Ứng dụng kỹ thuật PCR genotyping (ORF75) trong nghiên cứu tác nhân gây bệnh đốm trắng trên tôm sú (penaeus monodon)

Thành phần hóa chất tham gia phản ứng là: PCR buffernồng độ là 1X, nồng độ MgCl2 là 1,5 mM,nồng độ dNTPs là 200µM,nồng độmồi xuôi vàmồi ngược là 20 pmol,nồng độ taq ADN polymerase là 2,0 U,nồng độ ADN chiết tách 1 µl. Tổng thể tích cho mỗi phản ứng là 25 µl.

pdf48 trang | Chia sẻ: lylyngoc | Lượt xem: 3038 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Ứng dụng kỹ thuật PCR genotyping (ORF75) trong nghiên cứu tác nhân gây bệnh đốm trắng trên tôm sú (penaeus monodon), để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
Guatemala, Belice Magbanua , 2 000; Bondad- Reantaso et al. 2001; Hossain et al. 2001; Wu et al. 2001 1999 - 2000 Mehico Bondad-Reantaso et al, 2001 2002 Pháp, Iran Dieu et al. 2004; Marks 2005 2005 Brazil APHIS-USDA 2005 2.3.1 Đặc điểm cấu tạo của WSSV WSSV có dạng hình trứng, có đuôi, acid nhân là ADN 2 mạch, không có thể ẩn, chỉ có thể vùi trong nhân của tế bào mang, biểu bì ruột, dạ dày và tế bào biểu bì dưới vỏ, cơ quan lympho (trích dẫn bởi Trần Thị Tuyết Hoa, 2004). Trong hệ gen của WSSV có A và T chiếm 59% (Escobedo-Bonilla et al., 2008), WSSV có kích PDF created with FinePrint pdfFactory Pro trial version 10 thước khá lớn đường kính khoảng 65-70 nm và dài 300 -350 nm (van Hulten el al.; 2001). WSSV là một trong những virus có hệ gen lớn nhất được phát hiện (khoảng 300kb). Kích cỡ hệ gen của WSSV khác nhau tùy theo từng vùng khác nhau, virus được phân lập ở Thái Lan (WSSV- TH) là 292.967 bp (van Hulten et al., 2001). Còn hệ gen của WSSV được phân lập từ Đài Loan (WSSV-TW) kích thước là 307.287 bp, hệ gen của WSSV được phân lập từ Trung Quốc (WSSV- CN) là 305.107 bp (Marks et al, 2005). Virus có ít nhất 5 lớp protein VP28, VP26, VP24, VP19, VP15 với trọng lượng phân tử tương ứng là 28, 26, 24, 19, 15 kDa (Escobedo-Bonilla , 2008). VP28 và VP19 cấu tạo nên màng bao, VP26, VP24, VP15 cấu tạo nên nucleocapsid (van Hulten et al., 2000 trích dẫn bởi Marks et al., 2005). Hệ gen của WSSV có chứa khoảng 531 đến 684 ORF (open reading frames), trong đó có từ 181- 184 ORF có chức năng mã hóa protein có kích thước từ 51 đến 6077 acid amin. Trong đó vùng ORF75, ORF94 và ORF125 có thể được sử dụng để nghiên cứu về dịch tể học của WSSV bằng phương pháp PCR (Escobedo-Bonilla , 2008). WSSV có thể tồn tại trong môi trường nước ít nhất là 30 ngày ở 300C (điều kiện phòng thí nghiệm) (Momoyama et al., 1998) và có thể tồn tại ít nhất 3-4 ngày trong môi trường nước ở 250C (Chang et al., 1998). 2.3.2 Dấu hiệu bệnh lý Tôm bị bệnh đốm trắng thường xuất hiện các dấu hiệu bệnh lý như sau: trên vỏ tôm có nhiều đốm trắng có đường kính từ 0,5 -2,0 mm (Lightner, 1996). Những đốm trắng thường xuất hiện ở phần đầu ngực và ở phần đuôi (đốt bụng thứ 5 và 6). Các đốm trắng thường có kích thước đều nhau tròn và có tâm trong. Ngoài ra, khi tôm bị bệnh còn có các dấu hiệu khác như: khi tôm bị bệnh đốm trắng ở giai đoạn đầu tôm thường tập trung ở gần bờ ao, cơ thể và phụ bộ có màu hơi đỏ, tôm giảm ăn, virus đốm trắng gây ảnh hưởng đến dạ dày, mang, lớp biểu bì dưới vỏ, gan tụy. Ở giai đoạn sau nó ảnh hưởng đến tế bào lympho, tuyến râu, cơ, ruột giữa, ở giai đoạn sau khi tôm bị bệnh nặng các cơ quan như dạ dày, mang, lớp tế bào biểu mô dưới vỏ, cơ quan lympho, gan tụy, tuyến râu sẽ bị hoại tử (Chang , 1996). Tỉ lệ chết tích lủy là 100% sau khi bệnh bộc phát khoảng 3-10 ngày (Lightner, 1996). PDF created with FinePrint pdfFactory Pro trial version 11 2.3.3 Loài và giai đoạn cảm nhiễm Virus này gây bệnh trên nhiều đối tượng tôm nuôi như F. setiferus and L. vannamei (ở Mỹ), F. Chinensis và M. japonicus (Trung Quốc), P. monodon (Indonesia, Thái Lan, Malaysia, Đài Loan), M. japonicus (Nhật Bản). Ngoài ra, WSSV còn có thể ký sinh trên các loài giáp xác khác ở vùng nước ngọt, nước lợ, vùng nước mặn như cua biển và tôm hùm. Tuy nhiên WSSV không gây chết cho những loài này mà những loài này chỉ là vật mang mầm bệnh (Lo et al., 1996). WSSV không những gây bệnh cho các loài tôm nuôi mà còn gây bệnh cho các loài tôm ngoài tự nhiên. Vì vậy cần phải có nhiều biện pháp để phòng bệnh hợp lý. Virus này gây bệnh trên tất cả các giai đoạn tôm nuôi từ giai đoạn trứng cho đến giai đoạn bố mẹ. Tuy nhiên bệnh thường gặp nhất là ở giai đoạn hậu ấu trùng, tiền trưởng thành và trưởng thành. Và tỉ lệ chết cao nhất là khi tôm nuôi 1-2 tháng. Bệnh thường xuất hiện khi tôm bị sốc (chẳng hạn như khi nồng độ muối thay đổi đột ngột hoặc nhiệt độ nước xuống thấp dưới 300C thì bệnh sẽ bệnh bộc phát nhanh chóng) (Jiravanichpaisal , 2004) 2.3.4 Phương thức lây nhiễm WSSV có thể lây theo chiều dọc và chiều ngang. Lây nhiễm theo chiều ngang chủ yếu là do ăn thịt lẫn nhau (tôm khỏe ăn thịt tôm bệnh, hoặc ăn các thức ăn bị nhiễm WSSV), hoặc lây nhiễm theo nguồn nước (Chou et al., 1998). Theo Bùi Quang Tề (2006) bệnh đốm trắng lây truyền theo phương ngang là chủ yếu. Virus này chủ yếu lây từ các giáp xác khác (tôm cua, chân chèo) nhiễm bệnh đốm trắng từ môi trường bên ngoài ao hoặc ngay bên trong ao nuôi tôm. Những con tôm khỏe ăn những con tôm bị bệnh đốm trắng chết bị làm cho bệnh lây lan càng nhanh hơn. Có thể một số loài chim nước đã ăn tôm bệnh đốm trắng từ ao khác và bay đến ao nuôi đã mang theo các mẫu thừa vào ao nuôi. Theo ông bệnh đốm trắng không có khả năng lây truyền qua theo phương thẳng đứng vì trứng bị bệnh đốm trắng thì không thể thành thục được. Nhưng trong quá trình đẻ trứng tôm bố mẹ thải ra các virus đốm trắng từ trong buồng trứng, do đó ấu trùng tôm dể dàng bị nhiễm virus ngay từ giai đoạn sớm. Theo Lo (1997) thì WSSV ngoài PDF created with FinePrint pdfFactory Pro trial version 12 lây truyền theo phương ngang thì nó cũng có lây từ mẹ sang con nhưng những virion của WSSV có hiện diện bên trong trứng hay không thì chưa xác định được. 2.3.5 . Một số phương pháp phát hiện WSSV Chẩn đoán là việc xác định căn nguyên của bệnh thông qua các triệu chứng của bệnh (bệnh lý học lâm sàng). Kỹ thuật được sử dụng để chẩn đoán bệnh rất đa dạng và phong phú, từ quan sát đơn giản cho đến các thiết bị hiện đại dựa trên cơ sở kỹ thuật sinh học phân tử. Hiện nay có nhiều phương pháp chẩn đoán bệnh do WSSV gây ra như: – Dự chẩn: dựa vào dấu hiệu bên ngoài, làm tiêu bản ướt (wet-mounts). – Kiểm tra khẳng định: kính hiển vi điện tử (TEM), lai tại chổ (In situ hybridisation –ISH), PCR (Polymerase chain reaction), hóa mô miễn dịch.... Trong đó, phương pháp chẩn đoán dựa vào dấu hiệu bệnh lý bên ngoài, TEM, hóa mô miễn dịch, lai tại chổ ít được sử dụng trong chẩn đoán bệnh đốm trắng cho tôm ở giai đoạn ấu trùng (larvae), hậu ấu trùng do những phương pháp này có hạn chế về mặt chi phí và độ chính xác. 2.3.6 Một số kết quả nghiên cứu dịch tể về bệnh đốm trắng WSSV là một trong những virus gây thiệt hại cho nghề nuôi tôm biển trên thế giới. Vì vậy, WSSV đã làm cho không ít nhà khoa học tham gia vào nghiên cứu dịch tể học phân tử của virus gây bệnh WSSV. Và đã đạt được nhiều thành tựu quan trọng. Hiện nay, trình tự bộ gen của WSSV đã được giải mã và cho thấy WSSV là một trong những virus với acid nhân là ADN có kích thước lớn. So sánh trình tự cả bộ gen của 3 dòng WSSV phân lập trên tôm từ Thái Lan, Đài Loan và Trung Quốc cho thấy sự tương đồng của 3 dòng WSSV là 99,32% và xác định được một số vùng có trình tự lặp lại thuộc ORF75, ORF94 và ORF125. Đây là một trong những ORFs được sử dụng để phân tích sự khác nhau và các dòng đặc trưng của WSSV (Pradeep et al., 2007). ORF75 ở tất cả những WSSV được phân lập thì vùng ORF75 có 2 loại trình tự lặp lại (repeat units- RUs), với kích cỡ là 102bp và 45bp. Trong đó, 45 nucleotide đầu tiên của trình tự lặp lại 102 bp giống với trình tự lặp lại 45bp. Đối với ORF94 vùng lặp lại có kích thước là 54 bp, vùng lặp lại thuộc ORF125 có kích thước là PDF created with FinePrint pdfFactory Pro trial version 13 69 bp (Bui Thi Minh Dieu , 2004). ORF75 và ORF94 đều mã hóa cho đoạn protein chỉ hiện diện trong virion của WSSV, vùng lặp lại của 2 ORFs này mã hóa cho đọan protein có trình tự như sau: đầu tiên là arginine hoặc lysine, tiếp theo là 2 alanine, đến 2 hoặc 3 proline sau đó là một dãy các acid amimo acid (aspartate, glutamate) (Bui Thi Minh Dieu , 2004). Còn ORF125 có trình tự lặp lại là 69 bp (Bui Thi Minh Dieu , 2004). Ở Thái Lan Wongteerasupaya et al (2003) đã phân tích 65 mẫu tôm từ 55 ao để xác định số lần lặp lại của trình tự lặp lại thuộc ORF94. Nghiên cứu đã phát hiện như sau: trình tự lặp lại thuộc ORF94 có số lần lặp lại nằm trong khoảng 6 đến 20, trong đó các mẫu có 8 vùng lặp lại chiếm đa số (32%). Ở Việt Nam vào năm 2004, Bui Thi Minh Dieu et al cũng nghiên cứu về vùng lặp lại thuộc ORF94 (6 ao ở miền Trung, 2 ao ở miền Nam). Kết quả được ghi nhận như sau: số vùng lặp lại thuộc ORF94 của tôm bị bệnh đốm trắng ở Việt Nam nằm trong khoảng 7 đến 17 vùng. Tiếp theo, năm 2006 Lê Vân Hải Yến đã khảo sát vùng lặp lại thuộc ORF94 ở 2 tỉnh Trà Vinh và Sóc Trăng. Kết quả nghiên cứu đã xác định ở Trà Vinh số vùng lặp lại thuộc ORF94 chỉ có 3 nhóm là: 5, 8, 9 còn ở Sóc Trăng thì có số vùng lặp lại thuộc ORF94 là 5, 7, 8, 12. Trong đó các mẫu có 8 vùng lặp lại chiếm tỉ lệ cao nhất (50% ở Sóc Trăng và 57,1% ở Trà Vinh). Kế tiếp là nhóm tác giả Trần Thị Tuyết Hoa đã khảo sát 169 mẫu tôm bệnh đốm trắng thu từ 19 ao ở Cà Mau, Bạc Liêu đã ghi nhận: ở ao nuôi tôm Bạc Liêu số trình tự lặp lại thuộc ORF94 trên bộ gen của WSSV là từ 4 đến 16 vùng; trong đó kiểu gen WSSV với 5 vùng lặp lại chiếm tỉ lệ cao nhất (48.8%) (Trần Thị Tuyết Hoa và ctv, 2008). Vào năm 2008, Lý Ngọc Hà cũng khảo sát sự biến đổi của trình tự lặp lại thuộc ORF94 của WSSV trên tôm tại Bạc Liêu và được ghi nhận là số vùng lặp lại thuộc ORF94 gồm 6 nhóm là: 4, 6, 7, 8, 9, 12. Trong đó, kiểu gen WSSV với 7 vùng lặp lại thuộc ORF94 chiếm tỉ lệ cao nhất (34,48%). Đặc biệt là có sự nhiễm đa dòng WSSV trong cùng một ao, và kiểu gen WSSV đang tồn tại ở Bạc Liêu là rất đa dạng. Còn ở Cà Mau có 3 nhóm vùng lặp lại thuộc ORF94 trên bộ gen WSSV, từ 5 đến 9 vùng lặp lại (Trần Thị Tuyết Hoa và ctv, 2008). Ở Ấn Độ, vùng lặp lại thuộc ORF94 có 13 kiểu gen được tìm thấy với số lần lặp lại từ 2 đến 16, trong đó số lần lặp lại 7 lần là phổ biến nhất chiếm 11,3%, trong những mẫu phân tích không có mẫu nào có số lần lặp lại là 11, 15 (Pradeep B, 2007). Vì vậy có thể nói rằng số vùng lặp lại thuộc ORF94 trên bộ gen WSSV ở PDF created with FinePrint pdfFactory Pro trial version 14 các thời điểm thu mẫu và ở các khu vực địa lí khác nhau thì khác nhau (Trần Thị Tuyết Hoa và ctv, 2008). Còn ORF125, ở Ấn Độ có 11 kiểu gen khác nhau được tìm thấy với số lần lặp lại từ 2 đến 14, số lần lặp lại được tìm thấy nhiều nhất là 7 lần chiếm 47,1%, không tìm thấy mẫu nào có số lần lặp lại 6 lần hoặc 13 lần (Pradeep B, 2007). Bui Thi Minh Dieu et al đã khảo sát vùng lặp lại ORF125 vào năm 2004 đã ghi nhận như sau: vùng lặp lại thuộc ORF125 có 3 kiểu gen được tìm thấy với số lần lặp lại từ 5 đến 7. Ở Bạc Liêu được vùng lặp lại thuộc ORF125 có 3 nhóm là: 5, 6 và 7. Trong đó, kiểu gen WSSV với 6 vùng lặp lại thuộc ORF125 chiếm tỉ lệ cao nhất (67,9 %) (Lý Ngọc Hà, 2008). Đối với ORF75 khi Bui Thi Minh Dieu et al ( 2004) phân tích 8 ao tôm bị bệnh đốm trắng ở Việt Nam (6 ao ở miền Trung, 2 ao ở miền Nam) tìm thấy 3 kiểu gen khác nhau của vùng lặp lại ORF75 là 5, 6, 14. Theo Pradeep B (2007) ở Ấn Độ vùng lặp lại thuộc ORF75 có 6 kiểu gen. Trong đó các mẫu có cùng số lần lặp lại trên một ORF thì có số lần lặp lại không giống nhau trên một hoặc cả hai ORF khác. Từ những kết quả trên cho thấy cả 3 ORFs trên đều có ý nghĩa quan trọng trong nghiên cứu dịch tể học của virus đốm trắng. Trong 3 ORFs trên thì ORF94 có vai trò lớn nhất trong nghiên cứu dịch tể học, tiếp theo là ORF125 và ORF75 (Pradeep B, 2007). 2.4. Kỹ thuật PCR và các yếu tố ảnh hưởng đến phản ứng PCR 2.4.1 Nguyên tắc phản ứng PCR Phương pháp PCR (Polymerase Chain Reaction) được Kary Mullis và cộng sự (Mỹ) phát minh năm 1985 và kể từ đó đã tạo nên một tác động to lớn đối với các nhà nghiên cứu sinh học phân tử và kỹ thuật di truyền trên toàn thế giới (Phạm Thành Hổ, 2003). Phương pháp PCR dựa trên hoạt động của ADN polymerase trong quá trình tổng hợp ADN mới từ mạch khuôn. Tất cả các ADN polymerase đều cần những mồi, là những đoạn ADN ngắn có khả năng bắt cặp bổ sung với một đầu của mạch khuôn. Ðoạn mồi này sau đó sẽ được nối dài ra nhờ hoạt động của ADN polymerase để hình thành một mạch mới hoàn chỉnh. Một phản ứng PCR là một chuỗi nhiều chu kỳ nối tiếp nhau, mỗi chu kỳ gồm ba bước, mỗi bước kéo dài khoảng vài chục giây đến vài phút, trình tự như sau : PDF created with FinePrint pdfFactory Pro trial version 15 Bước 1: Biến tính (denaturation) nhiệt độ được nâng lên khoảng 940C để làm biến tính ADN từ dạng sợi đôi (dsADN) thành sợi đơn (ssADN). Bước 2: Bắt cặp (anealing) trong bước này nhiệt độ trong buồng PCR hạ xuống nhiệt độ giai đoạn này phụ thuộc vào đoạn mồi, các đoạn mồi (primer) bắt cặp theo nguyên tắc bổ sung vào hai đầu của chuỗi nucleic acid đích, đây là giai đoạn quyết định nên tính đặc hiệu của sản phẩm PCR. Bước 3: Kéo dài (extension) trong giai đoạn này nhiệt độ được nâng lên khoảng 720C . Vì taq popymerase hoạt động tốt ở khoảng nhiệt độ là 70-720C. Ở khoảng nhiệt độ này, hoạt động đặc biệt của taq popymerase cao khoảng 150 nucleotide/giây/enzime (Bùi Chí Bửu và Nguyễn Thị Lang, 1999). Sự tổng hợp này cần phải có sự hiện diện các deoxy nucleoside triphosphate (dNTPs). Như vậy từ một số lượng N ADN đích ban đầu, sau n chu kỳ nhiệt, thử nghiệm PCR đã tổng hợp được N.2n bản sao. Với một số lượng bản sao, hay còn gọi là sản phẩm PCR (PCR product), chúng ta dễ dàng được phát hiện bằng phương pháp điện di (Nguyễn Viết Khuê, 2006) 2.4.2 Các yếu tố ảnh hưởng đến phản ứng PCR ADN mạch khuôn: Theo Khuất Hữu Thanh (2003), trong kỹ thuật PCR khuôn ADN có vai trò rất quan trọng, nó ảnh hưởng rõ rệt đến hiệu quả của phản ứng PCR. Phản ứng PCR tối ưu khi các đoạn mạch khuôn hoàn toàn tinh sạch, nhưng khi các đoạn mạch khuôn không sạch có lẩn các protein thì hiệu quả sẽ giảm, nó sẽ giảm theo tỉ lệ thuận với độ tinh sạch của mạch khuôn ADN. Hàm lượng ADN khuôn nằm trong khoảng 100 ng - 1 µg (Newton và Graham,1995 trích dẫn bởi Trần Thị Mỹ Duyên, 2006). Enzyme: Lượng enzyme cần thiết là phụ thuộc vào lượng ADN mẫu và kích thước phản ứng PCR. Nồng độ Mg2+: Nồng độ ion Mg2+ tối ưu phụ thuộc vào loại ADN polymerase, ADN khuôn và thành phần buffer (một số buffer thương mại đã có sẵn 1 lượng nhất định ion Mg2+). Nồng độ dNTPs: Lượng dNTPs thường được sử dung ở nồng độ 20- 200 µM của mỗi loại dNTPs. Nếu mất cân bằng trong thành phần các dNTPs sẽ dẫn tới lỗi sao chép của ADN polymerase (Hồ Huỳnh Thùy Dương, 1998). Việc tăng dNTPs PDF created with FinePrint pdfFactory Pro trial version 16 không làm tăng đáng kể lượng sản phẩm PCR so với việc hiệu chỉnh các yếu tố khác. Mồi (Primer): Mồi là chỉ tiêu quan trọng nhất để đạt được sự khuếch đại của một đoạn ADN đặc trưng. Mồi luôn luôn gắn với ADN khuôn ở đầu 3’ và ADN polymerase kéo dài tổng hợp theo chiều 5’- 3’. Trình tự mồi, nhiệt độ gắn mồi và nồng độ trong phản ứng PCR là nhân tố quyết định sự thành công của phản ứng PCR. Khi chọn mồi cần tính toán đảm bảo Tm của mồi xuôi và mồi ngược không chênh lệch nhau quá lớn. Trình tự ADN cần khuếch đại, là trình tự nằm giữa hai mồi không nên quá 1 kb. (Khuất Hữu Thanh, 2003). Chu kỳ phản ứng: trong thực tế số chu kỳ của phản ứng PCR không vượt quá 40 chu kỳ cho một phản ứng. Vì phản ứng PCR diễn ra 2 giai đoạn. Giai đoạn đầu số lượng bản sao tăng theo cấp số nhân tỉ lệ với lượng mẫu ban đầu. Sau đó hiệu quả khuếch đại giảm do các nguyên nhân sau: (i) hoạt tính của enzyme polymerase giảm theo thời gian ở nhiệt độ cao. (ii) Sự cạn kiệt của các thành phần phản ứng. (iii) Các bản sao vừa tổng hợp không kết hợp với mồi mà kết hợp với nhau. (iv) Sự xuất hiện của các sản phẩm phụ ức chế phản ứng (Hồ Huỳnh Thùy Dương, 1998). 2.4.3 Ứng dụng của PCR Phương pháp PCR được ứng dụng trong nhiều lĩnh vực như: kiểm tra huyết thống, chẩn đoán bệnh di truyền, tách dòng gen, gây đột biến điểm, phân tích mẫu DNA cổ, xác định kiểu gen của các đột biến, so sánh mức độ biểu hiện của gen, nghiên cứu quá trình tiến hoá phân tử , chọn giống vật nuôi, cây trồng …. Ngoài ra, phương pháp này đã được sử dụng rộng rãi trong nhiều nghiên cứu sinh học phân tử, vi sinh, kiểm nghiệm, chẩn đoán…để phát hiện mầm bệnh, vi sinh vật, virus, tạo đột biến gen và xác định các mối quan hệ họ hàng về di truyền của các loài động vật và thực vật….Trong thủy sản PCR đã được áp dụng để chẩn đoán bệnh, trong đó bao gồm: bệnh tôm: MBV, WSSV, YHV, TSV… (Viện nghiên cứu nuôi trồng thủy sản 1, 2006). PDF created with FinePrint pdfFactory Pro trial version 17 CHƯƠNG 3 VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 3.1 Địa điểm và thời gian thực hiện 3.1.1 Địa điểm: phòng thí nghiệm của bộ môn Sinh Học và bệnh Thủy Sản, khoa Thủy Sản, trường Đại Học Cần Thơ. 3.1.2 Thời gian thực hiện: 12/2008 – 5/2009. 3.2 Vật liệu nghiên cứu 3.2.1 Vật liệu thí nghiệm Mẫu tôm sú (31 mẫu) được thu từ các ao nuôi quãng canh ở Cà Mau, kích cỡ trung bình từ 15-25 g/con. 3.2.2 Hóa chất thí nghiệm – Dung dịch DTAB, CTAB, chloroform, cồn tuyệt đối, nước cất tiệt trùng… – PCR buffer 5X, dNTPs 25 mM, MgCl2 10mM, mồi ORF75-flank Forward, ORF75-flank Reverse, taq ADN polymerase 5U/ml (Promega). – Agarose, TAE 1X, ethidium bromide, dung dịch nạp mẫu, thang ADN (100bp plus- Fermentas, 1kb plus- Invitrogen )... 3.2.3 Dụng cụ thí nghiệm – Dụng cụ chiết tách: que nghiền, đầu col (xanh, vàng), pipet (1000ml, 200ml), ống eppendorf, máy vortex, máy ly tâm, máy ủ, tủ hút… – Dụng cụ khuếch đại: đầu col (xanh, vàng), pipet, ống eppendorf, tủ hút, máy ly tâm, máy vortex, máy PCR… – Dụng cụ điện di: đầu col vàng, pipet, lò vi sóng, bồn điện di, máy chụp hình gel… PDF created with FinePrint pdfFactory Pro trial version 18 3.3 Phương pháp nghiên cứu 3.3.1 Qui trình phát hiện WSSV: thực hiện theo qui trình hướng dẫn của công ty Farming IntelliGene Technology Corporation, Đài Loan (kit IQ2000- WSSV) Ly trích ADN: ADN được ly trích từ mang tôm sú với bộ chiết tách là DTAB – CTAB. – Chuẩn bị mẫu: cho khoảng 20mg mang tôm vào ống eppendorf (1,5ml) chứa 600µl dung dịch DTAB. Nghiền mẫu bằng que nghiền tiệt trùng. – Ủ mẫu đã chuẩn bị ở 750C trong 5 phút, sau đó làm lạnh đến nhiệt độ phòng. – Lắc đều mẫu, ly tâm nhẹ, sau đó thêm 700µl chloroform, lắc đều 20 giây nữa và ly tâm 12.000 vòng/phút trong 5 phút. – Chuyển phần dung dịch ở trên sang ống eppendorf 1,5ml mới, thêm 100ml dung dịch CTAB và 900ml nước cất, lắc đều, sau đó ủ ở 750C trong 5 phút. – Làm lạnh xuống nhiệt độ phòng và ly tâm 12.000 vòng/phút trong 10 phút. – Cẩn thận rút bỏ phần dung dịch trong ở trên, hòa tan phần còn lại bằng 150 ml dung dịch hòa tan, ủ ở 750C trong 5 phút, sau đó làm lạnh ở nhiệt độ phòng. – Ly tâm 12.000 vòng/phút trong 5 phút. Chuyển phần dung dịch trong phía trên sang ống eppendorf 0,5ml mới có chứa 300ml ethanol 95%. – Voxter trộn mẫu, ly tâm 12.000 vòng/phút trong 5 phút, sau đó rửa sạch ADN bằng cồn 700, để lắng xuống, làm khô và hoà tan trong dung dịch đệm TE. Trữ ADN ly trích ở -80 0C. Qui trình khuếch đại – Chuẩn bị các chất phản ứng Bước 1 : 8μl/phản ứng, bao gồm các chất - First PCR PreMix 7,5μl - IQzyme DNA Polymerase 2U/μl 0,5μl Bước 2: 15μl/ phản ứng, bao gồm các chất - Nested PCR Premix 14μl - IQzyme DNA Polymerase 2U/μl 1μ PDF created with FinePrint pdfFactory Pro trial version 19 – Điều kiện phản ứng PCR bước 1: 940C trong 2 phút, 940C trong 20 giây, 620C trong 20 giây, 720C trong 30 giây. Lặp lại chu kỳ trên 15 lần. Sau đó, ở 720C trong 30 giây, 200C trong 30 giây. PCR bước 2: 940C trong 20 giây, 620C trong 20 giây, 720C trong 30 giây. Lặp lại chu kỳ trên 30 lần. Sau đó, 720C trong 30 giây, 200C trong 30 giây. Điện di – Chuẩn bị bản thạch (gel): đun nóng dung dịch đệm TAE 1X với agarose 1,5% (1,5g/100ml) cho tới khi agarose tan hoàn toàn (tránh để gel tràn ra ngoài). Sau đó để nguội khoảng 500C, cho 2 – 4µl Ethidium Bromide vào, lắc đều hoà tan dung dịch, rồi đổ dung dịch agarose từ từ vào khuôn gel. Thường bề dày của gel chỉ cần cao hơn đáy của lược khoảng 0,3 – 0,5 cm, bề dày của gel không quá 0,8 cm. – Điện di: cẩn thận cho mẫu, thang ADN, đối chứng âm, đối chứng dương vào trong từng giếng. Sau đó, điện di với dòng điện 90V trong thời gian khoảng 50 phút. Đọc kết quả: kết quả điện di được ghi nhận với thiết bị chụp ảnh gel (Vilber Loumart). Mẫu dương tính hiện vạch tương ứng 296bp (base pair - bp) và/hoặc 550bp. Mẫu âm tính hiện vạch tương ứng 848bp. 3.3.2 Qui trình PCR genotyping (ORF75) Sử dụng cặp mồi (ORF75-flank Forward và ORF75-flank Reverse) và nhiệt độ gắn mồi của Bui Thi Minh Dieu et al (2004). Trình tự của cặp mồi như sau: ORF75-flank Forward 5’- GAAGCAGTATCTCTAACAC - 3’ ORF75-flank Reverse 5’- CAACAGGTGCGTAAAAGAAG – 3’ PDF created with FinePrint pdfFactory Pro trial version 20 Qui trình thực hiện: Thành phần phản ứng: Điều kiện phản ứng: nhiệt độ 940C trong 3 phút, nhiệt độ 940C trong 30 giây, nhiệt độ 490C trong 30 giây, nhiệt độ 720C trong 60 giây, lặp lại chu kỳ này chu kỳ trên 30 lần. Cuối cùng là 720C trong 7 phút. Sau đó tiến hành tối ưu hóa các thành phần, nồng độ hóa chất phản ứng và điều kiện phản ứng. Các chỉ tiêu cần tối ưu là: hàm lượng ADN khuôn, nồng độ mồi, nồng độ MgCl2, nồng độ taq ADN polymerase, số lượng chu kỳ khuếch đại, thời gian kéo dài chuỗi. Điện di: các bước thực hiện giống như mô tả ở bước điện di của phần 3.3.1 Đọc và ghi nhận kết quả bằng máy chụp hình gel (Vilber Loumart). Hóa chất Nồng độ Thể tích 1 mẫu PCR bufer 1X 5 µl MgCl2 1,5 mM 1,5 µl dNTPs 200µM 0,5 µl ORF75- Flank Forward 20pmol 1 µl ORF75- Flank Reverse 20 pmol 1 µl Taq ADN polymerase 2,0U 0,4 µl Nước 13,6 µl ADN chiết tách 2 µl Tổng thể tích 25 µl PDF created with FinePrint pdfFactory Pro trial version 21 CHƯƠNG 4 KẾT QUẢ THẢO LUẬN 4.1. Ứng dụng qui trình PCR genotyping (ORF75) Các mẫu tôm được thu ở Cà Mau từ mô hình nuôi tôm quãng canh cải tiến, tôm được thu với nhiều kích cỡ khác nhau, kích cỡ trung bình là 15-25g/con. Sau khi được kiểm tra với bộ kit IQ2000-WSSV cường độ nhiễm WSSV của các mẫu được ghi nhận như sau: Bảng 4.1 Cường độ nhiễm WSSV của các mẫu tôm dùng trong nghiên cứu STT Mẫu phân tích Cường độ nhiễm 1 A4 + 2 A5 + 3 B2 + 4 F4 + 5 N1 +++ 6 N2 + 7 N3 +++ 8 N4 ++ 9 N5 +++ 10 S1 +++ 11 S2 +++ 12 S3 ++ 13 R1 +++ 14 R2 + 15 M8 +++ 16 M9 +++ 17 M10 +++ 18 M11 +++ 19 W1 ++ 20 W4 ++ 21 W5 + 22 T1 + 23 X1 - 24 B3 + 25 B4 + 26 B5 + PDF created with FinePrint pdfFactory Pro trial version 22 Trong đó: mẫu + : là mẫu có cường độ nhiễm nhẹ mẫu ++ : là mẫu có cường độ nhiễm trung bình mẫu + ++: là mẫu có cường độ nhiễm nặng Từ những mẫu tôm ở trên chọn 3 mẫu tôm bệnh (F4, C1, C2) có cường độ nhiễm khác nhau (cường độ nhiễm được trình bày ở bảng 4.1) thực hiện với qui trình PCR genotyping (thành phần hóa chất và chu kỳ nhiệt được nêu ở phần 3.3.2). Hình 4.1: Kết quả 3 mẫu chạy với qui trình PCR genotyping (ORF75) Giếng M: Thang ADN 1kb Giếng 2: mẫu C1 Giếng 1: mẫu C2 Giếng 3: mẫu F4 Từ kết quả trên cho thấy, qui trình PCR genotyping (ORF75) cho kết quả tốt với 3 mẫu khảo sát. Kết quả ở bước đầu khảo sát trên cho thấy khả năng ứng dụng của qui trình PCR genotyping (ORF75) là tốt. Tiếp theo tiến hành khảo sát với 10 mẫu (N1, N2, N3, N4, N5, S1, S2, S3, R1, R2) nhiễm WSSV có cường độ nhiễm khác nhau (bảng 4.1) để tiếp tục xem xét tính ứng dụng của qui trình này. 27 B6 + 28 C1 ++ 29 C2 +++ 30 C4 + 31 M2 + M 1 2 3 500 bp PDF created with FinePrint pdfFactory Pro trial version 23 Hình 4.2: Kết quả 10 mẫu chạy với qui trình PCR genotyping (ORF75) Giếng M: Thang ADN 1kb Giếng 6: Mẫu S1 Giếng 1: Mẫu N1 Giếng 7: Mẫu S2 Giếng 2: Mẫu N2 Giếng 8: Mẫu S3 Giếng 3: Mẫu N3 Giếng 9: Mẫu R1 Giếng 4: Mẫu N4 Giếng 10: Mẫu R2 Giếng 5: Mẫu N5 Từ kết quả trên cho thấy có một số mẫu có cường độ nhiễm nhẹ (+) không ra kết quả tốt. Có thể do lượng ADN của WSSV trong mẫu tôm ly trích quá thấp nên qui trình ban đầu (được nêu ở phần 3.3.2 ) không có khả năng phát hiện được. 4.2 Chu kỳ nhiệt 4.2.1 Chu kỳ phản ứng Khi ứng dụng qui trình qui trình PCR genotyping (ORF75) để phát hiện WSSV trên tôm sú thì một số mẫu có cường độ nhiễm nhẹ không ra kết quả. Có thể là do lượng WSSV quá ít, sau khi khuếch đại sản phẩm PCR tạo ra ít nên không thể phát hiện được khi điện di. Theo Nguyễn Viết Khuê (2006) từ một số lượng N ADN đích ban đầu, sau khi khuếch đại n chu kỳ, sẽ tổng hợp được N.2n bản sao. Vì vậy, để tăng sản phẩm PCR (số lượng bản sao) cho mỗi phản ứng thì tiến hành tăng chu kỳ nhiệt. Vì lý do đó, số chu kỳ được tăng lên từ 30 lần thành 35 lần (thành phần phản ứng và chu kỳ nhiệt theo phụ lục 7). Tuy nhiên, khi tăng số chu kỳ lên 35 lần những M 1 2 3 4 5 6 7 8 9 10 500bp PDF created with FinePrint pdfFactory Pro trial version 24 mẫu có cường độ nhiễm nhẹ vẫn không hiện vạch khi điện di. Vì vậy vẫn tiếp tục giữ số chu kỳ là 30 lần giống như qui trình ban đầu. 4.2.2 Nhiệt độ gắn mồi Xác định nhiệt độ gắn của mồi cũng có vai trò rất quan trọng trong phản ứng PCR. Nếu sử dụng sai nhiệt độ trong giai đoạn này dẫn đến việc đoạn mồi không gắn hoàn toàn vào ADN mẫu, hay gắn một cách tùy tiện. Theo Bui Thi Minh Dieu et al (2004) thì nhiệt độ gắn mồi được sử dụng trong phản ứng là 49oC. Vì vậy tiến hành dò tìm nhiệt độ mồi từ 49 đến 65oC (các điểm nhiệt độ dò tìm là 49oC; 51,1oC, 53oC; 55,7oC; 59,5oC; 62,3oC; 64oC; 65oC) để chọn nhiệt độ gắn mồi tối ưu nhất. Hình 4.3: Kết quả qui trình PCR genotyping (ORF75) với các nhiệt độ gắn mồi khác nhau Giếng 1: nhiệt độ gắn mồi 65oC Giếng 6: nhiệt độ gắn mồi 53oC Giếng 2: nhiệt độ gắn mồi 64oC Giếng 7: nhiệt độ gắn mồi 51,1oC Giếng 3: nhiệt độ gắn mồi 62,3oC Giếng 8: nhiệt độ gắn mồi 49oC Giếng 4: nhiệt độ gắn mồi 59,5oC Giếng M: thang ADN 100 bp Giếng 5: nhiệt độ gắn mồi 55,7oC Kết quả dò tìm nhiệt độ cho thấy ở nhiệt độ 65oC; 64oC; 62,3oC; 59,5oC; 55,7oC không ra kết quả. Có thể do nhiệt độ gắn mồi này cao hơn nhiệt độ gắn của mồi xuôi và mồi ngược nên mồi không thể gắn được vào ADN khuôn. Còn ở nhiệt độ 49oC; 51,1oC, 53oC thì cho kết quả. Độ sáng của các vạch ở nhiệt độ 51,1oC, 53oC 1 2 3 4 5 6 7 8 M 500 bp PDF created with FinePrint pdfFactory Pro trial version 25 thì tương đương như nhau. Ở nhiệt độ 49 oC thì kết quả tốt hơn ở nhiệt độ 51,1oC, 53oC. Vì vậy, nhiệt độ gắn mồi vẫn được giữ là 49oC theo như Bui Thi Minh Dieu et al ( 2004). Do đó tiếp tục tìm phương pháp khác để có thể phát hiện mẫu có cường độ nhiễm nhẹ. 4.3 Hàm lượng ADN khuôn ADN khuôn là thành phần rất quan trọng đối với qui trình PCR, nó ảnh hưởng rất lớn đến hiệu quả của phản ứng PCR. Những mẫu có cường độ nhiễm nhẹ qui trình ban đâu không thể phát hiện được có thể là do hàm lượng ADN khuôn quá thấp, khi khuếch đại sản phẩm tạo ra thấp nên khi điện di không thể phát hiện được. Theo tài liệu của Applied Biosytem và Promega hướng dẫn một trong những cách xử lý sự cố trong qui trình PCR là tăng hàm lượng ADN trong mỗi phản ứng. Việc tăng hàm lượng ADN có thể sẽ tăng sản lượng sản phẩm khuếch đại. Vì vậy, hàm lượng ADN khuôn tăng lên 4µl/phản ứng. Nhưng những mẫu có cường độ nhiễm nhẹ vẫn không ra kết quả. 4.4. Nồng độ mồi Nồng độ mồi có ảnh hưởng rất lớn đến phản ứng PCR, nó là một trong những yếu tố quyết định hiệu quả của phản ứng PCR. Để qui trình có thể phát hiện tất cả các mẫu bị nhiễm WSSV đặc biệt là những mẫu có cường độ nhiễm nhẹ thì việc thay đổi nồng độ mồi là điều cần thiết. Nồng độ mồi được khảo sát là 20, 40, 60 pmol với mẫu có cường độ nhiễm nhẹ. Kết quả từ hình 4.5 cho thấy ở nồng độ mồi là 20 pmol thì mẫu có cường độ nhiễm nhẹ không ra kết qủa. Có thể nồng độ mồi là 20 pmol thì không đủ để nó bắt cặp với ADN khuôn trong 30 chu kỳ khuếch đại. Vì vậy sản phẩm khuếch đại tạo ra ít không đủ để phát hiện khi điện di. Còn ở nồng độ 40, 60 pmol thì mẫu có cường độ nhiễm nhẹ ra kết quả tốt. Mặt dù ở 2 nông độ mồi này cho kết quả tốt nhưng khi sử dụng nồng độ mồi 40, 60 pmol/phản ứng cho những mẫu có cường độ nhiễm trung bình và nhiễm nặng thì rất hao tốn hóa chất, giá thành cho mỗi phản ứng cao. Vì vậy, tiếp tục khảo sát thêm một số chỉ tiêu khác. PDF created with FinePrint pdfFactory Pro trial version 26 Hình 4.4: Kết quả qui trình PCR genotyping (ORF75) với các nồng độ mồi Giếng 1: Nồng độ mồi 20 pmol Giếng 3: Nồng độ mồi 60 pmol Giếng 2: Nồng độ mồi 40 pmol Giếng M: Thang ADN 100 bp 4.5 Nồng độ MgCl2 MgCl2 có ảnh hưởng nhiều đến hiệu quả của phản ứng PCR vì Mg2+ tự do có khả năng kích hoạt enzyme polymerase. Nếu nồng độ Mg2+ hợp lý sẽ làm cho phản ứng PCR hiệu quả hơn (Bùi Chí Bửu và Nguyễn Thị Lang, 1999). Vì vậy thành phần tiếp theo được khảo sát là MgCl2. Nồng độ ion Mg2+ tối ưu phụ thuộc vào loại taq ADN polymerase, ADN khuôn và thành phần buffer. Nồng độ MgCl2 được dò tìm bằng cách thử với các nồng độ từ 0,5 đến 5,0 mM, các khoảng cách mỗi bước là 0,5 mM với mẫu có cường độ nhiễm trung bình. Kết quả cho thấy (hình 4.6) ở nồng độ 0,5 mM không ra kết quả. Nồng độ 1,0 mM ra kết quả không tốt. Có thể do ở nồng độ 0,5 và 1,0 mM không đủ để xúc tác phản ứng, sản phẩm PCR tạo ra ít nên không thấy được sản phẩm khuếch đại khi điện di. Còn ở nồng độ từ 1,5 đến 5,0 mM đều ra kết quả. Những mẫu có nồng độ là 1,5; 2,0 mM ra kết quả các vạch sáng tương đương nhau và không có sản phẩm phụ. Còn ở nồng độ là 2,5 mM là hiện vạch sáng nhất. Nhưng để tiết kiệm hóa chất thì chọn nồng độ MgCl2 là 1,5mM vì ở nồng độ này mẫu cũng ra kết quả tốt. Ở nồng độ 3,0; 3,5; 4,0; 4,5; 5,0 mM xuất hiện các sản phẩm phụ. 1 2 3 M 500bp PDF created with FinePrint pdfFactory Pro trial version 27 Hình 4.5 Kết quả qui trình PCR genotyping (ORF75) với các nồng độ MgCl2 Giếng 1: nồng độ MgCl2 0,5mM Giếng 6: nồng độ MgCl2 3,0mM Giếng 2: nồng độ MgCl2 1,0mM Giếng 7: nồng độ MgCl2 3,5mM Giếng 3: nồng độ MgCl2 1,5mM Giếng 8: nồng độ MgCl2 4,0mM Giếng 4: nồng độ MgCl2 2,0mM Giếng 9: nồng độ MgCl2 4,5mM Giếng M: Thang ADN 1kb Giếng 10: nồng độ MgCl2 5,0mM Giếng 5: nồng độ MgCl2 2,5mM Nhưng khi sử dụng nồng độ này để kiểm tra với mẫu có cường độ nhiễm nhẹ thì mẫu này vẫn không ra kết quả. Do đó, nồng độ MgCl2 vẫn được giữ là 1,5mM. Như vậy có thể nồng độ MgCl2 không là nguyên nhân làm cho mẫu có cường độ nhiễm nhẹ không ra kết quả. Sau khi khảo sát nồng độ MgCl2 mẫu có cường độ nhiễm nhẹ vẫn không ra kết qủa. Vì vậy, cần phải tiếp tục khảo sát các thành phần phản ứng khác để có thể phát hiện được những mẫu có cương độ nhiễm nhẹ. Trong phản ứng PCR, taq ADN polymerase là một trong những thành phần quan trọng nhất. Taq ADN polymerase càng mạnh thì phản ứng PCR càng triệt để (Khuất Hữu Thanh, 2003) Vì thế thành phần phản ứng tiếp theo được xem xét là nồng độ taq ADN polymerase. 4.6. Nồng độ taq ADN polymerase Nồng độ taq ADN polymerase được kiểm tra với nồng độ nhiều nồng độ khác nhau. Nồng độ taq ADN polymerase thay đổi từ 1- 2,5 U/ phản ứng (thành phần hóa chất được nêu ở phụ lục 2). Phản ứng được thực hiện với mẫu có cường độ nhiễm trung bình. 1 2 3 4 M 5 6 7 8 9 10 500bp PDF created with FinePrint pdfFactory Pro trial version 28 Hình 4.6: Kết quả qui trình PCR genotyping (ORF75) với các nồng độ taq ADN polymerase Giếng M: Thang ADN 100 bp Giếng 3: taq ADN polymerase 2U Giếng 1: taq ADN polymerase 1U Giếng 4: taq ADN polymerase 2,5 U Giếng 2: taq ADN polymerase 1,5U Với các nồng độ khác nhau của taq ADN polymerase thì kết quả như sau: ở nồng độ 1U hiện vạch nhạt, còn ở 3 nồng độ còn lại thì hiện vạch khá rõ. Vì vậy để tiết kiệm hóa chất và giá thành cho mỗi phản ứng thì nồng độ taq ADN polymerase được chọn là 1,5U. Tuy nhiên khi tiến hành khảo sát với một số mẫu nhiễm nhẹ thì ở nồng độ taq ADN polymerase 1,5U không ra kết quả. Do đó, nồng độ taq ADN polymerase vẫn được giữ là 2 U/phản ứng giống như qui trình ban đầu. Những mẫu có cường độ nhiễm nhẹ không ra kết quả có thể là do khi các ADN khuôn chưa tách nhau ra thì các thành phần hóa chất đã phản ứng trước. Có thể do như vậy mà làm hiệu quả phản ứng giảm. Vì vậy, cần phải tiếp tục tối ưu hóa phản ứng. 4.7 Điều kiện phản ứng Để qui trình có thể khuyếch đại được các mẫu không tạo ra sản phẩm ở các bước thử nghiệm trên. Tiến hành thực hiện với điều kiện phản ứng: máy được làm nóng lên đến 85oC và sau đó mới bắt đầu giai đoạn 94oC trong 3 phút, 94oC trong 30 M 1 2 3 4 500 bp PDF created with FinePrint pdfFactory Pro trial version 29 giây, 49oC trong 30 giây, 72oC trong 60 giây lặp lại 30 chu kỳ và cuối cùng là 72oC trong 7 phút. Và thành phần hóa chất không thay đổi so với mô tả ban đầu (phần 3.3.2) Hình 4.7: Kết quả 3 mẫu có cường độ nhiễm khác nhau đều tạo sản phẩm Giếng M: Thang ADN 100bp Giếng 2 Mẫu nhiễm trung bình Giếng 1 Mẫu nhiễm nhẹ Giếng 3 Mẫu nhiễm nặng Kết quả sau khi thực hiện thay đổi điều kiện phản ứng cho thấy với qui trình này có thể phát hiện được mẫu có cường độ nhiễm nhẹ tốt. 4.8 Ứng dụng kỹ thuật PCR genotyping sau khi đã tối ưu Sau khi tiến hành chuẩn hóa một số thành phần hóa chất và điều kiện phản ứng thì thành phần hóa chất và điều kiện phản ứng của qui trình PCR genotyping (ORF75) được chọn để ứng dụng trong nghiên cứu tác nhân gây bệnh đốm trắng trên tôm sú như sau: M 1 2 3 500 bp PDF created with FinePrint pdfFactory Pro trial version 30 Bảng 4.2 : Thành phần hóa chất được sử dụng để ứng dụng Thành phần hóa chất được sử dụng để ứng dụng chỉ khác với qui trình ban đầu ở lượng ADN chiết tách. Còn các thành phần hóa chất khác và tổng thể tích phản ứng không thay đổi so với qui trình ban đầu. Điều kiện phản ứng thì thay đổi khác so với qui trình ban đầu. Điều kiện phản ứng được thực hiện với điều kiện là: máy được làm nóng đến 85oC. Sau đó đến giai đoạn 94oC trong 3 phút, 94oC trong 30 giây, 49oC trong 30 giây, 72oC trong 60 giây lặp lại 30 chu kỳ và cuối cùng là 72oC trong 7 phút. Hóa chất Nồng độ Thể tích 1 mẫu PCR bufer 1X 5 µl MgCl2 1,5 mM 1,5 µl dNTPs 200 µM 0,5 µl ORF75- Flank Forward 20pmol 1 µl ORF75- Flank Reverse 20 pmol 1 µl Taq ADN polymerase 2,0U 0,4 µl Nước 14,6 µl ADN chiết tách 1 µl Tổng thể tích 25 µl PDF created with FinePrint pdfFactory Pro trial version 31 Qui trình trên được chạy ứng dụng với 8 mẫu có cường độ nhiễm khác nhau (được kiểm tra là dương tính bằng bộ kit IQ2000-WSSV) nhằm kiểm tra tính ứng dụng của qui trình sau khi tối ưu. Và kết quả như sau: Hình 4.8: Kết quả ứng dụng 8 mẫu nhiễm WSSV thu ở Cà Mau Giếng M Thang ADN 100bp Giếng 6 Mẫu M8 Giếng 1 Mẫu N4 Giếng 7 Mẫu M10 Giếng 2 Mẫu W1 Giếng 8 Mẫu M11 Giếng 3 Mẫu W4 Giếng 9 Đối chứng âm Giếng 4 Mẫu W5 Giếng 10 Đối chứng dương Giếng 5 Mẫu M9 Từ kết quả trên cho thấy các mẫu có kích thước sản phẩm khác nhau. Qua các mẫu khảo sát (hình 4.8) thì kích thước sản phẩm có 4 dạng, các dạng kích thước sản phẩm được xác định nằm trong các khoảng là: 400-500bp (giếng 1, 2, 3, 4), 600-700bp (giếng 10), 800-900bp (giếng 5), 900-1000bp (giếng 6, 7, 8). Vì vùng lặp lại thuộc ORF75 có 2 loại trình tự lặp lại là 45bp, 102bp cho nên không thể dùng công thức để xác định chính xác số lần lặp lại của các trình tự giống như ORF94 và ORF125. Nên chỉ xác định được các dạng của sản phẩm. Nếu muốn xác định chính xác số lần lặp lại của vùng ORF75 thì phải giải mã trình tự của nó. Do điều kiện không cho phép nên đề tài chỉ thực hiện đến đây. M 1 2 3 4 5 6 7 8 9 10 500bp PDF created with FinePrint pdfFactory Pro trial version 32 CHƯƠNG 5 KẾT LUẬN VÀ ĐỀ XUẤT 5.1 Kết luận Qui trình PCR genotyping (ORF75) sau khi tối ưu được sử dụng để ứng dụng là: — Thành phần hóa chất tham gia phản ứng là: PCR buffer nồng độ là 1X, nồng độ MgCl2 là 1,5 mM, nồng độ dNTPs là 200µM, nồng độ mồi xuôi và mồi ngược là 20 pmol, nồng độ taq ADN polymerase là 2,0 U, nồng độ ADN chiết tách 1 µl. Tổng thể tích cho mỗi phản ứng là 25 µl. — Điều kiện phản ứng được thực hiện theo chu kỳ nhiệt: máy được làm nóng đến 85oC. Sau đó đến giai đoạn 94oC trong 3 phút, 94oC trong 30 giây, 49oC trong 30 giây, 72oC trong 60 giây lặp lại 30 chu kỳ và cuối cùng là 72oC trong 7 phút. Tổng thời gian khuếch đại khoảng 1 giờ 20 phút. 5.2 Đề xuất — Ứng dụng trên các mẫu giáp xác khác (tôm càng xanh, tôm chân trắng, cua, ghẹ…) để đánh giá khả năng ứng dụng của qui trình này. — Dùng phương pháp giải mã trình tự gen để có thể xác định chính xác số lần lặp lại của vùng ORF75. PDF created with FinePrint pdfFactory Pro trial version 33 TÀI LIỆU THAM KHẢO 1) Bùi Chí Bửu, Nguyễn Thị Lang, 1999. Di truyền sinh học phân. NXB Nông nghiệp. 2) Bui Thi Minh Dieu, Hendrik Marks, Joukje Siebenga, Rob W. Goldbach, Dowe Zuidema, Tran Phuoc Duong and Just M. Vlak, 2004. Molecular epidemiology of white spot syndrome virus within Vietnam. Journal of General Virology. 85: 3607–3618. 3) Bùi Quang Tề, 2006. Bệnh học Thủy sản. Nhà xuất bản Nông Nghiệp. 439 trang. 4) Chang. P. S., C. F. Lo, Y. C. Wang and G. H. Kou. 1996. Identification of white spot syndrome associated baculovirus (WSBV) target organs in the shrimp Penaeus monodon by in situ hybridization. Diseases of Aquatic Organisms. 27: 131-139. 5) Chang P.S, L.J. Chen and Y.C Wang, 1998. The effect of ultraviolet irradiation, heat, pH, ozone, salinity and chemical disinfectants on the infectivity of white spot syndrome baculovirus. Aquaculture. 166: 1-17 6) Chou H.Y., C.Y. Huang, C.F. Lo and G.H. Kou, 1998. Studies on transmission of white spot syndrome associated baculovirus (WSBV) in Penaeus monodon and P. japonicus via waterborne contact and oral ingestion. Aquaculture. 164: 263-276 7) Durand, S., D. V. Lightner, R. M. Redman and Bonami, J. R. (1997). Ultrastructure and morphogenesis of white spot syndrome baculovirus (WSSV). Diseases of Aquatic Organisms. 29: 205-211. 8) Henegariu. O, N.A. Heerema, S.R. Dlouhy, G.H. Vance and P.H. Vogt, 1997. Multiplex PCR: Crutical Parameters and step- by- step rotocol. BioTechniques 23:504-511. 9) Hà Anh, 2007. 10) Hồ Huỳnh Thùy Dương, 1998. Giáo trình sinh học phân tử. NXB Giáo dục. 11) 37 Ngày truy cập 20/02/2009. 12) 56 Ngày truy cập 20/02/2009. 13) Ngày truy cập 20/02/2009. PDF created with FinePrint pdfFactory Pro trial version 34 14) Ngày truy cập 20/02/2009. 15) Ngày truy cập 20/02/2009. 16) Ngày truy cập 20/02/2009. 17) Ngày truy cập 20/02/2009. 18) Ngày truy cập 20/02/2009. 19) Innis MA and D.H Gelfand, 1990. Optimization of PCRs. pp. 3-12 in: PCR Protocols, Innis, Gelfand, Sninsky and White (Editors); Academic Press, New York. 20) Inouye K., K. Yamano, N. Ikeda, T. Kimura, H. Nakano, K. Momoyama, J. Kobayashi and S. Miyajima, 1996. The penaeid rod-shaped DNA virus (PRDV), which causes penaeid acute viremia. Fish Pathology. 31:39–45. 21) Jiravanichpaisal P., K.Soderhall and I.Soderhall, 2004. Effect of water temperature on the immune response and infectivity pattern of white spot syndrome virus (WSSV) in freshwater crayfish. Fish Shellfish Immunol., 17: 265-275 22) Khuất Hữu Thanh, 2003. Cơ sở di truyền phân tử và kỹ thuật gen. NXB khoa học và kỹ thuật. 23) Lê Vân Hải Yến, 2006. Khảo sát mối quan hệ giữa kiểu gen của White spot syndrome virus (WSSV) với bệnh đốm trắng trên tôm sú (Penaeus monodon) nuôi tại Sóc Trăng và Trà Vinh. Luận văn đại học. Trường Đại Học Cần Thơ. 24) Lightner D.V. (Ed.) (1996). Handbook of Pathology and Diagnostic Procedures for Diseases of Penaeid Shrimp. World Aquaculture Society, Baton Rouge, USA. 25) Lo, C. F., C. H. Ho, C. H. Chen, K. F. Liu, Y. L. Chiu, P. Y Yeh., S. E. Peng, H. C. Hsu, H. C.Liu, C. F.Chang, M. S. Su, C. H. Wang,. and G. H. Kou. 1997. Detection and tissue tropism of White spot syndrome baculovirus (WSBV) in captured brooders of Penaeus monodon with a special emphasis on reproductive organs. Diseases of Aquatic Organisms. 30: 53-72. 26) Lo C.F., C.H. Ho., S.E.Peng, C.H. Chen, H.C. Hsu, Y.L. Chiu, C.F. Chang, K.F. Liu, M.S. Su, C.H. Wang and G.H. Kou 1996. White spot syndrome PDF created with FinePrint pdfFactory Pro trial version 35 baculovirus (WSBV) detected in cultured and captured shrimps, crabs and other arthropods. Diseases of Aquatic Organisms. 27: 215-225. 27) Lo .C.F, H.C. Hsu, M.F. Tsai, C.H. Ho, S.E. Peng, G.H. Kou and D.V. Lightner, 1999. Specific genomic DNA fragment analysis of different geographical clinical samples of shrimp white spot syndrome virus. Diseases of Aquatic Organisms. 35: 175–185. 28) Lo C.F., J.H. Leu, C.H. Ho, C.H. Chen, S.E. Peng, Y.T.Chen, C.M. Chou, P.Y. Yeh, C.J. Huang, H.Y. Chou, Wang C.H. and Kou G.H. 1996. Detection of baculovirus associated with white spot syndrome virus (WSBV) in penaeid shrimps using polymerase chain reaction. Diseases of Aquatic Organisms. 25: 133-141. 29) Lotz, J. M. 1997. Viruses, Biosecurity and Specific Pathogen Free Stocks In Shrimp Aquaculture. World J Microbiol Biotechnol. 13: 405-413. 30) Lý Ngọc Hà, 2008. Tìm hiểu sự biến đổi vùng lặp lại thuộc ORF94 và ORF125 của virus gây bệnh đốm trắng (WSSV) trên tôm sú tại Bạc Liêu. Luận văn đại học. Trường đại học Cần Thơ. 31) Marks. H, 2005. Genomics and transcriptomics of White spot syndrome virus. PhD dissertation, Department of Plant Sciences, Wageningen University, The Netherlands. 32) Marks. H., Goldbach, R. W., Vlak, J. M. & van Hulten, M. C. W. 2003. Genetic variation among isolates of White spot syndrome virus. Arch Virol. 149: 673-697. 33) Marks, H., van Duijse, J. J. A., Zuidema, D., van Hulten, M. C. W. & Vlak, J. M. 2005. Fitness and virulence of an ancestral White spot syndrome virus isolate from shrimp. Virus Res, 110: 9-20. 34) Martha F. Kramer và Donald M. Coen, 2001. Enzymatic Amplification of DNA by PCR: Standard Procedures and Optimization. The Polymerase Chain Reaction. Protocols in Molecular Biology. 15.1.1-15.1.14 35) Momoyama K., M Hiraoka., H. Nakano and M.Sameshima, 1998. Cryopreservation of penaeid rod-shaped DNA virus (PRDV) and its survival in sea water at different temperatures. Fish Pathol.,33:95-96 36) Nguyễn Thanh Phương và Trần Ngọc Hải, 2004. Giáo trình kỹ thuật sản xuất giống và nuôi giáp xác. Khoa Thủy Sản, trường đại học Cần Thơ. 161 trang. 37) Nguyễn Thị Thúy Hằng, 2008. Ứng dụng kỹ thuật PCR genotyping (ORF 125) trong nghiên cứu tác nhân gây bệnh đốm trắng (White Spot Syndrome Virus – WSSV) trên tôm Sú (Penaeus monodon). Luận văn đại học. Trường Đại Học Cần Thơ. PDF created with FinePrint pdfFactory Pro trial version 36 38) Nguyễn Văn Hảo, 2004. Một số bệnh thường gặp trên tôm sú (Penaeus monodon). Các phương pháp chẩn đoán và phương pháp phòng trị. Nhà xuất bản Nông Nghiệp, Thành Phố Hồ Chí Minh, 223 trang. 39) Nguyễn Văn Thanh, 2007. Sinh học phân tử. NXB Giáo dục. 40) Nguyễn Viết Khuê, 2006. Chẩn đoán bệnh động vật thủy sản bằng phương pháp PCR. 41) Phạm Minh Đức, 2004. Tổng quan tình hình nuôi trồng thủy sản thế giới. 42) Phạm Thành Hổ, 2003. Di truyền học. Nhà xuất bản Giáo Dục. 613 trang. 43) Pradeep. B, 2007. Genotyping of white spot syndrome virus prevalent in shrimp farms of India. Diseases of Aquatic Organisms. 78:189-198 44) Quang, 2007 =viewst& sid= 160. ngày truy cập 05/11/2008. 45) Rosenberry, B. (2004). World shrimp farming 2004. In Shrimp News International. San Diego, California, USA. 46) Teunissen, O. S. P., Faber, R., Booms, G. H. R., Latscha, T. & J. H. Boon, 1998. Influence of vaccination on vibriosis resistance of the giant black tiger shrimp Penaeus monodon (Fabricius). Aquaculture 164, 359-366. 47) Thông tin chuyên đề Bộ Thủy Sản, sô 4/2003. Tình hình nuôi trồng thuỷ sản trên thế giới và các vấn đề đáng quan tâm. 48) Thông tin chuyên đề Bộ Thủy Sản số 2/2005. Phát triển nuôi tôm bền vững, hiện trạng, thách thức đối với Việt Nam. Trung tâm tin học, bộ Thủy Sản. 49) Thông tin chuyên đề Bộ Thủy Sản số 4/2005. Tình hình sản xuất và thương mại thủy sản nuôi trồng trên thế giới. Trung tâm tin học, bộ Thủy Sản. 50) Thông tin chuyên đề Bộ Thủy Sản số 3/2006. Tình hình cung cấp thủy sản của thế giới và xu hướng phát triển. Trung tâm tin học, bộ Thủy Sản. 51) Trần Thi Mỹ Duyên, 2006. Ứng dụng kỹ thuật PCR-genotyping trong nghiên cứu tác nhân gây bệnh đốm trắng (White Spot Syndrome Virus – WSSV). Luận văn đại học. Trường Đại Học Cần Thơ. 52) Trần Thị Tuyết Hoa, 2004. Bài giảng Bệnh virus động vật thủy sản. Trường Đại học Cần Thơ. 53) Trần Thị Tuyết Hoa, 2004. Bài giảng Sinh học phân tử. Trường Đại học Cần Thơ. 54) Tran Thi Tuyet Hoa, Richard Aj Hodson, Dang Thi Hoang Oanh, Nguyen Thanh Phuong, Nigel J Preston and Peter J Walker, 2005. Genotyping Virations in Tandem Repeat DNA Segements between Ribonucleotic PDF created with FinePrint pdfFactory Pro trial version 37 Reductase Subunit Genes of White Spot Syndrome Virus (WSSV) Isolates from Viet Nam. Disease in Asian Aquaculture, 13: 339- 351 55) Trần Thị Tuyết Hoa, Triệu Thanh Tuấn và Nguyễn Thanh Phương, 2008. Ứng dụng phương pháp PCR-genotyping (ORF94) trong nghiên cứu virus gây bệnh đốm trắng trên tôm sú (Penaeus monodon) Tạp chí Nghiên cứu Khoa học. 7: 163-169. 56) Van Hulten MC, J. Witteveldt., S. Peters, N. Kloosterboer and 5 others, 2001. The white spot syndrome virus DNA genome sequence. Virology 286:7–22 57) Venegas C.A., L. Nonaka, K. Mushiake, T. Nishizawa and K. Muroga, 2000 Quasi-immune response of Penaeus japonicus to penaeid rod-shaped DNA virus (PRDV). Diseases of Aquatic Organisms. 42: 83–89 58) Viện nghiên cứu nuôi trồng thủy sản 1, 2006. Chẩn đoán bệnh động vật thủy sản bằng phuương pháp PCR. 59) Wang, C. H., C. F. Lo, J. H. Leu, C. M. Chou, P. Y.Yeh, H. Y. Chou M. C. Tung, C. F. Chang, M. S. Su, and G. H. Kou. 1995. Purification and genomic analysis of baculovirus associated with White spot syndrome (WSBV) of Penaeus monodon. Diseases of Aquatic Organisms. 23: 239- 242. 60) Wongteerasupaya, C., P. Pungchai, B. Withyachumnarnkul, V. Boonsaeng, S. Panyim, T.W. Flegel,and P.J. Walker. 2003. High variation in repetitve DNA fragment length for white spot syndromevirus (WSSV) isolates in Thailand. Diseases of Aquatic Organisms 54: 253-275. 61) Wongteerasupaya, C., J. E. Vickers, S. Sriurairatana, G. L. Nash, A. Akarajamorn, V. Boonsaeng, S. Panyim, A. Tassanakajon, Withyachumnarnkul, B. and T. W. Flegel. 1995. A non-occluded, systemic baculovirus that occurs in cells of ectodermal and mesodermal origin and causes high mortality in the black tiger prawn Penaeus monodon. Diseases of Aquatic Organisms. 21, 69-77. PDF created with FinePrint pdfFactory Pro trial version 38 PHỤ LỤC Phụ lục 1: Thành phần hóa chât của phản ứng PCR genotyping (ORF75) trước khi tối ưu: Phụ lục 2: Thành phần hóa chất của phản ứng PCR genotyping (ORF75) tối ưu nồng độ taq: Hóa chất Nồng độ Thể tích 1 mẫu PCR bufer 1X 5 µl MgCl2 1,5 mM 1,5 µl dNTPs 200µM 0,5 µl ORF75- Flank Forward 20pmol 1 µl ORF75- Flank Reverse 20 pmol 1 µl Taq ADN polymerase 2,0U 0,4 µl Nước 13,6 µl ADN chiết tách 2 µl Tổng thể tích 25 µl Hóa chất Nồng độ Thể tích 1 mẫu PCR bufer 1X 5 µl MgCl2 1,5 mM 1,5 µl dNTPs 200µM 0,5 µl ORF75- Flank Forward 20pmol 1 µl ORF75- Flank Reverse 20 pmol 1 µl Taq ADN polymerase 1- 2,5 U 0,4 µl Nước ADN chiết tách 2 µl Tổng thể tích 25 µl PDF created with FinePrint pdfFactory Pro trial version 39 Phụ lục 3: Thành phần hóa chất của phản ứng PCR genotyping (ORF75) tối ưu nồng độ mồi 20 pmol. Phụ lục 4: Thành phần hóa chất của phản ứng PCR genotyping (ORF75) tối ưu nồng độ mồi 40 pmol Hóa chất Nồng độ Thể tích 1 mẫu PCR bufer 1X 5 µl MgCl2 1,5 mM 1,5 µl dNTPs 200µM 0,5 µl ORF75- Flank Forward 20pmol 1 µl ORF75- Flank Reverse 20 pmol 1 µl Taq ADN polymerase 2,0U 0,4 µl Nước 13,6 µl ADN chiết tách 2 µl Tổng thể tích 25 µl Hóa chất Nồng độ Thể tích 1 mẫu PCR bufer 1X 5 µl MgCl2 1,5 mM 1,5 µl dNTPs 200µM 0,5 µl ORF75- Flank Forward 40pmol 2µl ORF75- Flank Reverse 40 pmol 2 µl Taq ADN polymerase 2,0U 0,4 µl Nước 11,6 µl ADN chiết tách 2 µl Tổng thể tích 25 µl PDF created with FinePrint pdfFactory Pro trial version 40 Phụ lục 5: Thành phần hóa chất của phản ứng PCR genotyping (ORF75) tối ưu nồng độ mồi 60 pmol Phụ lục 6: Thành phần hóa chất của phản ứng PCR genotyping (ORF75) tối ưu nồng độ MgCl2: ( nồng độ MgCl2 được thực hiện từ 0.5- 5 mM) Hóa chất Nồng độ Thể tích 1 mẫu PCR bufer 1X 5 µl MgCl2 1,5 mM 1,5 µl dNTPs 200µM 0,5 µl ORF75- Flank Forward 60pmol 3 µl ORF75- Flank Reverse 60 pmol 3 µl Taq ADN polymerase 2,0U 0,4 µl Nước 9,6 µl ADN chiết tách 2 µl Tổng thể tích 25 µl Hóa chất Nồng độ Thể tích 1 mẫu PCR bufer 1X 5 µl MgCl2 0,5- 5 mM 1,5 µl dNTPs 200µM 0,5 µl ORF75- Flank Forward 20pmol 1 µl ORF75- Flank Reverse 20 pmol 1 µl Taq ADN polymerase 2,0U 0,4 µl Nước ADN chiết tách 2 µl Tổng thể tích 25 µl Hóa chất Nồng độ Thể tích 1 mẫu PDF created with FinePrint pdfFactory Pro trial version 41 Phụ lục 7: Thành phần hóa chất của phản ứng PCR genotyping (ORF75) tối ưu chu kỳ nhiệt Điều kiện phản ứng: Nhiệt độ 94 0C trong 3 phút, Nhiệt độ 94 0C trong 30 giây, Nhiệt độ 490C trong 30 giây, Nhiệt độ 720C trong 60 giây, lặp lại chu kỳ này chu kỳ trên 35 lần. Cuối cùng là 720C trong 7 phút. PCR bufer 1X 5 µl MgCl2 1,5 mM 1,5 µl dNTPs 200µM 0,5 µl ORF75- Flank Forward 20pmol 1 µl ORF75- Flank Reverse 20 pmol 1 µl Taq ADN polymerase 2,0U 0,4 µl Nước 13,6 µl ADN chiết tách 2 µl Tổng thể tích 25 µl PDF created with FinePrint pdfFactory Pro trial version

Các file đính kèm theo tài liệu này:

  • pdflv_dt_dieu_6492.pdf
Luận văn liên quan