Xác định các virus thuộc chi Begomovirus (họ Geminiviridae) trên cây cà chua và cây khác khu vực Hà Nội và vùng phụ cận

Dựa trên kết quả so sánh mức độ tương đồng (Bảng 10 và Bảng 12) và kết quả phân tích cây phả hệ (Hình 17, Hình 18) chúng tôi đã phát hiện một begomovirus mới. Dựa vào triệu chứng điển hình của cây nhiễm virus và địa điểm thu thập mẫu, theo hướng dẫn cách đặt tên virus thuộc họ Geminiviridae của ICTV (Fauquet & Stanley (2005)), chúng tôi đặt tên virus là tomato leaf curl Gialam virus viết tắt là (ToLCGLV).

ppt39 trang | Chia sẻ: lylyngoc | Lượt xem: 2893 | Lượt tải: 1download
Bạn đang xem trước 20 trang tài liệu Xác định các virus thuộc chi Begomovirus (họ Geminiviridae) trên cây cà chua và cây khác khu vực Hà Nội và vùng phụ cận, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG NGHIỆP HÀ NỘI KHOA CÔNG NGHỆ SINH HỌC BÁO CÁO THỰC TẬP TỐT NGHIỆP Đề tài: “Xác định các virus thuộc chi Begomovirus (họ Geminiviridae) trên cây cà chua và cây khác khu vực Hà Nội và vùng phụ cận ” ơ Giảng viên hướng dẫn: TS.Hà Viết Cường Bộ môn: Bệnh cây - khoa Nông học Sinh viên thực hiện: Lê Văn Hải Lớp: Công nghệ sinh học – khóa 50 Phần I. Mở đầu 1.1. Đặt vấn đề. Họ Geminiviridae là một trong những họ thực vật lớn nhất (289 loài). Họ virus này có 4 chi trong đó chi Begomovirus là chi quan trọng nhất về số lượng loài (185 loài) (Fauquet et al., 2008), cũng như các bệnh mà chúng gây ra trên cây trồng. Nhiều bệnh nghiêm trọng trên cây trồng được xác định là do begomovirus gây ra. Begomovirus gây bệnh tạo ra các triệu chứng giống nhau trên cây trồng, danh tính của chúng chỉ được xác định dựa trên phân tích phân tử. Begomovirus là các virus có bộ gien DNA sợi vòng đơn, kích thước khoảng 2.6 – 2.8 kb. Begomovirus có thể có bộ gien đơn (gồm một phân tử DNA-A) hoặc có bộ gen kép (gồm hai phân tử DNA-A và DNA-B). Triệu chứng của bệnh xoăn vàng lá cà chua và vector truyền bệnh Hình 1. Triệu chứng bệnh xoăn vàng lá cà chua (msucares.com) Hình 2. Vector truyền bệnh là Bọ phấn (tabaci). (www.aaas.org) Hình 3: triệu chứng do begomovirus gây ra trên một số đối tượng cây trồng và cây dại. (1) Cotton leaf curl virus (www.padil.gov.au), (2) Ludwigia yellow vein Vietnam virus & Ludwigia yellow vein; (3) African cassava mosaic virus (eastafrica.usaid.gov); (4) Siegesbeckia yellow vein Guangxi virus (www.bspp.org.uk); (5) Dolichos yellow mosaic virus (www.bspp.org.uk); (6) Okra yellow crinkle Mali virus (www.bspp.org.uk). 1 2 3 6 5 4 Hình 4. Tổ chức bộ gen phân tử DNA-A của begomovirus CR = common region DNA-A 2.6-2.8kb AC4 AC2 (TrAP) AC1 (Rep) AV1 (CP) AC3 (REn) AV2 CR Tái bản Tương tác với protein ký chủ điều khiển chu kỳ tế bào Tăng cường tái bản Tương tác với protein ký chủ điều khiển chu kỳ tế bào Hoạt hóa phiên mã Ức chế phản ứng phòng thủ của cây. Cảm ứng triệu chứng Di chuyển hệ thống Tích lũy DNA virus Cảm ứng triệu chứng Di chuyển hệ thống Vỏ protein Lan truyền qua vector Xâm nhập nhân tế bào Trên thế giới đã có 50 loài begomovirus được xác định gây hại trên cà chua. Tại Việt Nam, bệnh xoăn vàng lá được xem là bệnh virus quan trọng nhất trên cà chua. Có 3 begomovirus được phát hiện gây ra bệnh xoăn vàng lá cà chua ở Việt Nam gồm tomato yellow leaf curl Kanchanaburi virus (TYLCKaV) và 2 virus được phát hiện ở miền Bắc là tomato leaf curl Vietnam virus (ToLCVV), tomato yellow leaf curl Vietnam virus (TYLCVNV). Việt Nam dường như là trung tâm đa dạng của begomovirus. Nhưng hiện tại số lượng begomovirus phát hiện được mới 19 loài, trong đó chủ yếu là các loài cây dại. Điều đó gợi ý rằng có nhiều loài begomovirus đang gây hại trên cà chua và các cây khác của Việt nam cần phải được xác định. Chính vì vậy chúng tôi tiến hành đề tài: “Xác định các virus thuộc chi Begomovirus (họ Geminiviridae) trên cây cà chua và cây khác khu vực Hà Nội và vùng phụ cận” Claude Fauquet, 2006 Hình 6: Tám trung tâm đa dạng của geminivirus. Trung tâm Đông Nam Á là vòng tròn C (Nawaz-ul-Rehman & Fauquet, 2009). 1.2. Mục đích và yêu cầu 1.2.1. Mục đích Xác định các virus thuộc chi Begomovirus trên cây cà chua và cây khác khu vực Hà Nội và vùng phụ cận. 1.2.2. Yêu cầu Điều tra, thu mẫu và xử lý mẫu, bệnh virus với triệu chứng điển hình do nhóm begomovirus gây ra trên cây cà chua và một một số cây khác . Xác định sự có mặt của các begomovirus bằng PCR dùng mồi chung DNA-A BegoAFor1 & BegoAReV1 . Xác định thành phần loài đã tìm ra ở miền Bắc Việt Nam sử dụng hai cặp mồi đặc hiệu ToLCVV (ToLCVV-sp-F2 & ToLCVV-sp-R2) và TYLCVNV(TYLCVNV-sp-F1 & TYLCVNV-sp-R1). Xác định sự có mặt của vệ tinh DNA-β virus bằng cặp mồi đặc hiệu BetaFor2 & BetaRev2. Giải trình tự sản phẩm PCR của 1 - 2 mẫu cây cà chua. Giải trình tự sản phẩm của 1 cây khác. Phân tích trình tự có được sau giải trình tự. Phần II: Vật liệu và phương pháp nghiên cứu 2.1. Vật liệu nghiên cứu Các mẫu cà chua, các mẫu cây khác có triệu chứng nhiễm bệnh xoăn vàng lá thu thập tại khu vực Hà Nội và vùng phụ cận. Các thiết bị và hóa chất cần thiết. Sử dụng các cặp mồi đặc hiệu cho begomovirus, tomato yellow leaf curl Vietnam virus (TYLCVNV), tomato leaf curl Vietnam virus (ToLCVV) (Bảng 1). Sử dụng cặp mồi đặc hiệu DNA-β là BetaFor2 & BetaRev2. BetaFor2 : 5’ TAGCTACGCCGGAGCTTAGCTCG 3’ BetaRev2 : 5’AAGGCTGCTGCGTAGCGTAGTGG 3’ * Y (C / T), R (G / A), H (A / C / T), M (A / C), B (C / G / T), D (A / G / T), K (G / T) và i = inosine 2.2. Phương pháp nghiên cứu. Thu mẫu và xử lý mẫu. Chiết tách DNA tổng số từ mô lá cà chua bằng phương pháp NaOH (Wang et al., 1993), Phương pháp chiết dùng CTAB (Doyle & Doyle (1987)). Tiến hành kiểm tra PCR các mẫu cà chua và cây khác thu thập được, sử dụng các cặp mồi trong bảng 1, cặp mồi đặc hiệu DNA-β và điện di sản phẩm PCR. Tinh chiết sản phẩm PCR từ gel Agarose (Invitrogen) Định lượng sản phẩm tinh chiết. Giải trình tự gen. Phân tích trình tự bằng các phần mềm tin sinh học ClustalX 1.83, BioEdit 7.0.0, MEGA 4.0 và gói phần mềm thương mại DNASTAR. Phần III. Kết quả nghiên cứu 3.1. Kết quả điều tra thu mẫu 3.1.1. Kết quả điều tra bệnh trên cà chua Bảng 2: Kết quả điều tra tỉ lệ bệnh xoăn vàng lá trên cây cà chua Hình 8: triệu chứng điển hình cà chua mắc bệnh xoăn vàng lá thu thập được Cổ Bi – Gia Lâm – Hà Nội Tiên Sơn – Bắc Ninh ĐHNN HN Thanh Trì – Hà Nội Yên Mỹ - Hưng Yên Thanh Trì – Hà Nội Đa Tốn – Gia Lâm – Hà Nội 3.1.2. Kết quả thu thập và xử lý mẫu Đối với cà chua: Thu được 50 mẫu thông tin đầy đủ của các mẫu được trình bày ở (phụ lục 1). Đối với các cây khác: Thu được 64 mẫu có triệu chứng điển hình của bệnh do begomovirus gây ra. Đặc biệt chúng tôi thu được mẫu đu đủ có triệu chứng cuốn lá, cuống lá xoắn vặn. Tất cả các mẫu thu thập được đều được bảo quản cẩn thận. Các mẫu này sau đó được chiết tách DNA tổng số bằng hai phương pháp và được bảo quản ở -20o C để sử dụng cho các bước sau này. Hình 9:Triệu chứng xoăn lá trên mẫu đu đủ ((Yên Phú – Yên Mỹ - Hưng Yên(1, 2, 3)) và triệu chứng cây đu dủ nhiễm begomovirus của Trung Quốc (4) 1 3 4 2 3.2. Kết quả kiểm tra PCR các mẫu cây dại và đu đủ Sử dụng cặp mồi BegoAFor1 & BegoAReV1 để phát hiện sự có mặt của begomovirus nhiễm mẫu đu đủ và các cây dại. 1200bp M 2 3 4 Hình 10: : Kết quả điện di sản phẩm PCR của đu đủ và các mẫu cây dại thu được. M: Là thang DNA (GeneRuler 1 kb, Fermentas). 1: Đu đủ; 2: rau mương; 3: Lữ Đằng; 4: Ké hoa vàng. Các mẫu kiểm tra đều nhiễm begomovirus trong đó 3 các virus nhiễm 3 mẫu rau mương, lữ đằng, ké hoa vàng đã được phát hiện tại Việt Nam (Cuong Ha et al., 2008) Đặc biệt begomovirus nhiễm mẫu đu đủ lần đầu tiên được phát hiện ở Việt Nam sẽ được giải trình tự để làm rõ nguồn gốc phân loại virus này. 1 3.3. Kết quả kiểm tra PCR các mẫu cà chua 9 14 12 Cặp mồi chung begomovirus phát hiện cả 19 mẫu đều nhiễm begomovirus. Cặp mồi đặc hiệu ToLCVV phát hiện 10/19 mẫu nhiễm ToLCVV. Cặp mồi đặc hiệu TYLCVNV Phát hiện 8/19 nhiễm TYLCVNV. Mẫu số 12 nhiễm cả 2 virus ToLCVV và TYLCVNV. Tìm ra 2 mẫu là mẫu số 9 và mẫu số 14 Không nhiễm cả hai virus ToLCVV và TYLCVNV. Tuy nhiên danh tính của các virus này chỉ có thể được xác định dựa trên phân tích trình tự chuỗi gen của chúng. Hình 12: Kết quả điện di sản phẩm PCR của cặp mồi DNA-β. M: Maker; Giếng số 1 đến giếng số 19 tương ứng là các mẫu từ mẫu số 1 đến mẫu số 19 Phản ứng PCR sử dụng cặp mồi BetaFor2 & BetaRev2 tạo ra sản phẩm có kích thước xấp xỉ 1375 bp đối với 6/19 mẫu nhiễm begomovirus. Kết quả này khẳng định kết luận chung về vai trò của DNA-β đối với tính gây bệnh của begomovirus là hoàn toàn chính xác. 3.4. Kết quả tinh sạch sản phẩm PCR từ gel agarose Hình 13: Ước lượng hàm lượng sản phẩm PCR tinh chiết. 3 giếng maker là giếng M1: 12 µl, giếng M2: 6 µl, giếng M3: 3 µl các giếng 1, 2, 3 lần lượt là DNA của Mẫu số 9, Mẫu số 14, và Đu đủ (2 µl mỗi mẫu). Dựa vào độ sáng của băng điện di, chúng tôi ước lượng hàm lượng DNA trong mỗi mẫu khoảng 6.25 ng/µl. Hàm lượng này đủ để thực hiện phản ướng giải trình tự trực tiếp. Mẫu số 9 (Đa Tốn – Gia Lâm – Hà Nội) 5’CACAGGATTTTGGTCAGGTGTTTAACATGTATGATAACGAGCCAAGTACAGCCACAGTGAAGAACGATAACAGAGATCGCTTTCAAGTTCTACGGCGTTTTCAGGCGACTGTTACTGGTGGTCAGTATGCAAGTAAGGAGCAAGCAATAGTTAGGAAGTTTATGAAGGTGAACAACCATGTGACGTATAATCATCAAGAAGCTGCGAAGTATGACAATCACACAGAGAATGCTCTTTTGTTGTATATGGCATGTACTCATGCTAGTAATCCTGTGTATGCTACTTTGAAAATCAGAATCTATTTCTATGATTCTGTTCAGAATTAATAAAGATTGAATTTTATTATATTTGAATGTGTTACATATTCTGTCTTTTCCAATACATCCCATAATACATGATCACATGCTCTAATTACATTGTTAATACTAATTACACCCAAATTATCTAAATATTTCATACATTGAACCCTAAATACTCTTAAGAAACGCCAAGTCTGAGGACGTAAACGAGTCCAGATTTGGAATATTAGAAAACATTGGTGTATTCCCAACGCTTTCCTCAGGTTGTAATTGAATTGGACTTGTATTGTGATGATGTCGTTGTTCATCAGAAATGGTCTCTCGTCGTGGCTGATTATCTTGAAATATAGGGGATTTTTGACCGTCCAGATATATACGCCACTCTCTGCTTGAGCTGCAGTGATAGCTTCCCCTGTGCGAGAATCCATGATTGTGACAGCCTAGTGCAATGAAGTATGAACAGCCACAAGGAAGATCAACTCTCCGTCTCCTCGTTGCTTTCTTGGCGTTGCGGTGTTGC 3’ Mẫu số 14 (Yên Mỹ - Thanh Trì – Hà Nội) 5’CCCAGGATTTTGGCCAGGTGTTTAACATGTATGATAATGAGCCGAGTACAGCTACTGTGAAGAATGACAACAGGGATCGTTTTCAAGTTCTCCGCCGTTTTCAAGCCACTGTTACTGGTGGCCAGTATGCAAGTAAGGAGCAAGCAATAGTCAGGAAATTCATGAAGGTGAATAACCATGTAACTTATAACCATCAAGAGGCTGCGAAGTATGATAACCACACAGAAAATGCTTTGTTATTGTATATGGCATGTACTCATGCTAGTAATCCAGTGTATGCTACTTTGAAGATCAGGATCTATTTCTACGATTCTGTTCAGAATTAATAAAGATTAAATTTTATTATACTTGAATCTTCTGTATCAATTGTGCCTTCTAATACATTGTACAATACATGAGACATTGCTCTAATTACATTATTGATGCTAATAACTCCTAAATTGTCTAAATACTTAATACATTGATATTTAAATACTCTTAAGAAACGCGAGGTCTGAGGATGTAAACGAGTCCAAACTCGGCAGATTAGAAAACATTGGTGTATCCCCAATGCTTTCCTCAGGTTGTAATTGAATTGGACTTGTATTGTGATGATGTCGTGGTTCGTCAGAAATGGTCTCTCGTCGTGGCTGGTTATCTTGAAATATAGGGGATTTTTGACCGTCCAGATATATACGCCACTCTCTGCTTGAGCTGCAGTGATAGCTTCCCCTGTGCGAGAATCCATGATTGTGACAGCCTAGTGCAATGAAGTATGAACATCCACAAGGGAGATCAACTCTCCGTCTCCTCGTAGCTTTCTTGGCGTTGCGGTGTTGC 3’ Đu đủ (Yên Phú – Yên Mỹ - Hưng Yên) 5’CACAGGATTTTGGTCAGGTGTTTAACATGTATGATAACGAGCCAAGTACAGCCACTGTGAAGAACGACAACAGAGATCGCTTTCAAGTTCTACGGCGTTTCCAGGCGACTGTTACTGGTGGTCAGTATGCAAGTAAGGAGCAAGCAATAGTTAGGAAGTTTATGAAGGTGAACAACCATGTGACGTATAATCATCAAGAAGCTGCGAAGTATGACAATCACACAGAGAATGCTCTTTTGTTGTATATGGCATGTACTCATGCTAGTAATCCTGTGTATGCTACTTTGAAAATCAGAATCTATTTCTATGATTCTGTTCAGAATTAATAAAGATTGAATTTTATTATATTTGAATGTGTTACATATTCTGTTTTTTCCAATACATCCCATAATACATGATCACATGCTCTAATTACATTGTTAATACTAATTACACCCAAATTATCTAAATATTTCATACATTGAACCCTAAATACTCTTAAGAAACGCCAAGTCTGAGGACGTAAACGAGTCCAGATCTGGAAGATTAGAAAACATTGGTGTATTCCCAACGCTTTCCTCAGGTTGTAATTGAATTGGACTTGTATTGTGATGATGTCGTGGTTCATCAGAAATGGTCTCTCGTCGTGGTTGGTTATCTTGAAATATAGGGGATTTTTGACCGTCCAGATATATACGCCACTCTCTGCTTGAGTTGCAGTGATAGCTTCCCCTGTGCGAGAATCCATAATTGTGACAGCCTAGTGCAATGAAGTATGAACAGCCACAAGGGAGATCAACTCTCCGTCTCCTCGTTGCTTTCTTGGCGTTGCGGTGTTGC 3’ 3.5. Kết quả giải trình tự mẫu PCR Hình 14. Trình tự nucleotide của sản phẩm PCR dùng mồi BegoAFor1/BegoARev1. Đoạn ORF AC3 mã hóa protein REn được bôi đậm với vị trí khởi đầu dịch mã cũng như hướng dịch mã được chỉ bằng mũi tên vuông 3.6. Kết quả tìm kiếm các trình tự tương đồng. Bảng 4: : Kết quả tìm kiếm các trình tự tương đồng dựa trên trình tự 819 nucleotide của 3 kết quả giải trình tự. * Các điểm tìm kiếm blast (càng cao càng tương đồng), † phần trăm chiều dài đoạn chuỗi hỏi được tính điểm, ‡ mức tương đồng của chuỗi hỏi với các chuỗi trên Genbank Bảng 5: Kết quả tìm kiếm các trình tự tương đồng dựa trên trình tự của 3 gen AC3 của 3 kết quả giải trình tự * Các điểm tìm kiếm blast (càng cao càng tương đồng), † phần trăm chiều dài đoạn chuỗi hỏi được tính điểm, ‡ mức tương đồng của chuỗi hỏi với các chuỗi trên Genbank 3.7. Kết quả phân tích trình tự nucleotide Tiếp Bảng 6 Kết quả so sánh mức tương đồng của các gen AC3 Tiếp Bảng 7 Ghi chú: Số thứ tự từ 1 đến 10 ở hàng trên cùng tương ứng với số thứ tự isolate (số trong ngoặc vuông) ở cột isolate. ID là identical (giá trị tương đồng của một isolate với chính nó và luôn bằng 1). Bảng 8: Mức tương đồng nucleotide của 11 isolate PaLCuCNV (dựa trên đoạn 819 nts) 3.8. Kết quả so sánh mức tương đồng nucleotide của 11 isolate PaLCuCNV (dựa trên đoạn 819 nts) Hình 15: Cây phả hệ dựa trên phân tích đoạn 819 nts của 3 mẫu virus phân lập từ nghiên cứu này và đoạn tương ứng của 41 chuỗi virus trên GenBank. Các chuỗi được nắn bằng phần mềm Clustal X. Khoảng cách di truyền và cây phả hệ được xây dựng dùng phần mềm MEGA 4.0. Giá trị bootraps (%) với 1000 lần lặp lại được chỉ rõ ở gốc các nhánh. Thanh (bar) thể hiện khoảng cách di truyền bằng 0.05. Danh tính virus được trình bày ở Bảng 6 3.9. Kết quả xây dựng và phân tích cây phả hệ Hình 16: Cây phả hệ dựa trên phân tích trình tự nts của các gen AC3 của 3 mẫu virus phân lập từ nghiên cứu này và đoạn tương ứng của 41 chuỗi virus trên GenBank. Các chuỗi được nắn bằng phần mềm Clustal X. Khoảng cách di truyền và cây phả hệ được xây dựng dùng phần mềm MEGA 4.0. Giá trị bootraps (%) với 1000 lần lặp lại được chỉ rõ ở gốc các nhánh. Thanh (bar) thể hiện khoảng cách di truyền bằng 0.05. Danh tính virus được trình bày ở Bảng 7 Phần IV: Kết luận và kiến nghị 1. Điều tra tỉ lệ bệnh. Kết quả điều tra cho thấy cà chua nhiễm bệnh trong vụ thu đông là không cao và tại các vùng có sử dụng giống kháng có tỉ lệ bệnh thấp hơn so với vùng không sử dụng giống kháng. 2.Tính đặc hiệu của cặp mồi chung cho phân tử DNA-A của begomovirus Cặp mồi chung BegoAFor1 & BegoAReV1 đã chứng minh là có khả năng phát hiện ra begomovirus trên cây cà chua cũng như các cây khác. 3.Tính đặc hiệu của cặp mồi đặc hiệu ToLCVV và TYLCVV Cả 2 cặp mồi đặc hiệu đã chứng tỏ khả năng phát hiện và phân biệt 2 virus ToLCVV và TYLCVNV 4.1. Kết luận 4. Lần đầu tiên phát hiện được sự có mặt của Ageratum leaf curl virus (ALCV) trên cà chua tại Việt Nam. Dựa trên kết quả phân tích mức độ tương đồng và cây phả hệ chúng tôi phát hiện thấy virus nhiễm mấu số 14 có thể thuộc loài Ageratum leaf curl virus (ALCV). Tuy nhiên, kết luận này chỉ có thể được khẳng định khi giải mã đầy đủ trình tự bộ gen của virus này. 5. Đã phát một begomovirus mới trên cây cà chua và đu đủ. Dựa trên kết quả so sánh mức độ tương đồng (Bảng 10 và Bảng 12) và kết quả phân tích cây phả hệ (Hình 17, Hình 18) chúng tôi đã phát hiện một begomovirus mới. Dựa vào triệu chứng điển hình của cây nhiễm virus và địa điểm thu thập mẫu, theo hướng dẫn cách đặt tên virus thuộc họ Geminiviridae của ICTV (Fauquet & Stanley (2005)), chúng tôi đặt tên virus là tomato leaf curl Gialam virus viết tắt là (ToLCGLV). 4.2. Kiến nghị Tiếp tục giải mã toàn bộ gien của AGLV và ToLCGLV đồng thời nghiên cứu các đặc điểm sinh học như tính gây bệnh, khả năng lan truyền, phổ ký chủ cũng như điều tra để xác định mức độ phổ biến của 2 virus này. Tiếp tục điều tra, thu thập và phát hiện các begomovirus khác gây hại trên cà chua cũng như các cây trồng khác trên cả nước.

Các file đính kèm theo tài liệu này:

  • pptsinh_hoc_phan_tu_bao_cao_thuc_tap_tot_nghiep_7216.ppt
Luận văn liên quan