Chẩn đoán vi khuẩn E.Coli nhóm STEC bằng kỹ thuật gen

- Do tính chất chuyên biệt rất cao của enzyme cắt nên kỹ thuật này cho phép xác định sự tương đồng hoặc khác biệt rất nhỏ giữa các dòng vi khuẩn hoặc virus. - Có thể xác định nguồn gốc căn bệnh ởcác ổ dịch không chỉ trong phạm vi một vùng mà cả toàn thế giới. - Có thể kết hợp với kỹ thuật lai trong chẩn đoán các tác nhân gây bệnh.

pdf18 trang | Chia sẻ: lylyngoc | Ngày: 05/11/2013 | Lượt xem: 3820 | Lượt tải: 10download
Bạn đang xem nội dung tài liệu Chẩn đoán vi khuẩn E.Coli nhóm STEC bằng kỹ thuật gen, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Sinh viên : Lương Thế Thịnh MSSV : 05126112 1 I. ĐẶT VẤN ĐỀ Vi sinh vật nói chung và vi khuẩn nói riêng giữ vai trò rất quan trọng trong mọi hệ sinh thái. Chúng tồn tại khắp nơi ngay cả trong cơ thể của các sinh vật khác. Đa số các loài vi khuẩn có lợi được ứng dụng trong sản xuất các chế phẩm phục vụ cho vật nuôi và con người. Một số ít lại là nguyên nhân gây bệnh. Điều này thúc đẩy các kỹ thuật chẩn đoán vi khuẩn ra đời. Thông thường trong chẩn đoán vi khuẩn thường áp dụng kỹ thuật nuôi cấy phân lập trên một số môi trường chuyên biệt và xác định vi khuẩn thông qua các phản ứng sinh hóa… Quy trình chẩn đoán xét nghiệm này có ưu điểm là đơn giản nhưng lại không đảm bảo tính chính xác của kết quả cũng như không cho thấy những mối liên hệ về mặt di truyền, sự biến chủng của vi khuẩn theo thời gian. Các kỹ thuật sinh học phân tử, kỹ thuật gen, kỹ thuật chẩn đoán dựa trên cấu trúc gen của vi khuẩn như kỹ thuật PCR, Real-time PCR, PCR-RFLP… với những ưu điểm nổi trội như nhanh, nhạy, chính xác đã thay thế rất tốt cho các phương pháp chẩn đoán cổ điển trong các trường hợp xảy ra ổ dịch, nhất là đối với các loại vi khuẩn khó nuôi cấy và chẩn đoán như vi khuẩn lao, Leptospira… hoặc những vi khuẩn gây ngộ độc thực phẩm như Salmonella, E. Coli nhóm STEC. 2 II. TỔNG QUAN II.1. Trực khuẩn Escherichia coli: Escherichia coli là một loại trực khuẩn sống thường xuyên trong ruột người và một số động vật được Eschrich phát hiện ra từ năm 1885. Chúng chiếm tới 80% vi khuẩn hiếu khí sống ở ruột. Bình thường chúng không gây bệnh, khi cơ thể suy yếu một số chủng có khả năng gây bệnh. Vi khuẩn E. Coli thuộc họ trực trùng đường ruột (Enterobacteriacae). Ở trong ruột chúng sống đối kháng với một số vi khuẩn khác như Salmonella và Shigella (Thương hàn và lỵ) nhờ có khả năng tạo ra một loại chất ức chế có tên là Colixin. Chúng còn có khả năng tổng hợp một số vitamin thuộc nhóm B, E và K. Vì thế khi không gây bệnh chúng có lợi cho đường ruột nhờ hạn chế được một số vi khuẩn gây bệnh khác, giữ thế cân bằng sinh thái trong ruột và sinh tổng hợp một sốvitamin. E. Coli được thải ra môi trường theo phân, do chiếm tới 80% vi khuẩn hiếu khí trong ruột và luôn giữ thế cân bằng sinh thái nên E. Coli được chọn làm vi sinh vật chỉ thị ô nhiễm. 3 II.1.1 Đặc điểm sinh học của E. Coli: a) Đặc điểm hình thái & cấu tạo: E. Coli có hình que, hai đầu tròn, kích thước dài ngắn khác nhau, thường từ 2 – 3 micromet x 0,5 micromet. Thường đứng riêng rẽ từng tế bào, cũng có khi ghép từng đôi một, có khi kết với nhau thành từng đám hoặc một chuỗi ngắn. Thường có tiêm mao mọc khắp bề mặt,có khả năng di động. Không có khả năng hình thành bào tử, có khả năng hình thành giáp mạc (vỏ nhày) khi gặp môi trường dinh dưỡng tốt. Nhuộm gram âm. b) Tính chất nuôi cấy: Dễ nuôi cấy, pH thích hợp 7 – 7,2, nhiệt độ thích hợp 37oC. E. Coli có phản ứng đỏ Methyl dương tính. E. Coli có khả năng sinh Indol. c) Sức đề kháng: E. Coli dễ bị tiêu diệt bởi các thuốc sát trùng thông thường, sức đề kháng yếu. E. Coli thường bị tiêu diệt ở nhiệt độ 60oC trong 30 phút. Dễ bị tiêu diệt bởi các thuốc sát trùng thông thường. 4 II.1.2 Khả năng gây bệnh: Bình thường E. Coli sống trong ruột người không gây bệnh. Khi cơ thể suy yếu một số chủng trở nên gây bệnh. E. Coli không những chỉ gây bệnh đường ruột như tiêu chảy, kiết lỵ mà còn có thể gây một số bệnh khác như viêm đường tiết niệu, viêm gan, viêm phế quản, viêm màng phổi, v…v… Độc tố của E. Coli thuộc loại nội độc tố, có khả năng chịu nhiệt. Đặc biệt có một số chủng đột biến có khả năng sinh ngoại độc tố, có khả năng tác động lên tế bào thần kinh. Cái tên EHEC được áp dụng đối với Vi khuẩn Verotoxigenic E. Coli (VTEC), có liên quan đến bệnh viêm thành ruột kết ở người. Verotoxin là độc tố của E. Coli gây chết tế bào Vero. Những độc tố này gần giống với độc tố Shiga, được tạo ra từ Shigella dysenteriae, và vì vậy chúng cũng được gọi là độc tố giống Shiga (Shiga-like toxin). Độc tố Verotoxin chứa 2 nhóm: VT-1 (Shiga-like toxin I [SLT-I]) và VT-2 (Shiga-like toxin II [SLT-II]). 5 Yếu tố độc lực của nhóm STEC bao gồm enzyme haemolysin phá hủy hồng cầu (gen Hly), yếu tố kết bám Intimin (gen eae), độc tố SLT-I hay VT1 hoặc stx1 (gen stx1), độc tố SLT-II hay VT2 hoặc stx2 (gen stx2), độc tố SLT- Iie hay VT2e hoặc stx2e (gen stx2e)… các loại độc tố của STEC có tính chất sinh học tương đối giống nhau, đều cùng có khả năng phá hủy tế bào Vero vì vậy việc phân biệt được chúng cũng không đơn giản, đòi hỏi các phương tiện chẩn đoán hiện đại: Nuôi cấy tế bào hoặc ELISA xác định độc tố stx; PCR, lai xác định gen eae, VT1, VT2…; RFLP, PFGE phân biệt kiểu gen… II.1.3 Các phương pháp chẩn đoán E. Coli: Cũng giống như vi khuẩn Salmonella, sự phân loại và chẩn đoán vi khuẩn E. Coli theo type kháng nguyên là khá phức tạp,dựa theo 3 loại kháng nguyên bề mặt chính là: Kháng nguyên thân O, kháng nguyên lông roi H và kháng nguyên capsul K. Trong phân lập vi khuẩn STEC, người ta thường sử dụng môi trường sorbito-MacConkey agar (SMAC) hoặc môi trường SMAC bổ sung cefixime và potassium tellurite (CT-SMAC). Tuy nhiên việc phân lập vi khuẩn trên 2 môi trường này cho phép phát hiện chủ yếu vi khuẩn STEC thuộc serotype O157, trong khi đó còn không ít STEC không thuộc serotype O17 và có tính chất lên men đường sorbitol rất biến đổi. Kết quả phân lập STEC trên 2 môi 6 trường SMAC và CT-SMAC chỉ phù hợp từ 30-80% kết quả chẩn đoán độc tố stx trên môi trường tế bào Vero. Xét về tính chất sinh hóa, vi khuẩn O157:H7 STEC phần lớn không sản sinh được enzyme β-D-glucuronidase, do vậy có thể dùng tính chất này để sơ bộ đánh giá sự nhiễm O157:H7 STEC. Có thể chẩn đoán E. Coli O157 bằng kỹ thuật miễn dịch huỳnh quang trực tiếp với việc sử dụng kháng thể đa dòng kháng O157 gắn fluorescein isothiocyanate với thời gian xét nghiệm chỉ cần khoảng 2 giờ. Kỹ thuật ELISA trực tiếp cũng cho phép phát hiện vi khuẩn E. Coli O157 trong mẫu với thời gian rất ngắn, chỉ trong vòng 1 giờ. Tuy cả 2 kỹ thuật: Kỹ thuật miễn dịch huỳnh quang trực tiếp và ELISA trực tiếp đều có độ nhạy tương đương với việc phân lập trên môi trường SMAC và CT-SMAC nhưng cần phải khẳng định sự hiện diện của độc tố stx trong mẫu. Điều này được thực hiện qua kỹ thuật PCR-RFLP. 7 II.2 Phương pháp: II.2.1 Nhận diện STEC (VTEC) bằng kỹ thuật PCR: a) Xử lý mẫu: Mẫu phân được lọc nước và xử lý với phosphate-buffered saline (PBS) và được kiểm tra độ loãng để đảm bảo hoạt tính của độc tố có tác dụng trên lớp đơn tế bào Vero. b) Quá trình thực hiện: ™ Primers Qua việc xác định gen độc lực của nhóm STEC (gen stx), người ta có thể nhận diện được chúng. Kỹ thuật này sử dụng 2 cặp mồi tương ứng khuyếch đại cho 2 gen VT-1 và VT-2: ) Theo báo cáo của Karam Ramotar và cộng sự năm1995: VT-1 Primer GAAGAGTCCGTGGGATTACG AGCGATGCAGCTATTAATAA VT-2 Primer TTAACCACACCCACGGCAGT GCTCTGGATGCATCTCTGGT Trong đó: VT-1 Primers dùng khuyếch đại 130 cặp Nu (Từ Nu 1191 – 1320 của gen VT-1) VT-2 Primers dùng khuyếch đại 346 cặp Nu (Từ Nu 426 – 771 của gen VT-2) 8 ) Theo báo cáo của L. Mansouri-Najand và M. Khalili năm 2007: ™ Vật liệu: Hỗn hợp thực hiện PCR chứa: - 5 μl Buffer - 50 mM KCL - 0,01 % gelatin - 10 mM Tris-HCL (pH 8.3) - 2,5 mM MgCl2 - 0,2 mM từng loại dNTP - 0,001 mM từng loại Primers - 1 μl ADN khuôn - Phản ứng PCR bắt đầu với 2.5 U Tag polymerase 9 ™ Phản ứng: - Khởi đầu là biến tính ADN ở 95oC trong 5 phút - 40 chu kì sau diễn ra với chu trình nhiệt: 94oC trong 1 phút, 55oC trong 1 phút, 72oC trong 1 phút - Chu kì cuối giữ 72 oC trong 7 phút Sản phẩm khuyếch đại từ phản ứng PCR sau đó được điện di trên gel Agarose 2% và được nhuộm với Ethidium bromide. 10 II.2.2 Ứng dụng kỹ thuật PCR-RFLP trong chẩn đoán vi khuẩn E.Coli nhóm STEC (Shiga-like toxin Escherichia coli): Sản phẩm khuếch đại của phản ứng PCR có thể được sử dụng để dùng trong kỹ thuật RFLP để xác định các chủng trong nhóm STEC. Kỹ thuật RFLP tiến hành trên cơ sở sử dụng các enzyme cắt khác nhau kết hợp với các trình tự ADN được cắt cũng khác nhau (trình tự ADN khác nhau là sản phẩm của phản ứng PCR trước đó). Kết quả là thu nhận được sản phẩm cắt khác nhau (mang tính đa hình). Và như vậy cho phép phân biệt được các cá thể với nhau. Thông thường trong kỹ thuật PCR để chẩn đoán vi khuẩn nhóm STEC người ta sử dụng các cặp mồi xác định gen stx1 và stx2, tuy nhiên để chẩn đoán một số vi khuẩn đặc biệt thuộc nhóm STEC người ta sử dụng thêm những cặp mồi cho phép xác định các gen eae, stx2e … và các biến thể của chúng. Những dịng E. Coli được tìm thấy đều tạo độc tố verotoxin (VT) hoặc Shiga-like toxin (SLT). Cĩ 3 loại riêng biệt: VT-1 (SLT-1), VT-2 (SLT-2), và Vte (là biến thể của VT-2: SLT-IIv). Dịng E. Coli O91:H21 được nghiên cứu là sản xuất ra độc tố này. Sau khi giải trình tự và dịng hĩa dịng vi khuẩn này, ta xác định được 2 gen riêng biệt mã hĩa cho 2 độc tố đặc tính tương tự như VT-2. Gen thứ nhất gọi là vtx2ha mã hĩa cho độc tố VT2v-a, gen thứ hai gọi là vtx2hb mã hĩa cho độc tố VT2v-b 11 ™ Cách thực hiện: Chẩn đốn gen tiểu phần B biến thể của Verotoxin loại 2 (VT2v-b): B1: Chọn dịng vi khuẩn trong bảng sau: 12 B2: Thực hiện phản ứng PCR như trình bày ở trên thêm một số cặp mồi: Trong đó: VT2-c & VT2-d là primers đặc trưng cho VT2 và biến thể VT2; VT2v-1 & VT2v-2 là primers đặc trưng cho biết thể VT2 B3: Sử dụng Enzyme cắt giới hạn: Đối với chủng O157 có thể dùng các RE: XbaI, AvrII, SpeI. 13 B4: Điện di: Những trình tự ADN được khuyếch đại sau phản ứng PCR sau khi được cắt bởi enzyme cắt giới hạn sẽ tạo ra nhiều trình tự ADN nhỏ đặc trưng cho từng loại và được xác định qua phương pháp điện di gel agarose 2%. RFLP của sản phẩm PCR chẩn đoán gen VT2 (stx2) (A) Dùng enzyme cắt HaeIII (B) Dùng enzyme cắt RsaI (C) Dùng enzyme cắt Nci a: Thang chuẩnI b, c, d, e, f, g: các chủng E.Coli 14 B5: Nhuộm bạc theo phương pháp của Sambrook và cộng sự thu nhận kết quả. ™ Ưu điểm của kỹ thuật PCR-RFLP: - Do tính chất chuyên biệt rất cao của enzyme cắt nên kỹ thuật này cho phép xác định sự tương đồng hoặc khác biệt rất nhỏ giữa các dòng vi khuẩn hoặc virus. - Có thể xác định nguồn gốc căn bệnh ở các ổ dịch không chỉ trong phạm vi một vùng mà cả toàn thế giới. - Có thể kết hợp với kỹ thuật lai trong chẩn đoán các tác nhân gây bệnh. ™ Khuyết điểm: - Kỹ thuật này không cho phép phân biệt các chủng vi sinh vật nếu sự biến đổi gen của chúng xảy ra ngoài vị trí cắt đặc hiệu. 15 III. KẾT LUẬN: Chẩn đoán được vi khuẩn E.Coli nhóm STEC bằng kỹ thuật PCR-RFLP thông qua gen độc tố của từng chủng. Xác định được các biến thể độc tố của vi khuẩn nhóm STEC 16 IV. TÀI LIỆU THAM KHẢO Công nghệ Sinh học trong thú y (Nguyễn Ngọc Hải) Giáo trình Vi sinh vật học môi trường (Trần Cẩm Vân) Identification of Verotoxin Type 2 Variant B Subunit gens in E.Coli by PCR and RFLP (S.D Styler và cộng sự - Tập 29, số 7) Direct Detection of Verotoxin-Producing Escherichia coli in Stool Samples by PCR (KaRam Ramotar và cộng sự – Tập 33, số 3) Typing of Bovine Attaching and Effacing Escherichia coli by Multiplex in vitro amplification of Virulence-Associated genes (Bernard China et al – Tập 62, số 9)   17 I. ĐẶT VẤN ĐỀ II. TỔNG QUAN II.1 Trực khuẩn Escherichia coli E. Coli ...................................................3 II.1.1 Đặc điểm sinh học của E. Coli.......................................................4 II.1.2 Khả năng gây bệnh ........................................................................5 II.1.3 Các phương pháp chẩn đoán E. Coli..............................................6 II.2 Phương pháp.........................................................................................7 II.2.1 Nhận diện STEC (VTEC) bằng kỹ thuật PCR...............................8 II.2.2 Ứng dụng kỹ thuật PCR-RFLP trong chẩn đoán vi khuẩn E.Coli nhóm STEC (Shiga-like toxin Escherichia coli)....................................11 III. KẾT LUẬN IV. TÀI LIỆU THAM KHẢO

Các file đính kèm theo tài liệu này:

  • pdfchan_doan_vk_e_coli_bang_ky_thuat_gen_5425.pdf