Chẩn đoán phân biệt các Type Prrs

Mục đích của nghiên cứu này là để phát triển tính : nhanh, chắc chắn, nhạy và đặc hiệu kiểm tra để phát hiện và phân biệt type EU và US của PRRSV trong mẫu mô và huyết thanh cũng như trong dịch nổi của tế bào nuôi cấy.tính chắc chắn trong việc phát hiện PRRSV là rất quan trọng bởi vì sự thay đổi và triệu chứng lâm sàn không đặc trưng bệnh PRRS ở heo. Hơn nữa, PRRS thường được quan tâm trong chuẩn đoán phân biệt các bệnh lây nhiễm do virus.

pdf17 trang | Chia sẻ: lylyngoc | Ngày: 05/11/2013 | Lượt xem: 1692 | Lượt tải: 3download
Bạn đang xem nội dung tài liệu Chẩn đoán phân biệt các Type Prrs, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
1 TRƯỜNG ĐẠI HỌC NÔNG LÂM TP. HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC BÀI TIỂU LUẬN MÔN CHẨN ĐOÁN BỆNH GIA SÚC, GIA CẦM BẰNG KỸ THUẬT SINH HỌC PHÂN TỬ CHỦ ĐỀ : CHẨN ĐOÁN PHÂN BIỆT CÁC TYPE PRRS Giáo viên hướng dẫn : PGS.TS Nguyễn Ngọc Hải Sinh viên thực hiện : Nguyễn Thị Thanh Nga MSSV : 06126084 Lớp : DH06SH 2 MỤC LỤC Phần I : Đặt vấn đề……………………………………………………3 Phần II : Tổng quan……………………………………………………4 II.1 : Giới thiệu về virus PRRS……………………………………..4 II.2 : Giới thiệu về phương pháp phát hiện…………………………5 II.3 : Vật liệu và phương pháp………………………………………6 3.1 : Dòng tế bào nuôi cấy và virus……………………………….6 3.2 : Thiết kế primer và probe…………………………………….6 3.3 : Ly trích RNA và các mẫu định lượng……………………….7 3.4 : RT-PCR định lượng…………………………………………7 3.5 : Tính chuyên biệt và tính nhạy của TaqMan® RT-PCR……...9 3.6 : Các yếu tố cản trở……………………………………………9 II.4 Kết quả…………………………………………………………..10 Phần III : Kết luận…………………………………………………………16 Phần IV : Tài liệu tham khảo 3 I. ĐẶT VẤN ĐỀ PRRS : hội chứng rối loạn sinh sản hô hấp trên heo (Porcine Reproductive And Respiratory Syndrome).Bệnh này xảy ra với các biểu hiện rối loạn sinh sản trên heo nái và hô hấp trên heo thịt, gây thiệt hại đáng kể cho nhà chăn nuôi. Bệnh xuất hiện đầu tiên ở Bắc mỹ vào đầu những năm 1980, sau đó bệnh xuất hiện ở Châu Âu và Châu Á.Và ở Việt Nam bệnh được phát hiện vào năm 1997 trên đàn lợn nhập từ Mỹ. Hội chứng rối loạn sinh sản hô hấp trên heo nhiều lần đã bùng phát thành dịch ở nhiều nơi trên thế giới Khi phân tích về mặt di truyền người ta xác định được các dòng virus PRRS : dòng châu Âu (chủ yếu là Lelystad) , dòng châu Mỹ (chủ yếu là VR-2332).Và trong những năm gần đây thì còn phát hiện thêm dòng virus có nguồn gốc từ Trung Quốc với mức độ gây bệnh khá nguy hiểm. Vì vậy viêc chuẩn đoán phân biệt được các type là điều rất cần thiết vì như vậy thì ta có thể áp dụng được việc sử dụng nguồn vaccine có hiệu quả, sử dụng phương pháp phòng chống bệnh thích hợp. Phát hiện kháng thể, phân lập virus trên môi trường nuôi cấy tế bào, và RT-PCR là các phương pháp phổ biến sử dụng để chuẩn đoán PRRS. Tùy thuộc vào thời gian nhiễm bệnh và mẫu thí nghiệm có sẵn mà lựa chọn phương pháp chuẩn đoán thích hợp nhất. Để chẩn đoán phân biệt được các type virus PRRS thì ta có thể dùng kỹ thuật RT- PCR , nested PCR , cắt phân đoạn đa hình (RFLP), ELISA. Với các kỹ thuật trên, kỹ thuật RT-PCR định lượng với thuốc nhuộm TaqMan được xem là thành công nhất cho việc nghiên cứu chuẩn đoán bệnh .Kỹ thuật này có thể phát hiện và cho thấy sự khác nhau của 2 dòng PRRSV EU và US. 4 II. TỔNG QUAN II.1 Giới thiệu về virus PRRS Hội chứng rối loạn sinh sản hô hấp trên heo được xác định là do 1 loại virus ARN sợi dương có vỏ envelope thuộc họ Arteriviridae. Bộ gen của virus gây hội chứng PRRS gồm có 8 khung đọc mở (ORF : Open Reading Frame ) mã hóa cho các thành phần khác nhau của virus.Tuy nhiên chỉ có 3 khung ORF có ý nghĩa quan trọng trong định danh virus đó là ORF 7, 6 và 5 quy định tổng hợp các protein tương ứng là : nucleocapsid (N) 15-kda , matrix (M) 19-kda và glycoprotein envelope (E) 25-kda. Các ORF 7 và ORF 6 có tính ổn định rất cao trong từng dòng và sự khác biệt 2 ORF này ở 2 dòng châu Âu và châu Mỹ cũng rõ rệt. Giữa các dòng virus khi xét ở mức độ nucleotide thì có sự tương đồng khoảng 55%- 80% , sự khác nhau chủ yếu về yếu tố kháng nguyên. Hình 1: Các Protein cấu trúc PRRSV 5 II.2 Giới thiệu về phương pháp phát hiện Trong các phương pháp dùng để phát hiện PRRSV thì phương pháp thành công nhất để phát hiện acid nucleic đặc trưng của PRRSV là RT-PCR (Reverse Transcription Polymerase chain reaction). Một số phương pháp RT-PCR được thiết lập để phát hiện PRRSV, nhưng có một vài trong số này không thể phân biệt được dòng virus PRRS EU và US. Và chỉ có RT-PCR định lượng là có thể phát hiện được. RT-PCR thông thường tốn thời gian hơn TaqMan® RT-PCR (định lượng) và dễ bị nhiễm DNA từ lần PCR trước.Hơn nữa, nó đòi hỏi 1 số bước trước và sau khi khuếch đại. Sự phát triển của công nghệ TaqMan là 1 sự cải tiến đáng kể trong phương pháp phát hiện bằng cách cho phép phân tích định lượng. Nguyên tắc hoạt động của TaqMan® là cắt probe (sợi đôi) được đánh dấu huỳnh quang ở đầu 5’ và chất hấp phụ huỳnh quang ở đầu 3’ nhờ hoạt động 5’- 3’ exonuclease của các Taq DNA polymerase (chịu nhiệt). Không chỉ các primer mà các probe đều có thể gắn đặc hiệu với trình tự đích, do đó, ngay cả khi sản phẩm khuếch đại không đặc hiệu được tạo ra thì sẽ không thu được tín hiệu TaqMan dương tính vì các probe không gắn vào các phân tử DNA. Khi 2 primer được chọn chỉ để khuếch đại 1 đoạn DNA ngắn có chứa probe có các vị trí gắn kết thì hiệu quả khuếch đại sẽ được nâng cao.Nhiều thí nghiệm có thể được phát triển dễ dàng bởi vì có thể đánh dấu các probe với các thuốc nhuộm huỳnh quang khác nhau. Do sự khác biệt lớn về chiều dài bước sóng để phát ra tín hiệu của thuốc nhuộm huỳnh quang VIC và FAM , Sequence Detector SDS 7700 có thể phân biệt đồng thời được các tín hiệu của probe đánh dấu VIC –FAM cùng trong 1 ống. 6 Thử nghiệm TaqMan RT- PCR định lượng để phát hiện và phân biệt dòng EU và US thì dựa vào 1 cặp mồi bổ sung cho ORF7 của cả 2 type virus và sử dụng probe nhuộm huỳnh quang đặc trưng cho từng type. Bằng cách này thì các ống phản ứng được đóng kín cho các bước sau khuếch đại và nhờ vậy khuếch đại DNA không bị nhiễm từ môi trường xung quanh. II.3 Vật liệu và phương pháp 3.1 Dòng tế bào và virus : Tế bào Marc-145 thì thích hợp cho PRRSV được sử dụng để phát triển dòng vaccine US PRRSV VR 2332 với liều 105.9 TCID50 /ml ,được phát hiện bằng miễn dịch huỳnh quang gián tiếp sử dụng hyperimmune polyclonal.Mẫu đem sử dụng là huyết thanh từ heo bị bệnh. PAM, được tập hợp từ tế bào đại thực bào túi phổi từ những lợn con có mầm bệnh đặc trưng. PAM được dùng cho việc nuôi cấy dòng EU PRRSV Lelystad M 96262 với liều 107,3 TCID50/ml. Sử dụng mẫu là mô phổi. Nếu là mẫu cơ quan (100-200 mg) thì sẽ được đồng nhất trong 1ml phosphate buffered saline (PBS), làm sạch nhờ máy ly tâm và cất giữ ở -700C trước khi đem ly trích RNA. 3.2 Thiết kế primer và probe Trình tự của dòng đầu tiên Lelystad M 96262 và ATCC VR 2332 được aligned dùng phần mềm Gene Works 2.5.1 (Oxford Molecular Group , Oxford, UK). Với sự ổn định của khung ORF 7 của bộ gen của cả 2 type virus thì mồi ngược USalignEU-R (5’ AAATGIGGCTTCTCIGGITTTT 3’) và mồi xuôi USalignEU- F (5’ TCAICTGTGCCAGITGCTGG 3’) đã được chọn và khi TaqMan® RT-PCR khuếch đại thì sẽ tạo ra các đoạn DNA có kích thước 105pb (type US) với 96 pb (type EU). Các primer và probe đặc hiệu được thiết kế bởi phần mềm Primer ExpressTM (Applied Biosystems, Foster City, USA) và được tổng hợp bởi PE Biosystem, 7 Weiterstadt, Germany (probes) và Microsynth, Balgach, Switzerland (primers). Hai probe TaqMan® được thiết kế đặc trưng cho 2 type PRRSV. Probe đặc trưng cho type EU-PRRSV :VIC–EU (5’ CCCAGCGCCAGCAACCTAGGG 3’, định hướng antisense ) được đánh dấu với VIC ở điểm cuối ở đầu 5’ và TAMRA ở điểm kết thúc của đầu 3’. Nhưng trái lại Probe đặc trưng cho type US-PRRSV : FAM–US–rev (5’TCCCGGTCCCTTGCCTCTGGA 3’, định hướng sense ), đầu 5’ được đánh dấu với FAM và ở đầu 3’ là TAMRA. 3.3 Ly trích RNA và các mẫu định lượng Mẫu RNA cho cả 2 type sẽ được chuẩn bị, sau khi ly trích RNA bằng cách sử dụng TRIZOL® Reagent (Life Technologies, Rockville, USA), phần RNA sẽ được hòa tan với dung dịch nước không chứa enzym RNAse khoảng 20μl RNA được để lạnh ở -700C và sử dụng làm mẫu định lượng. Trước mỗi lần chạy, từng 1µl được rã đông và pha loãng thành các tỷ lệ 1:10, 1:100, 1:1000 để cung cấp 4 mẫu cho 2 type virus với tỷ lệ tương ứng là 1000, 100, 10, 1 với liều TCID50 cho từng ống phản ứng riêng biệt. 3.4 RT-PCR định lượng 8 PRRSV RT-PCR thông thường thì có tên là ORF 7 RT-PCR phát hiện RNA virus của toàn bộ ORF 7 của cả 2 type PRRSV đã bị biến đổi bằng cách sử dụng ExpandTM Reverse Transcriptase (Roche Molecular Biochemicals, Rotkreuz, Switzerland) ở 420C trong 1h, tiếp theo là PCR (950C trong 1 phút, 40 chu kỳ với mỗi chu kỳ : 940C : 20s ; 600C : 20s ; 720C : 20s ) với Taq DNA polymerase ( Promega, Madison, USA ). Các phản ứng được phân tích bằng điện di với gel agarose, và kết quả là có xuất hiện 2 băng đặc trưng ở 637 bp (EU) và ở 660 bp (US). Hỗn hợp (25µl) của TaqMan® RT-PCR gồm có : 5.5 mM MgCl2 and 1 x Buffer A [bao gồm 60 nM thuốc nhuộm ROX (6-carboxy-N,N,N_,N_- tetramethylrhodamine), 50mM KCl, 0.01 mM acid ethylenediamine tetraacetic (EDTA) và 10mM Tris-HCl, pH 8,3) từ bộ Kit TaqMan® Gold RT-PCR (Applied Biosystems, Foster City, USA), 300µM dATP, dGTP, dCTP và dTTP (Promega), 400 nM cho mỗi primer, 100 nM cho mỗi probe, 0.625 units Ampli Taq GoldR DNA Polymerase (Applied Biosystems), 12.5 units MultiScribeTM Reverse Transcriptase (Applied Biosystems), và 10 units Recombinant Rnasin® (Promega). Cuối cùng là 2µl RNA đích được thêm vào hỗn hợp. Nồng độ của probe và primer được xem xét để phản ứng đạt được ngưỡng : số chu kỳ (CT) thấp nhất và tín hiệu huỳnh quang tăng lên sau các chu kỳ ( ∆Rn ). Thực hiện RT ở 480C trong 30 phút và biến tính ở 950C trong vòng 10 phút, tiếp theo là 40 chu kỳ PCR được thực hiện ( 950C trong 15s ; 600C trong 1 phút). RT và PCR được thực hiện trong cùng ống đơn với 1 Sequence Detector ABI Prism® 7700 (Applied Biosystems) không cần mở các ống giữa bước RT và PCR cũng như bước sau khuếch đại. Để ngăn chặn phản ứng bị nhiễm thì hỗn hợp TaqMan® được chuẩn bị trong tủ cấy vô trùng. Mỗi lần chạy phản ứng gồm : 4 mẫu đối chứng âm (chỉ chứa nước thay vì chứa RNA), 4 mẫu RNA của type EU PRRSV và 4 mẫu RNA của type US PRRSV 9 tương ứng là 1000, 100, 10, 1, với liều TCID50 trong từng ống riêng biệt. Những mẫu được quan tâm thì được chạy 3 lần. Khi mẫu đối chứng âm là (-) cho cả 2 type và các mẫu virus của 2 type là (+) thì kết quả dương tính của mẫu mới có ý nghĩa, và điều này có nghĩa là mẫu chưa biết đã được xác định. 3.5 Tính chuyên biệt và tính nhạy của TaqMan® RT-PCR Tính chuyên biệt của sản phẩm TaqMan được kiểm tra bằng việc giải trình tự nucleotide. Tính chuyên biệt của probe được kiểm tra bằng việc phân tích mẫu RNA của cả 2 type virus EU và US, và của mẫu mô và huyết thanh chứa số lượng RNA của PRRSV EU và US khác nhau. Ngoài ra thì các probe được kiểm tra riêng biệt bằng việc thêm 1 số lượng lớn RNA của PRRSV khác loài. Phân lập virus trên tế bào nuôi cấy, RT-PCR thông thường và TaqMan RT-PCR được so sánh về tính nhạy bằng việc kiểm tra dịch nổi tế bào nuôi cấy được pha loãng liên tục 10 lần.Các mẫu được pha loãng trước hoặc sau khi ly trích RNA. Tính nhạy cho các mẫu bệnh phẩm được nghiên cứu bằng việc phân tích dịch nổi ở độ pha loãng 10 lần được lọc từ mẫu mô được đồng nhất hay huyết thanh từ những con thú thí nghiệm bị bệnh cũng như những mẫu tại khu chăn nuôi. Những mẫu bệnh phẩm này được pha loãng liên tục trước khi ly trích RNA. 3.6 Các yếu tố cản trở Các primer và probe trong thí nghiệm mutiplex RT-PCR có thể tác động qua lại làm giảm tính nhạy của thí nghiệm. Probe được kiểm tra riêng biệt, và tính nhạy được so sánh với thử nghiệm mutiplex TaqMan. Sự tồn tại của 2 type EU và US PRRSV cùng trong một con vật là một điều cản trở cho việc phát hiện ra 2 type virus này.Điều này được tìm thấy khi thực hiện nghiên cứu là phát hiện cùng lúc 2 type virus bằng việc trộn các RNA của 2 type EU và US PRRSV vào cùng 1 ống thí nghiệm. 10 II.4. Kết quả Dữ liệu của mỗi lần chạy TaqMan được phân tích nhờ sử dụng phần mềm SDS 1.7 ( Applied Biosystem ). Kết quả của ∆Rn ,khi số chu kỳ tăng tín hiệu đặc trưng được phát ra nhờ thuốc nhuộm ( ở đầu 5’), và giá trị CT , ngưỡng chu kỳ mà tại đó tín hiệu huỳnh quang xuất hiện nghĩa là biểu thị kết quả dương tính, và được sử dụng làm đặc điểm nhận biết mẫu RNA PRRSV là (+) hay (-). Việc phân tích mẫu RNA virus của 2 type PRRSV EU và US và việc phân tích mẫu mô và huyết thanh từ những con thú thí nghiệm chứa số lượng RNA khác nhau đã chứng tỏ từng probe đặc trưng cho loài cao, chưa từng scó hiện tượng dương tính giả với RNA PRRSV khác loài, cho dù là kiểm tra ở nồng độ cao. Tính chuyên biệt của thí nghiệm được kiểm tra bằng cách kiểm tra những virus có triệu chứng lâm sàn liên quan và tất cả đều âm tính. Và những mẫu hoang dã thu thập từ những con lợn hoang dã ở Switzerland trong đợt dịch sốt ở heo ( chọn ngẫu nhiên ), những mẫu từ các đàn heo nuôi hộ gia đình ở Switzerland thì tất cả đều cho âm tính với PRRSV. Pha loãng liên tục 10 lần để phân lập US VR2332 từ vaccine PRRS MLV và EU Lelystad M 96262 được đo độ chuẩn trong thí nghiệm TaqMan. RNA virus tương ứng với liều TCID50 thì được phát hiện cho dù là mẫu đó được pha loãng trước hay sau khi ly trích RNA. Tuy nhiên, phát hiện RNA pha loãng sau khi ly trích thì có 11 độ nhạy cao hơn và số chu kỳ cần để phát hiện ( CT ) ít hơn. Chu kỳ ngưỡng ( CT ) được sử dụng như 1 đơn vị biểu thị cho số chu kỳ PCR mà tại đó tín hiệu huỳnh quang đầu tiên phát ra. Hiệu quả khuếch đại của sản phẩm phụ thuộc vào độ dốc của đường chuẩn được tạo ra dựa vào việc pha loãng mẫu liên tục 10 lần.Đường chuẩn này được thiết lập từ giá trị logarit TCID50 /tube tương ứng với mỗi nồng độ của từng mẫu với giá trị chu kỳ ngưỡng thu được. 12 Đường chuẩn trên đồ thị cho thấy độ dốc trên đường đồ thị huỳnh quang của type EU là 3,51 và của type US là 3,58. Kết quả này gần với độ dốc lý tưởng theo lý thuyết là 3,32, giá trị mà hiệu quả khuếch đại tăng gấp đôi sau mỗi chu kỳ. Giá trị CT cho việc phát hiện với liều TCID50 là 27,87 (US) và 32,36(EU) Dịch nổi của tế bào nuôi cấy chứa VR 2332 hoặc M 96262, nơi RNA được ly trích sau khi mẫu đã pha loãng 10 lần, thì hiệu quả bằng nhau khi phát hiên bằng TaqMan RT-PCR và bằng ORF 7 RT-PCR . Cả 2 phương pháp RT-PCR này thì 13 đều phát hiện ở cùng 1 liều TCID50 và có tính nhạy như nhau với phương pháp phân lập virus . So sánh việc sử dụng 2 probe TaqMan trong 2 phản ứng riêng biệt với việc kết hợp chúng trong 1 ống thi thấy tính nhạy của probe trong việc kết hợp chung thì giảm không đáng kể và mỗi liều TCID50 đều phát hiện được. 14 Khi cả 2 type cùng có mặt trong mẫu khi nghiên cứu, việc phát hiện PRRSV US , theo dõi nhờ probe được đánh dấu FAM thì tìm thấy hiệu quả và tính nhạy độc lập với sự kết hợp liều 1000 TCID50 của PRRSV EU trong ống. Trong khi đó, phát hiện PRRSV EU bằng probe được đánh dấu VIC thì tính nhạy ít hơn khi RNA PRRSV US với 1000 TCID50 trong ống đã có sự hiện diện thêm RNA PRRSV EU. Tất cả các mẫu đối chứng âm thì luôn có kết quả âm tính trong thí nghiệm TaqMan. 15 16 III. KẾT LUẬN Mục đích của nghiên cứu này là để phát triển tính : nhanh, chắc chắn, nhạy và đặc hiệu kiểm tra để phát hiện và phân biệt type EU và US của PRRSV trong mẫu mô và huyết thanh cũng như trong dịch nổi của tế bào nuôi cấy.tính chắc chắn trong việc phát hiện PRRSV là rất quan trọng bởi vì sự thay đổi và triệu chứng lâm sàn không đặc trưng bệnh PRRS ở heo. Hơn nữa, PRRS thường được quan tâm trong chuẩn đoán phân biệt các bệnh lây nhiễm do virus.Một chiến lược đã được chọn là sử dụng một cặp primer đơn có khả năng gắn kết với cả 2 type RNA của PRRSV EU và US. Ở những vùng mà chọn để thiết kế các probe và primer thì có trình tự của dòng EU và US mang tính ổn định cao.Những kết quả của các thí nghiệm đã xác nhận tính đặc trưng là tuyệt đối cho dù lượng PRRSV khác loài được thêm vào nhiều. Phương pháp TaqMan có tiến bộ hơn so với ORF 7 RT-PCR thông thường : - thời gian cần cho quá trình phát hiện ít hơn - giảm rủi ro cho việc bị nhiễm bẩn - không cần có quá trình giữa RT và PCR - không đòi hỏi các bước sau PCR - biết trước lượng mẫu cho vào - Tính nhạy và tính chuyên biệt cao hơn Thí nghiệm TaqMan thì thực hiện với thành phần phản ứng , chu kỳ và nhiệt độ đều được tiêu chuẩn hóa, cho phép phát hiện dòng EU hoang dã và dòng vaccine US rất đáng tin cậy, những kết quả so sánh này có thể được hy vọng với dòng PRRS US hoang dã. TaqMan RT-PCR có thể phát hiện được sau vài tháng nhiễm bệnh ở các cơ quan phổi hay hạch bạch huyết. RT-PCR định lượng có thể là một công cụ thành 17 công nhất cho việc chuẩn đoán bệnh trong các nghiên cứu như là theo dõi quá trình tiến triển của bệnh lây nhiễm ở thú. Ưu điểm chính của TaqMan Probe là độ đặc hiệu cao, tỷ lệ huỳnh quang phát cao, và khả năng thực hiện các phản ứng Mutiplex. Tuy nhiên có hạn chế đó là : giá thành đắt và việc thiết kế phản ứng khó khăn. IV. TÀI LIỆU THAM KHẢO : Công nghệ sinh học trong thú y, Nguyễn Ngọc Hải, Nhà xuất bản Nông nghiệp Ias.cnsh.org Real time PCR : kỹ thuật và ứng dụng (Bio-rad) www.elsevier.com/locate/jviromet Journal of Virological Methods

Các file đính kèm theo tài liệu này:

  • pdfchandoanphanbiettypeprrs_8205.pdf
Luận văn liên quan