heo hoặc bò lên hai loại môi trường MAC và SMAC để thu các nhóm khuẩn lạc và phát hiện gen. Hướng phân lập E. coli có sử dụng PVC và CT - SMAC chỉ để áp dụng đối với mẫu bề mặt thịt. Tuy nhiên, qua thực tế khảo sát (9 mẫu phân heo tiêu chảy và 10 mẫu phân bò tiêu chảy) cho thấy tần số phát hiện E. coli mang gen stx1 hiện diện với tỉ lệ thấp (10% ở bò tiêu chảy và 11,1% ở phân heo cai sữa tiêu chảy), và chưa có mẫu phân heo hay bò tiêu chảy nào được tìm thấy eae và uid. Theo Paton và Paton (1998) thì E. coli STEC dòng O157 ít hơn 1% trong quần thể E. coli. Mặt khác, ngoài E. coli, trong phân còn có sự hiện diện của nhiều loài vi khuẩn khác như Salmonella, Shigella, Campylobacter, Staphylococcus aureus, Proteus ... Vì vậy, để tăng khả năng phát hiện những dòng E. coli STEC mang gen gây độc từ phân bê tiêu chảy, chúng tôi tiến hành phân lập theo hướng có sử dụng môi trường tăng sinh chọn lọc và môi trường thạch chọn lọc chuyên biệt CT - SMAC. Kết quả phát hiện gen độc lực được ghi nhận cụ thể ở bảng 4.4. Trong 8 mẫu phân bê tiêu chảy, có 8/8 mẫu (100%) phát hiện được E. coli mang ít nhất 1 gen độc lực, có mẫu phát hiện E. coli mang 2 -3 gen độc lực. Gen ehxA được phát hiện với tỉ lệ cao nhất (8/8 mẫu – 100%), kế đến là gen stx1 (7/8 mẫu – 87,5%), gen stx2 (1/8 mẫu – 12,5%) . Trong khi đó, không phát hiện được gen uid trong bất kì mẫu nào. Smith và Scotland (1988) và Gyles (1992) cho rằng nhiều loại gia súc mang STEC không có biểu hiện triệu chứng, một vài dòng STEC có khả năng gây tiêu chảy cho bò, đặc biệt là bê. Và 7/8 (87,5%) mẫu đều hiện diện cả gen ehxA và stx. Theo Barrett và ctv (1992), độc tố Stx là điều kiện cần chứ chưa phải là điều kiện đủ để gây bệnh tiêu chảy trên vật nuôi. Do đó, sự xuất hiện đồng thời các gen ehxA và stx có thể góp phần giải thích lý do tiêu chảy trên bê. Feng và Monday (2000) cho biết có trên 100 loại serotype STEC khác nhau có thể sản sinh các loại độc tố Stx1, Stx2, và nhiều biến chủng của Stx2. Trong đó, Stx1 và Stx2 là 2 độc tố chủ yếu gây ra bệnh ở người. Bảng 4.4 Kết quả phát hiện gen độc lực của E. coli trong từng nhóm khuẩn lạc ở phân bê tiêu chảy Mẫu Loại khuẩn lạc, môi trường Gen độc lực eae ehxA stx1 stx2 uid 1 HM _ + _ _ _ TS _ + _ _ _ 2 HM _ _ _ _ _ HS _ + _ _ _ HCT _ _ + _ _ 3 HM _ _ _ _ _ HS _ + + _ _ TCT _ _ _ _ _ 4 HM _ + _ _ _ HS _ + + _ _ HCT _ _ + _ _ 5 HM _ _ _ _ _ HS _ + + _ _ TCT _ _ _ _ _ 6 HM _ + _ _ _ HS _ + + _ _ HCT _ _ + _ _ 7 HCT _ + + + _ 8 HM _ + + _ _ HS _ + + _ _ 4.4. Kết quả phát hiện gen độc lực của E. coli phân lập được từ bề mặt thịt bò Trong quá trình giết mổ, E. coli từ phân dễ dàng vấy nhiễm lên nền sàn, dụng cụ giết mổ, nước sử dụng, phương tiện vận chuyển... Do đó, nếu qui trình giết mổ gia súc, vận chuyển và phân phối thịt không tuân thủ nghiêm ngặt các điều kiện vệ sinh thì nguy cơ vấy nhiễm E. coli từ phân vào thịt dễ dàng xảy ra. Phân gia súc là nguồn chủ yếu chứa E. coli O157:H7, và thịt heo cũng có thể là một nguồn lây nhiễm (Doyle, 1991). Theo Levine (1987), STEC là những tác nhân gây bệnh cho người, người trở nên cảm nhiễm do ăn phải thức ăn bị nhiễm STEC trong do tiếp xúc trực tiếp với STEC từ động vật (Renwick và ctv, 1993). Người bị nhiễm STEC có thể tiêu chảy trong trầm trọng hơn như HC và HUS (Karmali, 1989). Và để bước đầu tầm soát các gen độc lực của E. coli STEC trong thực phẩm, chúng tôi tiến hành khảo sát bề mặt thịt bò, vì hầu hết các trường hợp ngộ độc thực phẩm là do người ăn phải thịt bò trong các sản phẩm có nguồn gốc từ thịt bò bị nhiễm E. coli nhóm STEC (Keskimaki, 2001). Kết quả phát hiện các gen độc lực của 9 mẫu E. coli phân lập từ thịt bò được ghi nhận ở bảng 4.5. Trong 9 mẫu bề mặt thịt bò khảo sát, không có mẫu nào phát hiện được E. coli có mang gen độc lực. Nếu nói về khía cạnh ngộ độc thực phẩm thì kết quả này thật sự đáng mừng. Điều này hoàn toàn hợp với luật pháp không cho phép STEC hiện diện trong thực phẩm (Paton và Paton, 1998). Tuy nhiên, nguyên nhân của sự vắng mặt những dòng E. coli mang gen độc lực được phân lập từ thịt bò có thể do: Số mẫu khảo sát còn ít nên chưa đủ để phát hiện các gen độc lực. Khuẩn lạc trắng trên môi trường CT - SMAC có thể không phải là khuẩn lạc điển hình của E. coli O157:H7. Theo Fujisawa và ctv (2002), trên môi trường CT - SMAC, vi khuẩn hiếu khí Pseudomonas spp. cũng có khuẩn lạc không màu, cũng không lên men sorbitol. Mẫu âm tính thật sự. Bảng 4.5 Kết quả phát hiện gen độc lực của E. coli trên bề mặt thịt bò Mẫu Loại khuẩn lạc, môi trường Gen độc lực eae ehxA stx1 stx2 uid 1 TCT _ _ _ _ _ 2 TCT _ _ _ _ _ 3 TCT _ _ _ _ _ 4 TCT _ _ _ _ _ 5 TCT _ _ _ _ _ 6 TCT _ _ _ _ _ 7 TCT _ _ _ _ _ 8 TCT _ _ _ _ _ 9 TCT _ _ _ _ _ 4.5. Tổng kết kết quả phát hiện gen độc lực của E. coli trên các mẫu khảo sát có nguồn gốc từ bò và heo Tóm lại, trong khảo sát này, 2 đối tượng gia súc được chọn khảo sát là bò và heo. Ở bò, chúng tôi khảo sát trên ba loại mẫu: phân bê tiêu chảy, phân bò tiêu chảy và bề mặt thịt bò vì như Beutin và ctv (1995) đã nhận định rằng những dòng STEC thường hiện diện trong phân của loài nhai lại. Trên heo, phân heo cai sữa tiêu chảy được tập trung khảo sát vì tính nhạy cảm của lứa tuổi này với nhóm STEC. Khảo sát 36 mẫu, gồm 8 mẫu phân bê tiêu chảy, 10 mẫu phân bò tiêu chảy, 9 mẫu phân heo tiêu chảy và 9 mẫu bề mặt thịt bò, kết quả phát hiện gen độc lực của E. coli từ các mẫu khảo sát trên được tổng hợp ở bảng 4.6. Như vậy, trong 36 mẫu khảo sát có 16 mẫu phát hiện E. coli mang gen độc lực của nhóm STEC, chiếm tỉ lệ 44,4%. Gen ehxA được phát hiện với tỉ lệ rất cao (75%). Hầu hết các dòng STEC O157 và các dòng STEC không thuộc O157 đều sản sinh độc tố gây dung huyết EhxA (Paton và Paton, 1998). Theo Stephan và Hoelzle (2000), STEC mà không mang gen ehxA thì độc lực sẽ giảm và thậm chí không độc đối với người. Tần số hiện diện gen stx1 và stx2 lần lượt là 9/36 mẫu (25%) và 8/36 mẫu (22,2%). Không phát hiện được gen eae và uid trong các mẫu khảo sát. Điều này có thể được giải thích do các primer Eae chỉ gắn vào đoạn gen eae chuyên biệt tạo dạng protein g-intimin (Feng và Monday, 2000). Protein này có chủ yếu ở các serotype O157:H7 và O55:H7 mà thôi. Các serotype này hiện diện rất ít trong mẫu phân cũng như thực phẩm. Beutin và ctv (1995) đã nghiên cứu và kết luận rằng chỉ có 3/208 (1,4%) khuẩn lạc STEC có nguồn gốc từ phân của động vật dương tính với eae. Theo Wang và ctv (2002), gen ehxA có khả năng gây bệnh cao hơn. Vả lại, theo Jerse và ctv (1990), intimin do gen eae mã hóa là điều kiện cần chứ không phải là điều kiện đủ để gây sự tổn thương kiểu A/E. Tóm lại, tuy đã phát hiện một số E. coli thuộc nhóm STEC nhưng vẫn chưa phát hiện bất kì dòng E. coli O157:H7. Bởi vì, những vụ bộc phát bệnh do STEC không nhất thiết gây ra bởi một dòng đơn thuần và có lẽ cần một phức hệ VSV (Paton và Paton, 1998). Bảng 4.6 Tổng kết kết quả phát hiện các gen độc lực của E. coli nhóm STEC trên 36 mẫu khảo sát Nguồn gốc N (+) Gen độc lực eae ehxA stx1 stx2 uid Phân bò tiêu chảy 10 (%) 5 50,0 0 0,0 10 100,0 1 10,0 4 40,0 0 0,0 Phân heo cai sữa tiêu chảy 9 (%) 4 44,4 0 0,0 9 100,0 1 11,1 3 33,3 0 0,0 Phân bê tiêu chảy 8 (%) 7 87,5 0 0,0 8 100,0 7 87,5 1 12,5 0 0,0 Bề mặt thịt bò 9 (%) 0 0,0 0 0,0 0 0,0 0 0,0 0 0,0 0 0,0 Tổng cộng 36 16 0 27 9 8 0 (%) 44,4 0 75 25 22,2 0 N: số lượng mẫu khảo sát (+): số lượng mẫu phát hiện có mang gen độc lực của E. coli nhóm STEC Biểu đồ 4.1 Kết quả phát hiện các gen độc lực của E. coli trên 36 mẫu khảo sát Hình 4.1 Kết quả điện di sản phẩm multiplex - PCR T1: mẫu thịt số 1; P.B1: mẫu phân bò tiêu chảy số 1; Ladder: thang chuẩn; P.b7: mẫu phân bê tiêu chảy số 7; EDL933: đối chứng dương; P.h1: mẫu phân heo cai sữa tiêu chảy số 1. Phần 5. KẾT LUẬN VÀ ĐỀ NGHỊ 5.1. Kết luận Từ những kết quả thu nhận được trong quá trình thực hiện đề tài, chúng tôi rút ra những kết luận sau: E. coli trên môi trường thạch MAC chỉ xuất hiện 1 loại khuẩn lạc hồng (HM), trên môi trường thạch SMAC xuất hiện 2 loại khuẩn lạc trắng (TS) và hồng (HS), trên môi trường thạch CT - SMAC cũng xuất hiện 2 loại khuẩn lạc trắng (TCT) và hồng (HCT). Nhóm khuẩn lạc có mang gen độc lực thì chưa chắc từng khuẩn lạc riêng lẻ có mang gen độc lực đó. 100% mẫu phân tiêu chảy đều có E. coli mang gen dung huyết ehxA. Tần số phát hiện gen stx của E. coli phân lập được trong mẫu phân bò, heo và bê tiêu chảy lần lượt là: 50%; 44,4% và 100%. 9 mẫu bề mặt thịt bò chưa phát hiện được gen độc lực của E. coli. Chưa phát hiện được gen uid và eae trong 27 mẫu phân tiêu chảy của bò, bê và heo; và 9 mẫu bề mặt thịt. 5.2. Tồn tại và đề nghị Tồn tại Do điều kiện thời gian và kinh phí có hạn, đề tài còn có một số tồn tại sau: Chưa phát hiện và phân lập được serotype E. coli O157:H7. Chưa tổ chức khảo sát được việc phát hiện các gen độc lực của E. coli trên các môi trường phân lập MAC, SMAC, CT - SMAC. Đề nghị (1) Có thể ứng dụng kỹ thuật multiplex – PCR để phát hiện gen độc lực của những dòng E. coli gây bệnh trong chẩn đoán bệnh và kiểm tra vệ sinh an toàn thực phẩm, đặc biệt trong các trường hợp xảy ra dịch bệnh. (2) Tăng số lượng mẫu khảo sát, định serotype các khuẩn lạc riêng lẻ bằng kháng huyết thanh chuẩn. (3) Thay đổi môi trường tăng sinh để tăng khả năng phát hiện E. coli O157:H7. Chẳng hạn thay môi trường pepton đệm bổ sung cefixime và vancomycin bằng môi trường LST (Lauryl sulfate tryptose) bổ sung cefixime (0,0125mg/L) và tellurite (0,625mg/L) được ủ ở 420C trong 24 giờ (Dogan và ctv, 2003). TÀI LIỆU THAM KHẢO PHẦN TIẾNG VIỆT Bộ môn vi sinh – Khoa Y - Đại học Y Dược TP.HCM, 1996. Vi khuẩn học. Trang 123 – 130. Trần Thị Dân, 2001. Lưu ý về PCR. Tài liệu giảng dạy Trường Đại học Nông Lâm, TP. Hồ Chí Minh. Hồ Huỳnh Thuỳ Dương, 1998. Sinh học phân tử. Nhà xuất bản giáo dục TP. HCM. 301trang. Lê Thị Mai Khanh, 2004. Phát hiện một số gen độc lực của Escherichia coli phân lập được từ phân và thịt bò, heo bằng kỹ thuật multiplex - PCR. Luận văn Thạc sỹ Nông nghiệp Trường Đại học Nông Lâm, TP. Hồ Chí Minh. PHẦN TIẾNG NƯỚC NGOÀI Barrett T. J., Kaper L. P., Jerse A. E., and Wachsmuth I. K., 1992. Virulence factors in Shiga-like toxin producing Escherichia coli isolated from humans and cattle. J. Infect. Dis. 165: 970 - 980. Bauer M. E., and Welch R. A., 1996. Characterization of an RTX toxin from enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 64: 167 - 175. Beutin L., Montenegro M. A., Orskov I., Orskov F., Prada J., Zimmermann S., and Stephan R., 1989. Close association of verotoxin (Shiga-like toxin) production with enterohemolysin production in strains of Escherichia coli. J. Clin. Microbiol. 27: 2559 - 2564. Beutin L., Geier D., Zimmermann S., and Karch H., 1995. Virulence markers of Shiga-like toxin-producing Escherichia coli strains originating from healthy domestic animals of different species. J. Clin. Microbiol. 33: 631- 635. Blanco M., Blanco J. E., Gonzalez E. A., Mora A., Jansen W., Gomez T. A. T., Zerbini L. F., Yano T., de Castro A. F. P., and Blanco J., 1997. Note: Genes coding for enterotoxins and verotoxins in porcine Escherichia coli strains belonging to different O:K:H serotypes: relationship with phenotype. J. Clin. Microbiol. 35: 2958 - 2963. Botteldoorn N., Heyndrick M., Rijpens N., Herman L., 2003. Detection and characterization of verotoxigenic Escherichia coli by a VTEC/EHEC multiplex PCR in porcine faeces and pig carcass swabs. Research in Microbiology. 154: 97-104. Calderwood S. B., Acheson D. W. K., Keusch G. T., Barret T. J., Griffin P. M., Strockbine N. A. et al, 1996. Proposed new nomenclature for SLT (VT) family. ASM News. 62: 118 – 119. Cebula T. A., Payne W. L., and Feng P., 1995. Simultaneous Identification of Strains of Escherichia coli Serotype O157:H7 and Their Shiga – Like toxin Type by Mismatch Amplification Mutation Assay – Multiplex PCR. J. Clin. Microbiol. 33: 248 - 250. Cerna J. F., Nataro J. P., and Teresa Estrada Garcia, 2003. Multiplex PCR for detection of three plasmide borne genes of enteroaggregative Escherichia coli strains. J. Clin. Microbiol. 41: 2138 - 2140. Chalmer R. M., Salmon R. L., Willshaw G. A., Cheasty T., Looker N., Davies I., and Wray C., 1997. Verocytotoxin-producing E. coli O157 in a farmer handing horses. Lancet. 349: 1816. Dogan H. B., Kluleasan H., Cakin I., và Hallemam A. K., 2003. Evaluation of increased incubation temperature và cefixime – telluride treatment for the isolation of Escherichia coli O157:H7 from minced beef. J. Food Microbiology. 87: 29 -34. Donnenberg M. S., Tzipori S., McKee M. L., O’Brien A. D., Alroy J., and Kaper J. B., 1993. The role of the eae gen of enterohemorrhagic Escherichia coli in intimate attachment in vitro and in a porcine model. J. Clin. Invest. 92: 1418 - 1424. Doyle M. P., 1991. Escherichia coli O157:H7 and its significance in foods. International J. of Food Mic. 12: 289 - 302. FAO, 1992. Microbiological analysis in the food control laboratory. FDA, 2002. “Diarrheagenic Escherichia coli”, Bacteriological Analytical manual Online, CFSAN. September 2002. Feng P., Lample KA, 1994. Genetic analysis of uidA expression in enterohaemorrhagic Escherichia coli serotype O157:H7. Microbiology. 140: 2101- 2107. Feng P. and Monday S., 2000. Multiplex PCR for detection of trait and virulence factors in enterohemorrhagic Escherichia coli serotypes. Molecular and Cellular Probes. 14: 333 - 337. Fujisawa T., Sata S., and Aikawa K., 2002. Evaluation of sorbitol-salicin MacConkey medium containing cefixime and tellurite (CT-SSMAC medium) for isolation of Escherichia coli O157:H7 from raw vegetables. J. Food Mic. 74: 161 - 163. Gyles C. L. 1992. Escherichia coli cytotoxins and enterotoxins. Can. J. Microbiol. 38: 734 - 746. Jay J. M., 2000. Modern food Microbiology. An Aspen publication, Maryland. p. 531 - 543. Jerse A. E., Yu J., Tall B. D., and Kaper J. B., 1990. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc. Natl. Acad. Sci. USA. 87: 7839 – 7843. Foster J. W., 2004. Escherichia coli acid resistance: tales of an amateur acidophile. Karmali M. A. 1989. Infection by verotoxin-producing Escherichia coli. Clin. Microbiol. Rev. 2: 15 - 38. Keene W. E., McAnulty J. M., Hoesly L. P., Williams Jr., Hedberg K., Oxman G. L., Barrett T. J., Pfaller M. A., and Fleming D. W., 1994. A swimming-associated outbreak of hemorrhagic colitis caused by Escherichia coli O157:H7 and Shigella sonnei. N. Engl. J. Med. 331: 579 - 584. Keskimaki M., 2001. Shiga toxin-producing and other diarrhoeagenic Escherichia coli in Finland: pheno- and genotypic epidemiology. Academic dissertation. The Faculty of Agriculture and Forestry of the University of Helsinky, Finland. p. 15 – 18. Kim H. H., 1994. Characteristics of antibiotic-resistant Escherichia coli 0157:H7 in Washington State, 1984-1991. J. Infect. Dis. 170: 1606-1609. Konowalchuk J., Speirs J. I., and Stavric S., 1977. Vero response to a cytotoxin of Escherichia coli. Infect. Immu. 18: 775 - 779. Law D., and Kelly J., 1995. Use of heme and hemoglobin by Escherichia coli O157 and other Shiga-like-toxin-producing E. coli serogroups. Infect. Immun. 63: 700 - 702. Levine M. M., Xu J., Kaper J. B., Lior H., Prado V., Tall B., Nataro J., Karch H., and Wachsmuth I. K., 1987. A DNA probe to identify enterohemorrhagic Escherichia coli of O157:H7 and other serotypes that cause hemorrhagic colitis and hemolytic uremic syndrome. J. Infect. Dis. 156: 175 - 182. Leyer G. J., Wang L., and Johnson E. A., 1995. Acid adaptation of Escherichia coli O157:H7 increases survival in acidic foods. Appl. Environ. Microbiol. 61: 3752 - 3755. Lingwood C. A. 1996. Role of verotoxin receptors in pathogenesis. Trends Microbiol. 4: 147 - 153. Mainil J. G., and Daube G., 2005. Verotoxigenic Escherichia coli from animals, humans and foods: who’s who ?. Journal of Applied Microbiology. Rev. 98: 1332 - 1344. Monday S., Whittam T., and Feng P., 2001. Genetic and Evolutionary Analysis of Mutations in the gusA Gene That Cause the Absence of bêta-Glucuronidase Activity in Escherichia coli O157:H7. The Journal of Infectious Diseases. 184: 918 - 21 Nataro J. P. and Kaper J. P., 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11: 142 – 201. O’Brien A. D., Newland J. W., Miller S. F., Holmes R. K., Smith H. W., and Formal S. B., 1984. Shiga-like toxin-converting phages from Escherichia coli strains that cause hemorrhagic colitis or infantile diarrhea. Science. 226: 694–696. Oswald E., Schmidt H., Morabito S., Karch H., Marches O., và Caprioli A., 2000. Typing of Intimin Genes in Human and Animal Enterohemorrhagic and Enteropathogenic Escherichia coli : characterization of a New Intimin Variant. Infection and Immunity. 68: 64 - 71. Paton A. W., Ratcliff R., Doyle R. M., Seymour-Murray J., Davos D., Lanser J. A., and Paton J. C., 1996. Molecular microbiological investigation of an outbreak of hemolytic uremic syndrome caused by dry fermented sausage contaminated with Shiga-like toxin-producing Escherichia coli. J. Clin. Microbiol. 34: 1622 – 1627.. Paton J. C. And Paton A. W., 1998. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infection. Clin. Microbiol. Rev. 11: 450 - 479 Renwick S. A., Wilson J. B., Clarke R. C., Lior H., Borcyk A. A., Spika J., Rahn K., McFadden K., Brouwer A., Anderson N. G., Alves D., and Karmali M. A., 1993. Evidence of direct transmission of Escherichia coli O157:H7 infection between calves and a human. J. Infect. Dis. 168: 792 – 793. Sandhu K. S., Clarke R. C., McFadden K., Brouwer A., Louie M., Wilson J., Lior H., and Gyles C. L., 1996. Prevalence of the eaeA gene in verotoxigenic Escherichia coli strains from dairy cattle in Southwest Ontario. Epidemiol. Infect. 116: 1 - 7. Smith H. R., and Scotland S. M., 1988. Vero cytotoxin-producing strains of Escherichia coli. J. Med. Microbiol. 26: 77 - 85. Smith H. R., and Scotland S. M., 1993. Isolation and identification methods for Escherichia coli O157 and other Vero cytotoxin producing strains. J. Clin. Pathol. 46: 10 - 17. Stephan R., and Hoelzle L. E., 2000. Characterzation of shiga toxin type 2 variant B-subunit in Escherichia coli strains from asymptomatic human carriers by PCR-RFLP. Lett. Appl. Mic. 31: 139 - 142. Tzipori S., Karch H., Wachsmuth I. K., Robins-Browne R. M., O’Brien A. D., Lior H., Cohen M. L., Smithers J., and Levine M. M., 1987. Role of a 60-MDa plasmid and Shiga-like toxins in the pathogenesis of infection caused by enterohemorrhagic Escherichia coli O157:H7 in gnotobiotic piglets. Infect. Immun. 55: 3117 - 3125 USA Department of Agriculture’s Food safety and Inspection Service, 2004. Wang G., Clark C. G., and Rodgerst F. G., 2002. Detection in Escherichia coli of the genes defining the O157:H7 serotype, and components of the type 2 shiga toxin family by Multiplex PCR. J. Clin. Microbiol. 40: 3613 - 3619. Waterman S. R., and Small P. L., 1996. Characterization of the acid resistance phenotype and rpoS alleles of Shiga-like toxin-producing Escherichia coli. Infect. Immun. 64: 2808 - 2811. PHỤ LỤC HÓA CHẤT CHO ĐIỆN DI TBE (0,5X) Tris HCl 3,94 mg Acid Boric 1,39 mg Na2EDTA 93,06 mg Nước cất vừa đủ 500 ml pH = 8,3 Agarose (1,65%) Loading dye Bromophenol blue 0,25% Sucrose 40% TE 1X vừa đủ 100% HÓA CHẤT CHO NHUỘM GEL TBE 1X Ethidium bromide 10 mg/ml MÔI TRƯỜNG VÀ THUỐC THỬ Môi trường Nước pepton đệm Pepton 10 g Sodium chloride 5 g Disodium hydrogen phosphate 9 g Potassium dihydrogen phosphate 1,5 g Nước cất vừa đủ 1000 ml NA Pepton 5 g Sodium chloride 5 g Beef Extract 1,5 g Yeast Extract 1,5 g Agar 15 g Nước cất vừa đủ 1000 ml pH = 7,4 ± 0,2 (250C) MAC Bacto pepton 17 g Bacto Proteose pepton 3 g Bacto Lactose 10 g Bacto Bile salts 1,5 g Sodium Chloride 5 g Bacto agar 13,5 g Neutral Red 0,03 g Bacto Crystal Violet 0,001 g SMAC Pepton 20 g Sodium chloride 5 g Bile salt 1,5 g Sorbitol 10 g Crystal violet 0,001 g Neutral red 0,003 g Agar 15 g Nước cất vừa đủ 1000 ml SIMMON CITRATE Na citrate 2 g NaCl 5 g K2HPO4 1 g NH4H2PO4 1 g MgSO4 0,2 g Bromothymol blue 0,08 g Agar 15 g Nước cất vừa đủ 1000 ml MR – VP Pepton 7 g Glucose 5 g K2HPO4 5 g Nước cất vừa đủ 800 ml pH = 6,9 ± 0,2 Thuốc thử VP (Voges Proskauer) Dung dịch A: Alpha napthol 5 g Ethanol tuyệt đối 100 ml Dung dịch B: Potassium hydroxyde 40 g Nước cất 100 ml MR (Methyl red) Methyl red 0,1 g Alcohol 300 ml Nước cất vừa đủ 500 ml

Các file đính kèm theo tài liệu này:

  • docluan van.doc
  • docBIA.DOC
  • docmuc luc.doc
Luận văn liên quan