Đề tài Bước đầu nghiên cứu sử dụng vi sinh vật để sản xuất chế phẩm probiotic phòng và trị bệnh đường ruột cho heo

Từ những thực nghiệm trên, chúng tôi đã có những kết luận sau : 1. Đã phân lập và tuyển chọn được 3 chủng VK lactic, 1 chủng nấm men có những đặc tính cần thiết của một chủng probiotic : - Có khả năng sinh các chất kháng khuẩn cao. - Có hoạt tính đối kháng mạnh, phổ kháng khuẩn rộng với các VSV kiểm định (chuyên gây bệnh tiêu chảy cho heo) như E. colỉ, Salmonella choleraesuis. - Có khả năng đề kháng tốt với các chất kháng sinh (trị đường ruột) như neomicin, nalidixic axit, kanamicin, gentamicin. - Có khả năng duy trì các hoạt tính sinh học và sống sót cao sau quá trình đông khô. 2. Đã nghiên cứu các đặc điểm hình thái, sinh lý, sinh hóa và phân loại các chủng trên đến loài là : Chủng B là Lactobacillus agilis. Chủng N4 là Lactobacillus saỉivarius. Chủng L2 là Lactobacillus acidophilus. Chủng nấm men Sac. sp.02 là Sac. cerevisiae.

pdf132 trang | Chia sẻ: builinh123 | Ngày: 28/07/2018 | Lượt xem: 664 | Lượt tải: 1download
Bạn đang xem trước 20 trang tài liệu Đề tài Bước đầu nghiên cứu sử dụng vi sinh vật để sản xuất chế phẩm probiotic phòng và trị bệnh đường ruột cho heo, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
4 Hình 3.11. Khả năng đề kháng với các kháng sinh của Saccharomyces sp.02 sau đông khô sau 60 ngày (a) (b) (c) (d) Hình 3.12. Khả năng đối kháng với các VK kiểm định trước (a và c) và sau đông khô 60 ngày của Sac. cerevisiae Kiểm tra khả năng đề kháng với VK kiểm định và đề kháng với kháng sinh của Sac. cerevisiae chúng tôi thấy kết quả tƣơng tự. Với các đặc tính trên, chúng tôi có thể bƣớc đầu yên tâm khi sử dụng thử nghiệm các chế phẩm probiotic của mình trên heo con sau cai sữa. 75 3.7. Xây dựng quy trình công nghệ tạo chế phẩm probiotic Hình 3.13. Sơ đồ quy trình công nghệ tạo chế phẩm probiotic * Giải thích quy trình công nghệ sản xuất chế phẩm P-SP-01 Trƣớc hết là phân lập, tuyển chọn các chủng VK lactic, nấm men đáp ứng những yêu cầu của công nghệ tạo chế phẩm probiotic. Tiến hành nhân giống các chủng trong MT thích hợp. Khảo sát các điều kiện tối ƣu cho quá trình thu sinh khối từng chủng Xác định tỷ lệ tổ hợp giống thích hợp cho từng loại chế phẩm và kiểm tra hoạt tính enzim. Tạo các chế phẩm P-SP-01 và P-SP-02. Kiểm tra chất lƣợng chế phẩm sau quá trình bảo quản. Bƣớc đầu thử nghiệm chế phẩm P-SP-01 trên heo con sau cai sữa. 76 Hình 3.14. Chế phẩm P-SP-01 trước và sau khi đóng gói 3.8. Bƣớc đầu thử nghiệm chế phẩm P-SP-01 trên heo con sau cai sữa Mục đích thí nghiệm là nghiên cứu tác dụng của chế phẩm P-SP-01 đến việc phòng, trị bệnh tiêu chảy, hệ số chuyển hóa thức ăn và khả năng tăng trọng của heo con sau cai sữa (giai đoạn từ 28 ngày đến 56 ngày tuổi). So sánh hiệu quả của chế phẩm P-SP-01 so với hiệu quả của chế phẩm BioI (đối chứng) do Viện sinh học nhiệt đới TP. HCM sản xuất và hiện đang lƣu hành phổ biến trên thị trƣờng. 3.8.1. Tỷ lệ tiêu chảy ở heo con sau cai sữa Bổ sung và trộn đều 1g chế phẩm P-SP- 01/kg thức ăn cho heo con sau cai sữa 28 ngày tuổi. Kết quả theo dõi tỷ lệ tiêu chảy ở heo con đƣợc tính bằng số ngày heo con tiêu chảy tái phát trên tổng số ngày nuôi trong các lô thí nghiệm. Tỷ lệ tiêu chảy trung bình của 5 lô đƣợc trình bày qua bảng 3.15 và biểu đồ 3.6. 77 Bảng 3.15. Tỷ lệ tiêu chảy trên heo con sau cai sữa (%) Lô Chỉ tiêu Lô ĐC1 Lô ĐC2 Lô TN3 Lô TN4 Lô TN5 Tổng số ngày heo con bị tiêu chảy 35 27 13 19 20 Tổng số ngày nuôi của các lô thí nghiệm 224 224 224 224 224 Tỷ lệ tiêu chảy (%) 15,63 12,05 5,80 8,48 8,93 Giảm so với ĐC (%) - 22,90 62,89 45,75 42,87 Biểu đồ 3.6. Tỷ lệ tiêu chảy giữa các lô thí nghiệm * Nhận xét Kết quả khảo sát cho thấy, ở các lô thí nghiệm có bổ sung chế phẩm P-SP-01 có tỷ lệ tiêu chảy thấp hơn so với lô ĐC2 - bổ sung BioI và lô ĐC1 - không bổ sung chế phẩm. Việc sử dụng chế phẩm cho heo con có tác dụng làm giảm tỷ lệ tiêu chảy từ 42,87% - 62,89% so với lô ĐC1. Điều này chứng tỏ, P-SP-01 ngoài tác dụng cạnh tranh và đối kháng để loại trừ VK gây bệnh, còn cung cấp thêm một lƣợng VSV có lợi, giúp duy trì sự cân bằng hệ VSV đƣờng ruột, từ đó làm giảm tình trạng tiêu chảy ở heo con. Đặc biệt, ở các lô thí nghiệm 3, 4, 5, không có tỷ lệ tái phát bệnh, còn ở lô không dùng chế phẩm tỷ lệ tái phát bệnh tiêu chảy khá cao (66,66%) Kết quả khảo sát của chúng tôi phù hợp với ghi nhận của một số tác giả 78 nhƣ Trần Thị Thu Thủy (2003), khi sử dụng Organic Green để phòng bệnh tiêu chảy ở heo con cai sữa với liều 1,2 tỉ CFU/kg thức ăn liên tục trong 28 ngày, đã làm giảm 45,17% - 57,30% tỷ lệ tiêu chảy ở heo con so với lô đối chứng; Tạ Thị Vịnh và Đặng Thị Hoè (2002), sử dụng VITOM 1.1 liều 50mg/kgP, 2 ngày 1 lần trên heo con để phòng bệnh tiêu chảy, kết quả đã giảm 47,5% số heo con mắc bệnh so với lô đối chứng,... 3.8.2. Tăng trọng ở heo con sau cai sữa Kết quả khảo sát trọng lƣợng và sự tăng trọng bình quân của heo con từ 28 đến 56 ngày tuổi đƣợc trình bày qua bảng 3.16. Bảng 3.16. Tăng trọng bình quân của heo con từ 28 đến 56 ngày tuổi Lô Chỉ tiêu Lô ĐC1 Lô ĐC2 Lô TN3 Lô TN4 Lô TN5 Thời gian thí nghiệm (ngày) 28 28 28 28 28 Trọng lƣợng 28 ngày tuổi (kg/con) 6,2 7,1 9,0 5,8 5,9 Trọng lƣợng 56 ngày tuổi (kg/con) 15,3 17,9 21,9 15,3 15,8 Tăng trọng bình quân (kg/con) 9,1 10,8 12,9 9,5 9,9 Tăng trọng trung bình trong 1 ngày (g/ngày/con) 325 385,7 460,1 339,3 353,6 Biểu đồ 3.7. Tỷ lệ tiêu chảy giữa các lô thí nghiệm 79 * Nhận xét :Kết quả khảo sát cho thấy, tăng trọng bình quân ở các lô có bổ sung chế phẩm (lô 3, 4, 5, ĐC2) đều cao hơn so với lô ĐC1. Tuy nhiên, tăng trọng bình quân giữa các lô 3, 4, 5 không đều nhau. Theo Chiba (1996), trọng lƣợng heo con ở 4 tuần tuổi đƣợc xếp hạng nhƣ sau : kém khi 7,2 kg/con. Chính trọng lƣợng ban đầu không đều nhau giữa các heo con đã ảnh hƣởng đến sự không đều về khả năng chuyển hóa thức ăn và tăng trọng của heo. Vì thế mà ở lô 3, tăng trọng bình quân rất cao so với các lô 4, 5 và lô ĐC2 (12,9kg/con so với 9,lkg/con ở lô ĐC1). Nhƣ vậy, chỉ tiêu tăng trọng đạt cao nhất ở các lô có bổ sung chế phẩm. Kết quả của chúng tôi phù hợp với nghiên cứu của Trần Thị Thu Thủy (2003) và Thái Quốc Hiếu (2002). Các tác giả đều cho rằng, ở tất cả các lô có bổ sung chế phẩm sinh học cho heo con, đều cho kết quả tăng trọng cao hơn các lô đối chứng. 3.8.3. Hệ số tiêu tốn thức ăn Các ghi nhận về ảnh hƣởng của chế phẩm probiotic đến hệ số tiêu tốn thức ăn của heo con đƣợc tổng hợp trong bảng 3.17 và biểu đồ 3.8. Bảng 3.17. Hệ số tiêu tốn thức ăn trong thời gian thí nghiệm Lô Chỉ tiêu Lô ĐC1 Lô ĐC2 Lô 3 Lô 4 Lô 5 Số kg thức ăn tiêu thụ (kg/lô) 121,5 100 135 94,2 102 Tăng trọng (kg/lô) 72,7 86,1 103 76,2 79 Hệ số tiêu tốn thức ăn 1,67 1,16 1,31 1,24 1,29 80 Biểu đồ 3.8. Hệ số tiêu tốn thức ăn giữa các lô thí nghiệm * Nhận xét Kết quả khảo sát cho thấy, hệ số tiêu tốn thức ăn ở các lô có bổ sung chế phẩm P-SP- 01 (lô 3 : 1,31; lô 4 : 1,24; lô 5 : 1,29) và BioI (lô ĐC2 : 1,16), đều thấp hơn rất nhiều so với lô ĐC1 (1,67). Hệ số này gần xấp xỉ với 1,4 là giá trị của hệ số tiêu tốn thức ăn cho hiệu quả kinh tế nhất theo kinh nghiệm của các nhà chăn nuôi. Qua các kết quả trên cho thấy, khi bổ sung probiotic vào trong khẩu phần ăn, các VSV có lợi sẽ nhanh chóng phát triển, chúng kết hợp với các enzym hỗ trợ cho việc tiêu hóa thức ăn làm cho heo con ăn nhiều hơn, hấp thụ dƣỡng chất tốt hơn dẫn đến tăng trọng mau hơn và làm giảm hệ số tiêu tốn thức ăn. Kết quả nghiên cứu của chúng tôi phù hợp với nghiên cứu của Trần Thị Thu Thủy (2003) và Thái Quốc Hiếu (2002). Các tác giả đều cho rằng, ở tất cả các lô có bổ sung chế phẩm sinh học, đều có hệ số tiêu tốn thức ăn thấp hơn so với các lô đối chứng. 81 Bƣớc đầu thử nghiệm chế phẩm trên heo con sau cai sữa (28 ngày tuổi) cho thấy khả năng phòng và trị bệnh tiêu chảy cho heo của chế phẩm P-SP-01 cho kết quả khá tốt. Hiệu quả này tƣơng đƣơng với hiệu quả sử dụng chế phẩm Biol của Viện sinh học nhiệt đới TP.HCM hiện đang đƣợc lƣu hành phổ biến trên thị trƣờng. Tuy nhiên, các số liệu ghi nhận đƣợc mới chỉ là bƣớc đầu do số lƣợng heo con thử nghiệm còn hạn chế cùng với những khó khăn khi triển khai thực nghiệm trong thời kỳ dịch cúm H5N1 có nguy cơ đang bùng phát ở Việt Nam. 82 KẾT LUẬN VÀ ĐỀ NGHỊ KẾT LUẬN Từ những thực nghiệm trên, chúng tôi đã có những kết luận sau : 1. Đã phân lập và tuyển chọn đƣợc 3 chủng VK lactic, 1 chủng nấm men có những đặc tính cần thiết của một chủng probiotic : - Có khả năng sinh các chất kháng khuẩn cao. - Có hoạt tính đối kháng mạnh, phổ kháng khuẩn rộng với các VSV kiểm định (chuyên gây bệnh tiêu chảy cho heo) nhƣ E. colỉ, Salmonella choleraesuis. - Có khả năng đề kháng tốt với các chất kháng sinh (trị đƣờng ruột) nhƣ neomicin, nalidixic axit, kanamicin, gentamicin. - Có khả năng duy trì các hoạt tính sinh học và sống sót cao sau quá trình đông khô. 2. Đã nghiên cứu các đặc điểm hình thái, sinh lý, sinh hóa và phân loại các chủng trên đến loài là : Chủng B là Lactobacillus agilis. Chủng N4 là Lactobacillus saỉivarius. Chủng L2 là Lactobacillus acidophilus. Chủng nấm men Sac. sp.02 là Sac. cerevisiae. 3. Đã xác định đƣợc các điều kiện tối ƣu cho sự tạo thành sinh khối của 3 chủng VK lactic và 1 chủng nấm men. 4. Đã khảo sát và xác định đƣợc công thức tạo 2 loại chế phẩm probiotic P-SP-01 và P-SP-02. 83 5. Kiểm tra chất lƣợng chế phẩm sau quá trình bảo quản từ 1 đến 2 và 3 tháng cho thấy khả năng sống sót của các chủng khá cao, sau 3 tháng mật độ tế bào ở mức cho phép (109 CFU/g). Chất lƣợng này tƣơng đƣơng với chế phẩm BioI đang lƣu hành rộng rãi trên thị trƣờng. 6. Đã xây dựng đƣợc quy trình sản xuất chế phẩm P-SP-01 và P-SP-02 ở quy mô phòng thí nghiệm. 7. Bƣớc đầu thử nghiệm chế phẩm PSP01 trên heo con sau cai sữa, giai đoạn 28 đến 56 ngày tuổi. Kết quả thu đƣợc : Tỷ lệ tiêu chảy 7,74% ; Tỷ lệ tái phát 0%; Tăng trọng trung bình là 384,3g/ngày ; Hệ số tiêu tốn thức ăn 1,28%. So với lô sử dụng BioI, đạt chất lƣợng tốt hơn hay tƣơng đƣơng. ĐỀ NGHỊ Từ những kết quả nghiên cứu đạt đƣợc, để sớm đƣa chế phẩm vào ứng dụng thực tiễn, chúng tôi xin đề nghị một số vấn đề sau : - Tiếp tục hoàn thiện quy trình công nghệ tạo các chế phẩm probiotic trên. - Bƣớc đầu thử nghiệm chế phẩm P-SP-02 trong phòng và trị tiêu chảy cho heo con sau cai sữa làm cơ sở cho việc sản xuất và sử dụng chế phẩm quy mô đại trà. 84 TÀI LIỆU THAM KHẢO TÀI LIỆU TRONG NƢỚC 1. Kiều Hữu Ảnh (1999), Giáo trình Vi sinh vật học Công nghiệp, Nxb Khoa học và kỹ thuật, Hà Nội, tr.105 - 108. 2. Kiều Hữu Ảnh dịch (1983), Cơ sở hóa sinh của Vỉ sinh vật học Công nghiệp, Nxb Khoa học và kỹ thuật, Hà Nội. 3. Nguyễn Liêu Ba, Võ Thị Thứ, La Thị Nga, Trƣơng Ba Hùng, Nguyễn Minh Dƣơng (2003), Đặc điểm sinh học của một số chủng Bacillus và Lactobacillus có khả năng ứng dụng để xử lý môi trường nuôi tôm, cá, Hội nghị Công nghệ Sinh học toàn quốc, Hà Nội, tr. 388-391. 4. Lý Kim Bảng, Lê Thanh Bình, Tạ Kim Chỉnh (1998), ứng dụng vi khuẩn lactic trong việc bảo quản thức ăn xanh cho trâu bò, Tạp chí Khoa học kỹ thuật Nông nghiệp, tập 10, tr. 455 - 457. 5. Báo Sài gòn giải phóng (Ngày 10/12/1999), Vai trò của vi khuẩn lactic đối với cơ thể, tr. 4. 6. Lê Thanh Bình (20-26/10/1997), Vi khuẩn lactic và kỹ thuật gen, những vấn đề và triển vọng trong sản xuất thực phẩm, Unesco Worshop Hà Nội, tr. 1-11. 7. Lâm Thị Kim Châu, Văn Đức Chín, Ngô Đại Nghiệp (2004), Thực tập lớn sinh hóa, Nxb Đại học Quốc gia TP. HCM, tr. 55-69. 8. Nguyễn Thị Chính (chủ biên), Trƣơng Thị Hòa (2005), Vi sinh vật y học, Nxb Đại học Quốc gia Hà nội. 85 9. Trần Thị Dân (2004), Sinh sản heo nái và sinh lý heo con, Nxb Nông nghiệp, TP. HCM. 10. Trƣơng Văn Dung, Phạm Sỹ Lăng (chủ biên), Nguyễn Ngọc Nhiên, Lê Văn Tạo, Nguyễn Hữu Vũ (2002), Một số bệnh mới do vi khuẩn và Mycoplasma ở gia súc - gia cầm nhập nội và biện pháp phòng trị, Nxb Nông nghiệp, Hà Nội. 11. Nguyễn Lân Dũng, Nguyễn Đình Quyến, Phạm Văn Ty (1997), Vi sinh vật học, Nxb Giáo dục, Tr. 224 - 230. 12. Nguyễn Lân Dũng dịch (1980), Thực tập vi sinh vật học, Nxb Đại học và Trung học chuyên nghiệp. 13. Nguyễn Lân Dũng, Đoàn Xuân Mƣợu, Nguyễn Phùng Tiến, Đặng Đức Trạch, Phạm Văn Ty (1972, 1976, 1978), Một số phương pháp nghiên cứu vỉ sinh vật học, Tập I, II, III, Nxb Khoa học và kỹ thuật, Hà Nội. 14. Nguyễn Thành Đạt (2002), Cơ sở sinh học Vi sinh vật học, Nxb Giáo dục. 15. Đào Trọng Đạt, Phan Thanh Phƣợng, Lê Ngọc Mỹ (1995), Bệnh đường tiêu hóa ở lợn, Nxb Nông nghiệp, Hà Nội. 16. Nguyễn Văn Đức (2005), Nguồn gen giống lợn móng cái, Nxb Lao động - Xã hội. 17. Hội chăn nuôi Việt Nam (2003), Cẩm nang chăn nuôi lợn, Nxb Nông nghiệp, Hà Nội. 18. Lê Tấn Hƣng, Võ Thị Hạnh, Lê Thị Bích Phƣợng, Trƣơng Thị Hồng Vân, Võ Minh Sơn (2003), Nghiên cứu sản xuất chế phẩm probiotic BIO 86 II và kết quả thử nghiệm trên ao nuôi tôm, Hội nghị Công nghệ Sinh học toàn quốc, Hà Nội, tr. 75 - 79. 19. Đinh Duy Kháng, Nguyễn Thị Ngọc Ánh, Phan Văn Chi (1998), Sản xuất và xác định tính chất của kháng huyết thanh kháng Lactobacillus acidophilus, Tạp chí Khoa học và Công nghệ, XXXVI, 2, tr. 7 - 11. 20. Đinh Duy Kháng và cộng sự (1988), Các thông số kỹ thuật quan trọng trong qui trình sản xuất biolactovin trong thùng lên men 15l/mẻ, Tạp chí Khoa học và Công nghệ, tập 36, số 4, tr. 30 - 34. 21. Phạm Thị Ngọc Lan, Lê Thanh Bình (2003), Đặc điểm phân loại chủng Lactobacillus probiotic CH123 và CH126 phân lập từ đường ruột của gà, Hội nghị Công nghệ Sinh học toàn quốc, Hà Nội, tr. 101 - 105. 22. Phạm Sỹ Lăng, Phan Địch Lân, Trƣơng Văn Dung (2003), Bệnh phổ biến ở lợn và biện pháp phòng trị, Tập 1,2, Nxb Nông nghiệp, Hà Nội. 23. Trƣơng Lăng (2000), Hướng dẫn điều trị các bệnh lợn, Nxb Đà Nẵng. 24. Nguyễn Đức Lƣợng (1997), Công nghệ vi sinh vật, Tập 1, Trƣờng Đại học Bách khoa, tr. 192 - 201. 25. Nguyễn Đức Lƣợng (chủ biên), Phan Thị Huyền, Nguyễn Ánh Tuyết (2003), Thí nghiệm công nghệ sinh học, Tập 2, Thí nghiệm vi sinh vật học, Nxb Đại học Quốc gia TP. HCM. 26. Nguyễn Đức Lƣợng, Nguyễn Chúc, Lê Văn Việt Mần (1997), Thực tập vi sinh vật học thực phẩm, Trƣờng Đại học Kỹ thuật TP. HCM. 27. Nguyễn Hoài Nam (1986), Xác định hoạt lực khánh sinh bằng vi sinh vật, Tập 1, Nxb Khoa học và Kỹ thuật. 87 28. Lƣơng Đức Phẩm (2001), Vi sinh vật học và an toàn vệ sinh thực phẩm, Nxb Nông nghiệp, tr 86 - 87. 29. Nguyễn Nhƣ Pho, Trần Thị Thu Thủy (2003), Tác dụng của probiotic đến bệnh tiêu chảy trên heo con, Hội nghị khoa học chuyên ngành Chăn nuôi thú y, Đại học Nông lâm TP. HCM, tr. 14-20. 30. Nguyễn Hữu Phúc (1998), Các phương pháp lên men thực phẩm truyền thống ở Việt Nam và các nước trong vùng. Nxb Nông nghiệp. 31. Lê Thị Bích Phƣợng, Võ Thị Hạnh, Trƣơng Thị Hồng Vân, Lê Tấn Hƣng (2003), Khảo sát khả năng cạnh tranh và đối kháng của các vi sinh vật có trong chế phẩm BIO II với vi khuẩn gây bệnh cho tôm, Hội nghị Công nghệ Sinh học toàn quốc, Hà Nội, tr. 353-357. 32. Lƣơng đức Phẩm, 2005, Nấm men công nghiệp, Nhà xuất bản Khoa học Kỹ thuật Hà Nội, tr 226 - 247. 33. Trần Mỹ Quan, Nguyễn Thị Huyên, Phạm Thị Ánh Hồng, Nguyễn Quang Tâm (2003), Thực tập sinh hóa cơ sở, Nxb Đại học Quốc gia TP.HCM. 34. Nguyễn Quang Tâm (2003), Giáo trình kiểm nghiệm lương thực, thực phẩm, Trƣờng Đại học Khoa học Tự nhiên (Tài liệu lƣu hành nội bộ). 35. Trần Thị Thanh (2003), Công nghệ vi sinh. Nxb Giáo dục. 36. Trần Thanh Thủy (1998), Hướng dẫn thực hành Vi sinh vật học. Nxb Giáo dục. 37. Trần Linh Thƣớc (2002), Phương pháp phân tích vi sinh vật trong nước, thực phẩm, mỹ phẩm. Nxb Giáo dục. 88 38. Võ Thanh Thứ (1992), Nghiên cứu sản xuất BIOLACTOVIN để phòng và chống bệnh tiêu chảy, rối loạn tiêu hóa, bệnh hoại thư, bệnh táo bón, Tạp chí Sinh học, tập 14, số 4, tr. 45 - 46. 39. Võ Thanh Thứ (1993), Nghiên cứu bảo quản dược chủng Lactobacillus acidophilus, Tạp chí Sinh học. 40. Võ Thị Thứ, La Thị Nga, Trƣơng Ba Hùng, Nguyễn Minh Dƣơng (2003), Nghiên cứu tạo chế phẩm BIOCHE và đánh giá tác dụng của chế phẩm đến môi trường nước nuôi tôm cá, Hội nghị Công nghệ Sinh học toàn quốc, Hà Nội, tr. 119 - 122. 41. Lê Ngọc Tú, La Văn Chú, Phạm Trân Châu, Nguyễn Lân Dũng (1982), Enzym vi sinh vật. Nxb Khoa học và Kỹ thuật. 42. Trần Thị Mỹ Trang, 2006, Nghiên cứu sử dụng vi khuẩn lactic để sản xuất chế phẩm probiotic phòng và trị bệnh đƣờng ruột cho heo. Luận văn Thạc sĩ, Trƣờng ĐHSP Tp. HCM. TÀI LIỆU NƢỚC NGOÀI 43. F A. Skinner, Susan M. Passmore, R. R Davenport, 1980, Biology and activities of yeast, A subsidiary of Harcour Brace Jovanovich. 44. Gerald W. Tannock (1999), Probiotics A Critical Review, University of Otago, Dunedin, New Zealand. 45. Kirsop B. E and Doyle A (1991), Maintenance of microorganìsms and Cultured celỉs, Amanual of Laboratory Methods, London. 46. M. Garriga, M. pascual, J.M. Monfort and M. Hugas (1998), Selection of lactobacillus for chicken probiotic adjunts, J. of Appl, Microbiol, vol. 84, p. 125 - 132. 89 47. Young Ju kim, Ji Hee Kang, Ji Sunlee & Myung Suklee (2001), Study on the bacteriocin produced hy Lactobacillus sản phẩm GM 7311, Department of Microbiology college of nature Science Pukyong National University. 48. Yuan Kun Lee, Koji Nomoto, Seppo Salminen, Sherwood L. Gorbach (1999), Handbook of probiotics, John Wiley & Sons, inc. 49. Seppo Salminen (1997), Lactic acid bacteria, University of turku, Finland. 50. S. Salminen, M.A. Deighton, Y. Benno, S.L. Gorbach (1998), Lactic acid bacteria in health and disease, In lactic acid bacteria Microbiology and Funtional asspects. Marcel Delker Inc, p. 211-252. 51.Wood. B. J. B (1985), Microbiology offermented foods, vol 1, Elsevier applied science publishers, London and New yerle. 52.Wood. B. J. B and Holzapfel WH (1995), The genera of lactic acid bacteria, Blackie Ademic and professional, codon, p. 19-48. INTERNET 53. 54. 55. 56. 57. http:www.kluweronline.com/article.asp?PIPS=357672&PDE=l 58. ƣPicturesofProbiotics.htm 59. bacteria.htm i PHỤ LỤC 1. Các loại môi trƣờng nghiên cứu VK lactic *MT cacbonat - agar (MT1) : MT dùng để phân lập VK lactic gồm : Cao thịt 2g ; Tween 80 - 0,5ml; Glucose - 10g ; Cao nấm men - 10g ; Pepton - 5g ; CaCO3 - 5g ; CH3COONa - 2g ; Dung dịch muối (*) -0,5ml; Thạch - 20g ; Nƣớc cất - 1000ml; pH = 6,8 ; Thanh trùng ở 1210C/20 phút. (*) Dung dịch muối: MgSO4. 7H2O3 - 4g ; NaCl - 0,2g; MnSO3. 4H20 - 2g; FeSO4 . 7H2O - 0,2g ; Nƣớc cất - l00ml; *Môi Trường MRS (MT2) : Dùng để nuôi cấy, giữ giống và nghiên cứu các đặc điểm sinh lý sinh hóa gồm : Cao thịt - 10g ; Cao nấm men - 5g; Pepton - l0g; Glucose - 20g; K2 HPO4- 2g; CH3COONa - 5g; MnSO4 - 0,05g; MgSO4 . 7H2O - 0,2g; (NH4)3 C6H3O7 .2g; Tween 80 - 1 ml; Thạch - 20g; Nƣớc cất - l000ml; pH = 6,5 ± 0,2; Thanh trùng ở 1210C/20 phút. * Môi Trường MPA (Meat extract - Pepton Agar) (MT3) : Dùng để nuôi cấy một số chủng VSV kiểm định, gồm : Cao thịt - 3g ; NaCl - 5g; Pepton - 10g; Thạch - 20g; Nƣớc cất -1000ml; Thanh trùng ở 1210C/20 phút. ii * MT nước chiết giá đậu (MT4) : Nƣớc chiết giá đậu - 50% thể tích MT; Pepton - 20g ; Saccharose - 20g; K2HPO4 - 0,2g ; MgS04.7H20 - 0,58g ; MnSO4.4H2O - 2g ; Nƣớc cất đủ - l000ml; Thanh trùng ở 1210C/20 phút; Dùng 300g giá đậu đun sôi với 1 lít nƣớc cất trong 30 phút, lọc lấy nƣớc trong. * MT nước chiết cà chua (MT5) : Nƣớc cà chua - 400ml ; Glucose - 10g ; Cao nấm men - 10g ; Dung dịch A - 5ml; Dung dịch B - 5ml; Bổ sung nƣớc cất cho đủ 1000 ml; Thanh trùng ở 1210C/20 phút; MgSO4 Dung dịch A : K2HPO4 (2,5g), KH2PO4 (2,5g), H2O (250ml). Dung dịch B. 7H2O (10g), NaCl (5g), FeSO4.7H2O (5g), MnSO4. 4H2O (5g), H2O (250ml). Dùng 0,5kg cà chua thái nhỏ đun sôi với 0,5 lít nƣớc/60 phút, lọc lấy nƣớc trong. * MT có chất tăng trưởng (MT6) : Glucose - 20g ; Pepton - 10g ; Chất tăng trƣởng (Vitamin nhóm B : gồm B2, B3, B6) ; (NH4)2SO- lg ; KH2PO4 - l,5g ; K2HPO4 - 4g ; Nƣớc cất - l000ml; pH =7; Hấp 1atm/ 20 phút. * MT không có chất tăng trưởng (MT7) : Glucose - 20g ; Pepton - 10g ; (NH4)2SO4 - lg ; KH2PO4 - l,5g ; K2HPO4 - 4g ; Nƣớc cất - l000ml; pH = 7 ; Hấp 1 atm/ 20 phút. iii * MT thử hoạt tính protease (MT8) : Glucose - 0,05g; Nƣớc chiết thịt - 5ml; Gelatin - l0g; Pepton - 0,lg; KH2PO4 - l,5g; K2HP04 - l,5g; NaCl - 3g; Agar - 20g; Nƣớc cất - 1000ml. Hấp 1 atm/ 20 phút. * MT thử khả năng di động của VK lactic (MT9) : Cao thịt - 5g ; Pepton - 5g ; Glucose - 5g ; Dịch tự phân nấm men - 5% thể tích ; Tween 80 - 0,5ml ; MnS04.4H20 - 0,lg ; Kali citrat - lg ; Bromocresol tía 1,6% - 2,8ml ; Agar - 15g ; Nƣớc cất - l000ml ; pH - 6,5 Thanh trùng ở 1210 C/20 phút. 2. Các loại môi trƣờng nghiên cứu nấm men * Môi trƣờng 1: Môi trƣờng cao malt (môi trƣờng hoạt hóa): Cao malt 20g Pepton 5g Nƣớc cất 1000ml Hấp khử trùng ở 1,5 atm trong 15 phút. * Môi trƣờng 2: Môi trƣờng Hansen agar và dịch thể : Glucose, đƣờng kính 50g Pepton 10g KH2PO4 3g MgSO4 3g Agar 16g Nƣớc cất 1000ml Hấp khử trùng ở 1,5 atm trong 15 phút. iv * Môi trường 3: Môi trƣờng cao nấm men : Cao nấm men 1g Glucose 50g Pepton 10g KH2PO4 3g Nƣớc cất 1000ml Hấp khử trùng ở 1,5 atm trong 15 phút. * Môi trường 4: Môi trƣờng dịch chiết nấm men : Pepton 10g Dịch chiết nấm men 50g Glucose 20g Nƣớc cất 1000ml Hấp khử trùng ở 1,5 atm trong 15 phút. * Môi trường 5: Môi trƣờng khoai tây - đƣờng - cám : Khoai tây 300g Cám 100g Đƣờng kính 50g Nƣớc l000ml Khoai tây 0 5 kg cắt vỏ, thái nhƣ hạt lựu, lọc, đun cùng 500ml nƣớc cất. Cám 200g cho vào 500ml nƣớc đun nhỏ lửa, lọc. Hấp khử trùng ở 1,5 atm trong 15 phút. v * Môi trường 6: Môi trƣờng cao malt: Cao malt 3g Cao nấm men 3g Pepton 5g Glucose 10g Nƣớc 1000ml Hấp khử trùng ở 1,5 atm trong 15 phút. * Môi trưởng 7: Môi trƣờng bảo vệ nấm men khi đông khô : Sữa gầy 10% Natri Glutamat 1% Nƣớc cất 1000ml results of BLAST Strain Sb Chủng Sb GCATATCAATTAAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACG GCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGA GTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGA ACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTG TAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAG TGGGTGG TAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAAC AAGTACA GTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAA TTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCC TTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAG GATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAAT ACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATG GTTATATGCCGCCCGCT BLASTN 2.2.10 [Oct-19-2004] Reference: Altschul, stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997) "Gapped BLAST and PSI-BLAST: a new generation of protein đatabasp search programs", Nucleic Acids Res. 25:3389-3402. RID: 1099371195-1171-1330817 4 32.BLASTQ4 Query= (603 letters) Database: All GenBank + EMBL + DDBJ + PDB sequences (but no EST, STS, GSS, environmental samples or phase 0, 1 or 2 HTGS sequences) 2,671,199 sequences; 12,095,686,587 total letters If you have any problems or questions with the results of this search please refer to the BLAST FAQS Taxonomy reports Distribution of 101 Blast Hits on the Query Sequencc Mouse-over to show defline and scores. Click to show alignments Sequences producing significant alignments: Score (bits) E Value gi |1360587|emb|z73326.1| SCYLR154C s.cerevisiae chromosome X... 1170 0.0 gi |1262303 |gb|053879.1 | YSCL9634 Saccharomyces cerevisiae ch... 1170 0.0 gi |48596767|emb|AJ746340.1| Saccharomyces cerevisiae 26S rR... 1170 0.0 gi |46242015 |gb| Ay529515.1| Saccharomyces cerevisiae isolate... 1160 0.0 gi |172409|qb|J01355.1|YSCRGIH5 Saccharomyces cerevisiae 25S.. 1146 0.0 gi |31746929|qb|AY048154.1| Saccharomyces cerevisiae NRRL Y-.. 1140 0.0 gi |31747002|gb|AY130346.1| Saccharomyces cerevisiae NRRL Y-. 1134 0.0 gi |31747001|qb|AY130345.1| Saccharomyces cerevisiae NRRL Y-.. 1134 0.0 gi |31747000|gb|ÁY130344.1| Saccharomyces cerevisiae NRRL Y-.. 1134 0.0 gi |31746999|qb|AY130343.1| Saccharomyces cerevisiae NRRL Y- 1134 0.0 gi |14150788|gb|AF374615_.1| Saccharomyces cerevisiae 26S rib.. 1134 0.0 gi |32127530|emb|AJ508593.1| SCA508593 Saccharomyces Dastoria.. 1134 0.0 gi |32127528|emb|AJ508591.1|SEA508591 Saccharomyces sp. CBS .. 1134 0.0 gi |32127518|emb|AJ508581.1|CRO508581 Saccharomyces cerevisi . . 1134 0.0 gi |33327422|gb|AF528077.1| Saccharomyces cerevisiae strain .. 1134 0.0 gi |33327420|gb|AF528075.1| Saccharomyces cerevisiae strain .. 1134 0.0 gi |33327419|gb|AF528074.1| Saccharomyces cerevisiae strain .. 1134 0.0 gi |33327418|gb|AF528073.1| Saccharomyces cerevisiae strain .. 1134 0.0 gi |33327417|gb|AF528072.1| Saccharomyces cerevisiae strain .. 1134 0.0 gi |33327416|gb|AF528071.1| Saccharomyces cerevisiae strain .. 1134 0.0 gi |33327415|gb|AF528070.1| Saccharomyces cerevisiae strain .. 1134 0.0 gi |33318414|gb|AF528067.1| Saccharomyces cerevisiae strain .. 1134 0.0 gi |10717178|gb|AY007889.1| Saccharomyces cerevisiae 26S rib 1134 0.0 gi |3327421|gb|AF528076.1| Saccharomyces cerevisiae strain .. 1134 0.0 gi |46242017|gb|AY529517.1| Saccharomyces cerevisiae isolate.. 1126 0.0 gi |42661532|emb|AJ544259.1| Saccharomyces cerevisiae.. 1114 0.0 Saccharomyces kudriavzevii Saccharomyces cariocanus Saccharomyces cerevisiae Sb Zygosaccharomyces microellipso Saccharomyces servazzii Saccharomyces kluyveri Saccharomyces kunashirensis Saccharomyces mikatae Saccharomyces uvarum Saccharomyces pastorianus Saccharomyces bayanus XÁC NHẬN CỦA THỦ TRƢỞNG CƠ QUAN CHỦ NHIỆM ĐỀ TÀI TS. Dƣơng Thị Bạch Tuyết TS. Trần Thanh Thúy Mẫu 01 1 BỘ GIÁO DỤC VÀ ĐÀO TẠO THUYẾT MINH ĐỀ TÀI NGHIÊN CỨU KHOA HỌC VÀ CÔNG NGHỆ CẤP CƠ SỠ Mtd.doc Mẫu 01 2 9. ĐƠN VỊ PHỐI HỢP CHÍNH Tên đơn vị trong và ngoài nƣớc Nội dung phối hợp Họ và tên ngƣời đại diện 10. KẾT QUẢ NGHIÊN CỨU VÀ SẢN PHẨM TRONG, NGOÀI NƢỚC LIÊN QUAN TRỰC TIẾP ĐẾN ĐỂ TÀI (Ghi cụ thể một số bài báo, tài liệu, nghiên cứu triển khai....trong 5 năm gần đây) Mtd.doc 2 12. MỤC TIÊU ĐỀ TÀI 13. TÓM TẮT NỘI DUNG CỦA ĐỀ TÀI VÃ TIẾN ĐỘ THỤC HIỆN (ghi cụ thể) Nội dung Thời gian thực hiện Dự kiến kết quả 14. DỰ KIẾN SẢN PHẨM VÀ ĐỊA CHÍ ỨNG DỤNG • Loại sản phẩm: • Tên sản phẩm (ghi cụ thể): • Đìa chỉ có thế ứng dụng (ghi cụ thể) Mtd.doc 3 15. KINH PHÍ THỰC HIỆN ĐỀ TÀI Tổng kinh phí: Trong đó: Kinh phí sự nghiệp khoa học công nghệ: Các nguồn kinh phí khác: Nhu cầu kinh phí từng năm: - Năm - Năm Dự trù kinh phí treo các mục : Mtd.doc BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC SƢ PHẠM TP. HỒ CHÍ MINH KHOA SINH HỌC ----------------------- BÁO CÁO TÓM TẮT ĐỀ TÀI NGHIÊN CỨU KHOA HỌC CẤP CƠ SỞ ĐỂ TÀI: BƢỚC ĐẦU NGHIÊN CỨU SỬ DỤNG VI SINH VẬT ĐỂ SẢN XUẤT CHẾ PHẨM PROBIOTIC PHÒNG VÀ TRỊ BỆNH ĐƢỜNG RUỘT CHO HEO MÃ SỐ CS. 2005.23.92 CHỦ NHIỆM ĐỀ TÀI TS. Trần Thanh Thủy TP. HỒ CHÍ MINH - 2006 1 MỞ ĐẦU Đã từ lâu, VK lactic và nấm men vốn nổi tiếng với vai trò quan trọng trong các thực phẩm lên men, đem lại nhiều lợi ích cho sức khỏe con ngƣời. Những năm gần đây, nhóm vsv này đƣợc biết đến nhiều hơn với chức năng "VKprobiotic" nhằm ngăn ngừa, hạn chế mầm bệnh tăng cƣờng chuyển hóa thức ăn, cải thiện sự cân bằng hệ vsv tự nhiên nơi đƣờng ruột của ngƣời và vật nuôi. Trong chăn nuôi heo, tiêu chảy là căn bệnh khá phổ biến, gây thiệt hại không nhỏ đến năng suất và chất lƣợng sản phẩm nuôi. Việc sử dụng kháng sinh để trị bệnh này thuờng dẫn đến hiện tƣợng loạn khuẩn khiến tiêu chầy kéo dài, gây hậu quả nghiêm trọng cho sức khỏe con ngƣời và môi trƣờng sinh thái. Phƣơng pháp hữu hiệu nhất khắc phục tình trạng này là tái lập cân bằng hệ vi khuẩn đƣờng ruột bằng cách bổ sung một hệ vi khuẩn cố lợi mới dƣới dạng các chế phẩm probiotic. Đó cũng chính là lý do khiến chúng tôi chọn đề tài nghiên cứu : "Bước đầu nghiên cứu sử dụng vi sinh vật tạo chế phẩm Probiotic phòng và trị bệnh đường ruột cho heo" Mục tiêu của đề tài: Sử dụng một số chủng vsv có ích (VK lactic, nấm men) tạo chế phẩm có khả năng phòng và trị bệnh tiêu chảy cho heo có hiệu quả. Nhiệm vụ của đề tài: 1. Phân lập, tuyển chọn các chủng vi khuẩn lactic, nấm men có các hoạt tính cần thiết của một chủng probiotic. 2. Nghiên cứu các đặc điểm hình thái, sinh lý, sinh hoá và phân loại các chủng vsv đã tuyển chọn. 3. Nghiên cứu các điều kiện tối ƣu cho sự tạo sinh khối các chủng. 4. Xác định tỷ lệ tổ hợp giống và tạo chế phẩm probiotic. 5. Kiểm tra chất lƣợng chế phẩm theo thời gian bảo quản. 6. Bƣớc đầu thử nghiêm chế phẩm trên heo con sau cai sữa. 7. Xây dựng quy trình công nghệ tạo chế phẩm probiotic quy mô phòng thí nghiệm. 2 CHƢƠNG 1. TỔNG QUAN TÀI LIỆU 1.1. Tổng quan về probiotic 1.1.1. Lược sử nghiên cứu probiotic 1.1.2. Thành phần và đặc điểm VSVđược dùng trong probiotic 1.1.3. Cơ chế tác động của probiotic 1.1.4. Vai trò của probiotic 1.1.5. Tình hình nghiên cứu và sử dụng probiotic trên TG và VN 1.2. Sơ lƣợc về vi sinh vật probiotic A. Vi khuẩn lactic 1.2.1. Đặc điểm hình thái 1.2.2. Phân loại vi khuẩn lactic 1.2.3. Quá trình lên men lactic 1.2.4. Các yếu tố ảnh hưởng đến sinh trưởng, phát triển của VK lactic 1.2.4.1. Nguồn cacbon 1.2.4.2. Nguồn nitơ 1.2.4.3. Các muối vô cơ 1.2.4.4. Các chất sinh trƣởng 1.2.4.5. Oxy 1.2.4.6. Nhiệt độ 1.2.4.7. pH 1.2.5. Ứng dụng của vi khuẩn lactic trong sản xuất các chế phẩm sinh học phục vụ đời sống B. Sơ lược về nấm men 1.3. Tổng quan về heo 1.3.1. Vị trí phân loại của heo 1.3.2. Đặc điểm sinh lý tiêu hoá ở heo con 1.3.3. Các bệnh đường ruột ở heo con 1.3.3.1. Bệnh tiêu chảy ở heo con do E. coli 1.3.3.2. Tiêu chảy do Salmonella (Phó thƣơng hàn) 1.3.4. Các biện pháp phòng và điều trị 1.3.4.1. Phòng bệnh 1.3.4.2. Điều trị 3 CHƢƠNG 2. VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1. Vật liệu Nguồn phân lập từ các loại thực phẩm lên men lactic, các chế phẩm men tiêu hoá. Các chủng VK kiểm định do Trung tâm Công nghệ Sinh học ĐHQG Hà Nội và Viện Pasteur Tp.HCM cung cấp. Enzym -amylase và protease do Viện Sinh học Nhiệt đới Tp.HCM cung cấp. Đĩa giấy kháng sinh chuẩn do Công ty TNHH Nam Khoa cung cấp. 2.2. Phƣơng pháp nghiên cứu 2.2.1. Phân lập vi khuẩn lactic theo phƣơng pháp Koch 2.2.2. Xác định khả năng sinh axit tổng bằng phƣơng pháp cấy chấm điểm 2.2.3. Định lƣợng axit lactic bằng phƣơng pháp chuẩn độ Therner 2.2.4. Xác định hoạt tính ức chế vi khuẩn kiểm định bằng phƣơng pháp khoan lỗ thạch 2.2.5. Hoạt tính đề kháng với các chất kháng sinh của vi khuẩn lactic 2.2.6. Bảo quản giống VSV bằng phƣơng pháp đông khô 2.2.7. Xác định gián tiếp mật độ tế bào bằng phƣơng pháp đếm số khuẩn lạc mọc trên môi trƣờng thạch 2.2.8. Khảo sát sự sinh trƣởng của vi khuẩn lactic bằng phƣơng pháp đo mật độ quang 2.2.9. Xác định các dạng đồng phân của axit lactic bằng phƣơng pháp sắc ký bản mỏng 1.2.10. Phân loại nấm men bằng phƣơng pháp xác định trịnh tự rADN 16S 2.2.11. Xác định sinh khối nấm men bằng phƣơng pháp cân sinh khối tƣơi 2.2.12. Phƣơng pháp thử nghiệm chế phẩm trên heo con sau cai sữa (Tỷ lệ tiêu chảy, tỷ lệ tái phát, tăng trọng và hệ số tiêu tốn thức ăn) 4 CHƢƠNG 3. KẾT QUẢ VÀ BIỆN LUẬN 3.1. Phân lập và tuyển chọn các chủng vsv có các đặc tính phù hợp với yêu cầu tạo chế phẩm probiotic * Tiêu chí tuyển chọn VK lactic nhƣ sau: - Là VK hiện diện bình thƣờng trong đƣờng ruột của heo. - Tạo axit lactic cao, chịu pH thấp của MT. - Có khả năng ức chế phát triển của các VK gây bệnh, VK gây thối. - Đề kháng đƣợc các chất kháng sinh đƣờng ruột. - Làm tăng khả năng tiêu hoá thức ăn và hấp thu các chất dinh dƣỡng. * Kết quả: Phân lập đƣợc 34 chủng VK lactic và chọn đƣợc 3 chủng vi khuẩn Hình 3.1. Khả năng sinh axit lactic của chủng L2 và chủng B sau 48h Hình 3.2. Hoạt tính đối kháng E. coli và s. typhimurium của chủng B, N4 và L2 Hình 3.3. Hoạt tính kháng neomicin, kanamicin, gentamicin của chủng B, N4 và L2 Hình 3.4. Khả năng đối kháng với các VK kiểm định của Saccharomyces sp.02 Hình 3.5. Hình thái khuẩn lạc và tế bào của chủng Saccharomyces sp.02 5 3.2. Nghiên cứu các đặc điểm hình thái, sinh lý, sinh hóa của 3 chủng vi khuẩn lactic tuyển chọn Hình 3.6. Hình thái khuẩn lạc (a) và hình thái tế bào của chủng B, N4 và L2 chụp trên kính hiển vi điện tử quét (x 15 000 - 20 000) Bảng 3.1. Các đặc điểm sinh lý, sinh hóa của 3 chủng VK lactic Đặc điểm sinh lý, sinh hóa Ký hiệu chủng B N4 L2 Lên men Đồng hình Đồng hình Đồng hình Khả năng sinh khí Không Không Không Sinh trƣởng ở: 15 0 C + + + 50 0 C + + + pH = 3,5 + + + pH = 9,5 + + + NaCl = 6,5% + + + Dạng peptidoglucal Mezo- ĐAP Mezo- ĐAP Mezo- ĐAP Dạng đồng phân của axit lactic L-LDH L-LDH L-LDH; D-LDH Lên men đƣờng Glucose + + + L-arabinose + - - Raffinose - - - D-ribose +/- + - Maltose + + + Manitol + + - Saccharose + + - Lactose D-Galactose + + - 6 Sorbilol + + - Starch - - - Cellobioza - + - Fmctoza - - - D- gluconat +/- - - L- rbanuioza - - - L-sorboza - - - TrehaIoza - + - D-xyloza - - - Salỉcin - - + Gelatin - - - Melezitoza - - + Ghi chú: -: Âm tính; + : Dƣơng tính +/-: Mọc yếu Các kết quả nghiên cứu của chúng tôi kết hợp với kết quả định danh đến loài của Trung tâm Công nghệ Sinh học Đại học Quốc gia Hà Nội. Dựa vào khoá phân loại của Bergey's (1986) và Okada (1992), phân loại 3 chủng nhƣ sau: + Chủng Lactobacillus sp. B là lactobacillus agilis. + Chủng Lactobacillus sp. N4 là Lactobacillus salivarius. + Chủng Lactobacillus sp. L2 là Lactobacillus acidophilus. 33. Nghiên cứu đặc điểm sinh học của chủng nấm men Bảng 3.2. Các đặc điểm hình thái, sinh lý, sinh hóa của chủng nấm men Các đặc điểm Chủng Saccitaromyces sp.02 Đặc điểm của chi Sacchoromyces (theo Lodder 1971) Hình thái khuẩn lạc Tròn, bóng Khuẩn lạc dạng bột nhão, hơi bóng Hình thái tế bào Tròn, elip Tròn, elip Dạng nẩy chồi Đơn cực Đa cực hay đơn cực Khuẩn ly Giả Có hoặc không có khuẩn ty giả Nang bào tử Trong nang bào tử có 1-4 bào tử, bào tử hình cầu Trong nang bào tử có 1-4 bào tử, bào tử hình cẩu, elip Khả năng sử dụng nitrat Không Không Khả năng phân giải urê Không Không rõ Khả năng lên men các loại đƣờng Lên men đƣợc 6 trong 7 loại dƣờng kháo sát: glucose,mallose,fructose, saccarose, d- galactose, dextin không lên men dƣờng laciose Có khả năng lên men các loại đƣờng tƣơng tự 7 Khả năng đề kháng với các kháng sinh Đề kháng rất mạnh với các kháng sinh (Neomycin, Axit atidixic,Kanamycin, Gentamycin. Ampicillin, Ctoramphenicol, Noefloxacin, Tetracylin) , Khả năng đối khắng vđỉ các vi khuẩn kiểm dinh Đề kháng rất mạnh với E. coli, Samonella typhymurium, Samonelia choieraesuis Đề kháng khá mạnh với Bacillus subtilis, Streptococcus sp., Sacrina lutea So sánh các đặc điểm chủng nấm men Saccharomyces sp.02 với đặc điểm chung của chi Saccharomyces theo khoá phân loại của Lodder (1971), của Cletus p. Kurtzman (1998) chúng đều có các đặc điểm tƣơng đồng. Do vậy, chủng nấm men Saccharomyces sp.02 thuộc chi Saccharomyces. Kết quả xác định và so sánh bình tự gen rADN 16S chủng Saccharomyces sp.02 với bình tự gen rADN 16S đã đƣợc đăng ký trong ngân hàng dữ liệu gen Nhật Bản cho thấy chủng này có độ tƣơng đồng cao tới 99% so với loài Saccharomyces cerevisiae (phòng Thí nghiệm SHPT thuộc Trung tâm bảo tàng giống chuẩn ĐHQG Hà Nội). Từ đó có thể kết luận chủng này thuộc loài Saccharomyces cerevisiae. 3.4. Ảnh hƣởng một số điều kiện môi trƣờng đến sự tạo thành sinh khối các chủng nghiên cứu A. VI KHUẨN LACTIC 3.4.1. Ảnh hƣởng của môi trƣờng nuôi cấy Thời gian( giờ) Đồ thị 3.1. Ảnh hưởng của MT nuôi cấy đến sự tạo thành sinh khối của chủng B 8 Đồ thị 3.2. Ảnh hưởng của MT nuối cấy đến sự tạo thành sinh khối của Thời gian ( giờ) Đồ thị 3.3. Ảnh hưởng của MT nuôi cấy đến sự tạo thành sinh khối của chủng L2 3.4.2. Ảnh hƣởng của nhiệt độ môi trƣờng nuôi cấy Thời gian ( giờ) Biểu đồ 3.1. Ảnh hưởng của nhiệt độ đến sự tạo thành sinh khối của chủng L2 Thời gian ( giờ) 9 3.4.3. Ảnh hƣởng của pH ban đầu Thời gian ( giờ) Biểu đồ 3.2. Ảnh hưởng của pH ban díu đến sự tạo thành sinh khối của chủng L2 3.4.4. Ảnh hƣởng của nguồn thức ăn nitơ Thời gian ( giờ) Đồ thị 3.4. Ảnh hưởng của các nguồn thức ăn nitơ đến sự tạo (hành sinh khối của chủng B 3.4.5. Ảnh hƣởng của nồng độ cao nấm men Thời gian ( giờ) Biểu đồ 3.3. Ảnh hưởng của nồng độ cao nấm men đến sự tạo thành sinh khối của chủng L2 10 3.4.6. Ảnh hƣởng của nguồn thức ăn cacbon Thời gian (giờ) Biểu đồ 3.4. Ảnh hưởng của các nguồn thức ăn cacbon đến sự tạo thành sinh khối của chủng L2 3.4.7. Ảnh hƣởng của nồng độ saccharose Thời gian ( giờ) Biểu đồ 3.5. Ảnh hƣởng của nồng độ saccharose đến sự tạo thành sinh khối của chủng L2 3.4.8. Động thái quá trình tạo sinh khối tế bào của các chủng vi khuẩn lactic trong điều kiện tối ƣu Bảng 3.3. Động thái quá trình tạo sinh khối, sinh axit lactic vặ độ pH của 3 chủng VK lactic Thời gian (giờ) Các giá trị B N4 L2 OD600 pH H. lƣợng a. lactic (g/l) OD600 pH H. lƣợng a. lactic (g/l) OD600 pH H.lƣựng a. lactic (g/l) 0 0,149 6,019 0,198 0,157 6,011 0,207 0,131 5,360 0,288 6 1,517 4,332 0,441 1,635 4.252 0,459 0,586 4,568 0,414 12 2,214 3,577 1,062 2,157 3,539 1,053 1,005 3,685 0,981 18 2.370 3,490 1,224 2,242 3.463 1,260 1,430 3,606 1,134 24 2,422 3,431 1,341 2.346 3.413 1,314 1,827 3,585 1,179 30 2,466 3,426 1,395 2,395 3,411 1,359 1,974 3,563 1,224 36 2,482 3,401 1,431 2.395 3,406 1,404 2,016 3,517 1,242 42 2,482 3,390 1,449 2,395 3.401 1,422 2,054 3,502 1,278 48 2,515 3,386 1,467 2,482 3,389 1,440 2,121 3,476 1,332 11 Bảng 3.4. Tổng hợp các điều kiện để thu sinh khối của 3 chủng VK lactic Điền kiện tối ƣu Chủng B Chủng N4 Chủng L2 MT thay thế Nƣớc cà chua Nƣớc cà chua Nƣớc cà chua pH ban đầu 6-6.5 6-6,5 5,5 -6,0 Nguồn N Cao nấm men Cao nấm men Cao nấm men Tỷ lệ cao NM (%) 1 -1,5 1 -1.5 1 -2 Nguồn C Saccarose Saccarose Saccarose Tỷ lệ saccarose (%) 1-1.5 1-1,5 1 -2 Nhiệt độ MT(0C) 30-350C 30-350C 35 - 400c Thời gian thu sinh khối (h) 18-30h 18-30h 24-3 6h B. NẤM MEN Kết quả khảo sát ảnh hƣởng của MT đến sự tạo thành sinh khối chủng Sac. cerevisiae, chúng tôi đã xác định đƣợc các điều kiện tối nhƣ sau: - Môi trƣờng cao nấm men. - Tỷ lệ giống cấy ban đầu 10%. - Nhiệt độ là 350C. - pH ban đầu là 6,0. - Chế độ lắc thông khí là 170 vòng/phút. - Nồng độ cao nấm men là 0,3%. - Nồng độ saccharose thích hợp là 3,5%. - Thời gian thu sinh khối tốt nhất là 18 giờ. Đồ thị 3.5. Ảnh hưởng của các nguồn nitơ đến sự tạo thành sinh khối nấm men Đồ thị 3.6. Ảnh hưởng của cường độ thông khí đến sự tạo sinh khối nấm men 12 Đồ thị 3.7. Đồ thị tăng trưởng cùa chủng nấm men trên các loại môi trường Đồ thị 3.8. Ảnh hưởng của pH lên sự tạo thảnh sinh khối của chúng nấm men 3.5. Tạo chế phẩm probiotic 3.5.1. Đông khô các chủng VSV Mục đích việc đông khô các chủng VSV nghiên cứu ngoài nhiệm vụ bảo quản giếng mà còn đƣợc dùng làm nguyên liệu để tạo chế phẩm probiotic. Các chủng B, N4 và L2, đƣợc nuôi trên MT nƣớc chiết cà chua với những điều kiện tối ƣu tới pha ổn định (24 đến 36 giờ), ly tâm (3500 vòng/15 phút) thu sinh khối. Chủng nấm men đƣợc nuôi trên MT cao nấm men trong các điều kiện tối ƣu tới pha ổn định (18 - 21h), ly tâm thu sinh khối. Thực hiện đông khô các chủng. Mẫu VK Iactic đông khô có dạng bột mịn, màu trắng sữa và mùi đặc trƣng. Mẫu nấm men đông khô có dạng bột mịn, màu ƣấng ngà. Cố thể bảo quản chế phẩm ở nhiệt độ phòng (300C) hoặc trong tủ lạnh (40C). Hình 3.7. Đông khô 3 chủng VK lactic (a)và chủng Sac. cerevisiae (b) 13 3.5.2. Xác định tỷ lệ phối trộn các chủng trong các chế phẩm 3.5.2.1. Chế phẩm P-SP-01 Bảng 3.5. Hoạt tính đối kháng của các tỷ lệ phối trộn với các chủng VK kiểm định (D - d, mm) Tỷ lệ phối trộn VK Kiểm định Khả năng đối kháng của các tỷ lệ phối trộn với VK kiểm định (D - d, mm) 1:1:1 2:1:1 1:2:1 1:1:2 E. coli 15 15 19 14 S. typhimurium 14 14 15 13 S. choleraesuis 25 20 29 19 Serratia sp. 11 12 17 15 Streptococcus sp. 26 28 31 29 Bacttlus subtilis 25 25 28 24 3.5.2.2. Chế phẩm P-SP-02 Bảng 3.6. Khả năng đối kháng VK kiểm định của các tỷ lệ phối trộn Vi khuẩn kiểm định Khả năng đối kháng VKKD của các tỷ lệ phối trộn (D - d, mm) 1 : 1 1 :1,5 1,5 : 1 1 :2 E. coli 23 30 26 24 s. choleraesuis 21 27 25 22 Hình 3.8. Khả năng đối kháng với vsv kiểm định của tổ hợp giống (VK lactic/nấm men) 1 : 1,5 3.5.3. Đóng gói tạo chế phẩm probiotic Trộn sinh khối Lac. agilis : Lac. acidophilus : Lac. salivarius theo tỷ lệ 1:2: 1. Enzim a amylase và protease do viện Sinh học Nhiệt đới cung cấp đã đƣợc kiểm tra hoạt tính trƣớc khi sử dụng. Phối trộn 2 loại enzim trên theo tỷ lệ 1: 1. Hoạt tính của enzym α-amylase đƣợc kiểm tra bằng phƣơng pháp Smith & Roe, kết quả đạt 1453,963 UI (mg tinh bột/g/phút). Hoạt tính của enzym protease đƣợc kiểm tra bằng phƣơng pháp Anson cải tiến, kết quả đạt 21.867 Anson (μmol Tyrosin/g/phút). 14 Sinh khối 3 chủng VK lactic trộn với sinh khối nấm men theo tỷ lệ 1:1,5. Các nguyên liệu đƣợc đƣa vào máy ƣộn siêu tốc và tự động đóng gói chế phẩm trong bao nhôm với trong lƣợng 25g/gói. * Chế phẩm probiotic P-SP-01 gồm : - Sinh khối 3 chủng VK Iactic : 10g - Enzim α amylase và protease(tỷ lệ 1:1): 15g * Chế phẩm probiotic P-SP- 02 gồm : - Sinh khối 3 chủng VK lactic và nấm men : 10g - Enzim protease, amylase (tỷ lệ 1:1) là : 15g Bảo quản chế phẩm ỏ nhiệt độ phòng hay trong tủ lạnh (40C). Hình 3.9. Chế phẩm probiotic P-SP-02 3.6. Kiểm tra chất lƣợng chế phẩm 3.6.1. Khả năng sống sót của các chủng VSV sau quá trình đông khô Chất lƣợng và hiệu quả sử dụng chế phẩm phụ thuộc rất nhiều vào khả năng sống sốt của các chủng VSV đƣợc sử dụng trong các chế phẩm sau thời gian bảo quản. Bảng 3.7. Khả năng sống sót của các chủng VSV sau quá trình đông khô Ký hiệu chủng Mật độ tế bào(CFU/R) Trƣớc đông khô Sau 30 ngày San 60 ngày Sau 90 ngày Chủng B 2,76 x 1010 2,26 x 1010 9,28 x 109 6,22 x 109 Chủng N4 3,34 x 1010 2.91 x 1010 9,70 x 109 7 85 x 109 Chủng L2 3,37 x 109 2,66 x 109 9,44 x 109 6,81 x 109 Sau 30 ngày sế lƣợng tế bào của các chủng B, N4 và L2 thay đổi không đáng kể. Sau 60 ngày, đặc biệt sau 90 ngày đông khô, số lƣợng tế bào của các chủng tuy có giảm song vẫn đạt trên 109 tế bào/1g chế phẩm. Đây cũng chính là mức yêu cầu về mật độ tế bào của các chủng VSV trong chế phẩm probiotic và cho hiệu quả cao khi sử dụng. 15 3.6.2. Khả năng đối kháng với các VK kiểm định của các chăng trong chế phẩm Bảng 3.8. Khả năng đối kháng với các VK kiểm định của các chủng trong chế phẩm Chủng VSV ức chế vi khuẩn kiếm định Gây bệnh Khỉ năng ức chế (D-d, mm) Trước đông khô Sau đông khô Sac. cerevisiae với E.coli Viêm một, liêu cháy 25 23 Sac. cerevisiae với Sal choleraesuis Tiêu chảy ở heo 25 22 Chủng B với E.coli Viêm một, tiêu chảy 14 13 Chủng B với Sal. choleraesuis Tiêu chảy ở heo 27 26 Chủng N4 với E.coli Viêm ruột, tiêu chảy 12 11 Chủng N4 với Sai choleraesuis Tiêu chảy ở heo 25 24 Chủng 12 với E.coli Viêm ruột, tiêu cháy 13 13 Chủng 12 với Sai choleraesuis Tiêu chảy ở heo 22 22 Kiểm tra khả năng đề kháng với VK kiểm định và đề kháng với kháng sinh của Sac. cerevisiae cho thấy kết quả tƣơng tự. Với các đặc tính trên, cố thể bƣớc đầu yên tâm khi sử dụng thử nghiệm các chế phẩm probiotic của mình trên heo con sau cai sữa. 3.7. Xây dựng quy trình công nghệ Hình 3.10. So đồ quy bình công nghệ tạo chế phẩm probiotic 16 3.8. Bƣớc đầu thử nghiệm chế phẩm P-SP-01 trên heo con sau cai sữa Mục đích thí nghiệm là nghiên cứu tác dụng của chế phẩm P-SP-01 đến việc phòng, trị bệnh tiêu chảy, hệ số chuyển hoá thức ăn và khả năng tăng trọng của heo con sau cai sữa (giai đoạn từ 28 ngày đến Số ngày tuổi). So sánh hiệu quả của chế phẩm P-SP-01 so với hiệu quả của chế phẩm BioI (đối chứng) do Viện sinh học nhiệt đới TP. HCM sản xuất và hiện đang lƣu hành phổ biến trên thị trƣờng. 3.8.1. Tỷ lệ tiêu chảy ở heo con sau cai sữa Bổ sung và trộn đều lg chế phẩm P-SP-01/kg thức ăn cho heo con sau cai sữa 28 ngày tuổi. Tỷ lệ tiêu chảy ở heo con đƣợc tính bằng sế ngày heo con tiêu chảy tái phát trên tổng số ngày nuôi trong các lô thí nghiệm. Bảng 3.9. Tỷ lệ tiêu chảy trên heo con sau cai sữa (%) Lô Lô ĐC 1 Lô ĐC 2 Lô TN3 Lô TN 4 Lô TN 5 Chỉ tiêu Tổng số ngày heo con bị tiêu chảy 35 27 13 19 20 Tổng số ngày nuôi của các lô thí nghiệm 224 224 224 224 224 Tỷ lệ tiêu chảy (%) 15,63 12,05 5,80 8,48 8,93 Giảm so với ĐC (%) - 22,90 62,89 45,75 42,87 Biểu đồ 3.6. Tỷ lệ tiêu chảy giữa các lô thí nghiệm * Nhận xét Kết quả khảo sát cho thấy, ở các lô thí nghiệm có bổ sung chế phẩm P-SP-01 có tỷ lệ tiêu chảy thíp hơn so với lô ĐC2 - bổ sung Biol và lô ĐC1 - không bổ sung chế phẩm. Việc sử dụng chế phẩm cho heo con có tác dụng làm giảm tỷ lệ tiêu chảy từ 42,87% - 62,89% so với lô 17 ĐC1. Điều này chứng tỏ, P-SP-01 ngoài tác dụng cạnh tranh và dối kháng để loại trừ VK gây bệnh, còn cung cấp thêm một lƣợng VSV có lợi, giúp duy trì sự cân bằng hệ VSV dƣờng ruột, từ dó làm giảm tình trạng tiêu chảy ở heo con. Đặc biệt, ở các lô thí nghiêm 3, 4, 5, không cố tỷ lệ tái phát bệnh, còn ở lô không dùng chế phẩm tỷ lệ tái phát bệnh tiêu chảy khá cao (66,66%). 3.8.2. Tăng trọng ở heo con sau cai sữa Kết quả khảo sát trọng lƣợng và sự tăng trọng bình quân của heo con từ 28 đến 56 ngày tuổi đƣợc bình bày qua bảng 3.16. Bảng 3.10. Tăng trọng bình quân của heo con từ 28 đến 56 ngày tuổi Lô Chỉ tiêu Lô ĐC1 Lô ĐC2 Lô TN3 Lô TN4 Lô TN5 Thời gian thí nghiệm (ngày) 28 28 28 28 28 Trọng lƣợng 28 ngày tuổi (kg/con) 6,2 7,1 9,0 5,8 5,9 Trọng lƣợng 56 ngày tuổi (kg/con) 15,3 17,9 21,9 15,3 15,8 Tăng trọng bình quân (kg/con) 9,1 10,8 12,9 9,5 9,9 Tăng trọng trung bình trong 1 ngày (g/ngày/con) 325 385,7 460,1 339,3 353,6 Biểu đồ 3.7. Tỷ lệ tiêu chảy giữa các là thí nghiệm * Nhận xét :Kết quả khảo sát cho thấy, tăng trọng bình quân ở các lô có bổ sung chế phẩm (lô 3, 4, 5, ĐC2) đều cao hơn so với lô ĐC1. Tuy nhiên, tăng trọng bình quân giữa các lô 3, 4, 5 không đều nhau. Vì thế mà ở lô 3, tăng trọng bình quân rất cao so với các lô 4, 5 và lô ĐC2 (12,9kg/con so với 9,lkg/con ở lô ĐC1). 18 3.8.3. Hệ số tiêu tốn thức ăn Bảng 3.11. Hệ số tiêu tấn thức ăn trong thời gian thí nghiệm Lô Chỉ tiêu Lô ĐC1 Lô ĐC2 Lô 3 Lô 4 Lô 5 Số kg thức ăn tiêu thụ (kg/lô) 121,5 100 135 94,2 102 Tăng trọng (kg/Iô) 72,7 86,1 103 76,2 79 Hệ số tiêu tốn thức ăn 1,67 1,16 1,31 1,24 1,29 Biểu đồ 3.8. Hệ số tiêu tốn thức ăn giữa các lô thí nghiệm * Nhận xét: Kết quả khảo sát cho thấy, hệ số tiêu tốn thức ăn ở các lô có bổ sung chế phẩm P-SP-01 (lô 3 : 1,31; lô 4 : 1,24; lô 5 : 1,29) và Biol (lô ĐC2 : 1,16), đều thấp hơn rất nhiều so với lô ĐC1 (1,67). Hệ số này gần xấp xỉ với 1,4 là giá trị của hệ số tiêu tấn thức ăn cho hiệu quả kinh tế nhất theo kinh nghiệm của các nhà chăn nuôi. Nhƣ vậy, khi bổ sung probiotic vào trong khẩu phần ăn, các VSV có lợi sẽ nhanh chống phát triển, chúng kết hợp với các enzym hỗ trợ cho việc tiêu hóa thức ăn làm cho heo con ăn nhiều hơn, hấp thu dƣỡng chất tết hơn dẫn đến tăng trọng mau hơn và làm giảm hệ số tiêu tốn thức ăn. Bƣớc đầu thử nghiệm chế phẩm trên heo con sau cai sữa (28 ngày tuổi) cho thấy khả năng phòng và trị bệnh tiêu chảy cho heo của chế phẩm P-SP-01 cho kết quả khá tốt. Hiệu quả này tƣờng đƣơng với hiệu quả sử dụng chế phẩm BioI của Viện sinh học nhiệt đới TP.HCM hiện đang đƣợc lƣu hành phổ biến trên thị trƣờng. Tuy nhiên, các số liệu ghi nhận đƣợc mới chỉ là bƣớc đầu vì số lƣợng heo con thử nghiệm hạn chế do những khó khăn khi chúng tôi triển khai thực nghiệm trong thời kỳ dịch cúm HSN1 đang bùng phát ở Việt Nam. 19 KẾT LUẬN VÀ ĐỀ NGHỊ KẾT LUẬN Từ những thực nghiệm trên, chúng tôi đã cố những kết luận sau : 1. Đã phân lập và tuyển chọn đƣợc 3 chủng VK lactic, 1 chủng nấm men có những đặc tính cần thiết của một chủng probiotic : - Có khả năng sinh các chất kháng khuẩn cao. - Có hoạt tính đối kháng mạnh, phổ kháng khuẩn rộng với các VSV kiểm định (chuyên gây bệnh tiêu chảy cho heo) nhƣ E. coli, Salmonella choleraesuis. - Có khả năng đề kháng tết với các chất kháng sinh (trị dƣờng ruột) nhƣ neomicin (Ne), nalidixic axit (Ng), kanamicin (Kn), gentamicin (Ge). - Có khả năng duy trì hoạt tính sinh học và sống sốt cao sau quá bình đông khô. 2. Đã nghiên cứu các đặc điểm hình thái, sinh lý, sinh hoá và phân loại các chủng trên đến loài là : Chủng B là Lactobacillus agilis. Chủng N4 là Lactobacillus salivarius. Chủng L2 là Lactobacillus acidophilus. Chủng nấm men Sac. sp. 02 là Sác. Cerevisiae. 3. Đã xác định đƣợc các điều kiện tối ƣu cho sự tạo thành sinh khối của 3 chủng VK lactic và 1 chủng nấm men. 4. Đã khảo sát và xác định đƣợc công thức tạo 2 loại chế phẩm probiotic P-SP-01 và P-SP-02. 5. Kiểm tra chất lƣợng chế phẩm sau quá trình bảo quản từ1 đến 2 vả 3 tháng cho thấy khả năng sống sốt của các chủng khá cao, sau 3 tháng mật độ tế bào ở mức cho phép (109 CFU/g). Chất lƣợng này tƣơng đƣơng với chế phẩm BioI đang lƣu hành rộng rãi trên thị trƣờng. 6. Đã xây dựng đƣợc quy trình sản xuất chế phẩm P-SP-01 và P-SP-02 ở quy mô phòng thí nghiệm. 7. Bƣớc đầu thử nghiệm chế phẩm P-SP-01 trên heo con sau cai sữa, giai đoạn 28 đến 56 ngày tuổi. Kết quả thu đƣợc : Tỷ lệ tiêu chảy 7,74% ; Tỷ lệ tái phát 0%; Tăng trọng trung bình là 384,3g/ngày ; Hệ 20 số tiêu tấn thức ăn 1,28%. So với lô sử dụng Biol, đạt chất lƣợng tốt hơn hay tƣơng đƣờng. ĐỀ NGHỊ Từ những kết quả nghiên cứu đạt đƣợc, để sớm đƣa chế phẩm vào ứng dụng thực tiễn, chúng tôi xin đề nghị một số vấn đề sau : - Tiếp tục hoàn thiện quy trình công nghệ tạo các chế phẩm Probiotic trên. - Bƣớc đầu thử nghiệm chế phẩm P-SP-02 ƣơng phòng và bị tiêu chảy cho heo con sau cai sữa làm cơ sở cho việc sản xuất và sử dụng 2 chế phẩm nghiên cứu đƣợc ra quy mô đại trà. SẢN PHẨM THU ĐƢỢC SAU ĐỀ TÀI 1. Bài báo : "Nghiên cứu đặc điểm sinh học chủng nám men Saccharomyces sp.02", Tạp chí Khoa học, Trƣờng ĐHSP TP. Hồ Chí Minh, Năm 2006. 2. Bài báo : "Đặc điểm các chủng vi khuẩn lactic dùng trong chế phẩm probiotic phòng và trị bệnh tiêu chảy cho heo", Hội nghị Khoa học lần thứ 20 kỷ niệm 50 năm thành lập Trƣờng ĐHBK Hà Nội, Năm 2006. 3. Hai chế phẩm Probiotic P-SP-0I và P-SP-02.

Các file đính kèm theo tài liệu này:

  • pdfnkkh_buoc_dau_nghien_cuu_su_dung_vi_sinh_vat_de_san_xuat_che_pham_probiotic_phong_va_tri_benh_duong.pdf
Luận văn liên quan