Đề tài Nghiên cứu về begomovirus trên ớt và cà chua ở miền Trung và miền Nam Việt Nam

Dựa vào triệu chứngcây bị bệnh có lá cong xuống dưới vào phía bên trong. Về sau, lá không có hình dạng, nhỏ hẹp, biến vàng từ mép và chóp lá lan vào giữa gân; lá cuốn cong lên phía trên thành hình thuyền; lá non biến vàng mạnh, giòn và nhỏ hẹp. Cuống lá có thể xoắn vặn. Cây lùn còi cọc, mọc nhiều cành nhánh nhỏ, đốt thân ngắn. - Dựa vào phản ứng PCR để phát hiện sự có mặt của virus Các phản ứng PCR được thực hiện trong tube 0.5 mL với tổng thể tích phản ứng 20 μL chứa 2.0 μL dung dịch đệm PCR X10 (Roche); 0.5 μL dNTPs (10mM mỗi loại A, T, G, C, Roche); 0.5 μL mỗi loại mồi đặc hiệu xuôi dòng và ngược dòng (đều đươc chuẩn bị ở nồng độ 20 μM); 0,5 μL Taq polymerase (Roche) và 0,5 μL khuôn DNA (DNA plasmid hoặc DNA chiết từ cây). Phản ứng PCR được thực hiện trên máy PCR PTC-100 (MJ Research Inc.) với điều kiện sau: khởi đầu biến tính ở 940C trong 4 phút; tiếp theo là 35 chu trình PCR (biến tính ở 940C trong 40 giây, gắn mồi ở 520C trong 35 giây và tổng hợp sợi ở 720C trong 1 phút 30 giây). Phản ứng được kết thúc với 5 phút ở 720C. Sản phẩm PCR được điện di trên gel agarose 1% đươc chuẩn bị bằng đệm TAE X 0.5 và chứa 0.5 mg/mL ethidium bromide. Gel được chạy trên thiết bị điện di là Mini-Sub Cell (Biorad) với đệm TAE 0.5X ở điện thế 100 V trong 25 - 30 phút. Bản gel được kiểm tra dưới ánh sáng tử ngoại và được chup bằng phim Polaroid với máy ảnh Polaroid Gel Cam (UK).

docx69 trang | Chia sẻ: anhthuong12 | Ngày: 26/09/2020 | Lượt xem: 8 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Đề tài Nghiên cứu về begomovirus trên ớt và cà chua ở miền Trung và miền Nam Việt Nam, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
.5 ml đã đặt trên đá trước đó. Cho 10 μL sản phẩm nối vào tube chứa vi khuẩn, ủ trên đá ít nhất 30 phút. - Sốc nhiệt ở 42 oC trong 1 phút rồi để trên đá lạnh 5 phút, spin nhẹ. - Thêm 600 μL SOC vào mỗi tube, nuôi lắc 1 giờ ở 37 oC - Ly tâm 3-5 phút, loại bỏ dịch trên tủa để lại 100 μL. Cấy dịch vi khuẩn trên đĩa LB agar + Kanamycin + Tetracylin . - Nuôi qua đêm ở 37 oC trong tủ binder, kiểm tra số khuẩn lạc mọc. 3.2.8. Phản ứng PCR kiểm tra các khuẩn lạc mọc trên môi trường chọn lọc Nuôi cấy từng khuẩn lạc mọc trong 3 ml môi trường LB lỏng (chứa hai loại kháng sinh) ở 37 oC, lắc 250 vòng/ phút qua đêm. Ly tâm dịch vi khuẩn sau đó rửa cặn vi khuẩn hai lần bằng nước vô trùng. Hút 50 μL nước vô trùng và hòa tan cặn vi khuẩn và để trong tủ -20oC ít nhất 30 phút. Lấy tube ra thả vào nước sôi 10 phút, đảo đều tube và đem dịch vi khuẩn đi chạy PCR 3.2.9. Tinh chiết plasmid DNA plasmid được chiết từ tế vi khuẩn theo kỹ thuật chiết plasmid (miniprep) của Sambrook và cs. (1989). Bước 1: Lấy 1,5 ml dịch vi khuẩn nuôi cấy trong môi trường LB lỏng chứa kháng sinh cho vào mỗi tube Eppendorf loại 1,5 ml. Bước 2: Ly tâm 3 phút ở máy ly tâm để bàn để lắng cặn vi khuẩn. Loại bỏ dịch trong để nguyên cặn trong tube. Bước 3: Cho tiếp 1,5 ml dịch vi khuẩn vào tube và lặp lại bước 2. Bước 4: Ly tâm 3 phút để lắng cặn vi khuẩn, loại bỏ dịch trong để nguyên cặn trong tube. Dùng pipes hút hết dịch trên tủa. Để tube trên đá khoảng 3 phút. Bước 5: Cho 100 μl dung dịch I đã được để lạnh trên đá vào tube. Cho tiếp 2 μl RNAse A (dung dịch gốc 10 mg/mL). Votex để hòa tan vi khuẩn. Bước 6: Cho 200 μl dung dịch II vào tube (cần kiểm tra xem SDS có bị kết tủa không nếu có cần làm ấm dung dịch để hoà tan SDS). Ở bước này không cần trộn tube và phải để tube trên đá và không được để dịch tan quá 2 phút vì plasmid dễ bị biến tính ở nồng độ kiềm cao. Bước này là bước phá huỷ vách tế bào giải phóng DNA genom và DNA plasmid nên dịch tan trở nên rất nhầy. Bước 7: Cho 150 μl dung dịch III đã để lạnh trước trên đá vào tube, trộn đều bằng lắc tube nhiều lần. Đây là bước trung hoà, toàn bộ protein và DNA genom (vì có kích thước lớn) sẽ bị kết tủa còn DNA plasmid (vì có kích thước nhỏ) nên vẫn hoà tan trong dung dịch. Để tube trên đá khoảng 3 phút. Bước 8: Ly tâm dung dịch 5 phút để kết tủa prtein và DNA genomic. Chuyển dịch trên tủa (khoảng 400 μl) có chứa DNA plasmid sang một tube mới, loại bỏ tube cũ và cặn bên trong tube. Bước 9: Cho một thể tích tương đương (khoảng 400 μl) isopropanol vào tube. Trộn đều bằng đảo tube nhiều lần. Để tube ở nhiệt độ phòng khoảng 5 phút. Trong bước này isopropanol sẽ làm kết tủa DNA plasmid. Bước 10: Ly tâm 5 phút để kết tủa DNA plasmid. Loại bỏ dịch trong giữ lại cặn DNA plasmid. Ly tâm nhanh để lắng tất cả dịch bám trên thành tube xuống dưới và dùng pipes hút hết dịch Bước 11: Cho 500 μl cồn 70 % vào tube để rửa cặn, loại bỏ cồn (trong bước này rửa cồn càng nhiều lần càng tốt). Để loại bỏ hết cồn ra khỏi tube, thì sau khi đổ hết cồn ra ly tâm ngắn khoảng vài giây để lắng tất cả cồn bám trên thành tube xuống dưới và dùng pipes hút hết cồn. Bước 12: Để khô cặn DNA trong không khí khoảng 30 phút. Bước 13: Hoà cặn DNA plasmid với 50 μl dd H2O vô trùng hoặc đệm TE (pH = 8). Dịch DNA bây giờ có thể được dùng cho các phản ứng enzyme hoặc bảo quản ở -200C. 3.2.10. Chuẩn bị vi khuẩn A. tumefaciens khả biến (competent cells) Tế bào A. tumefaciens khả biến được chuẩn bị theo An và cs. (1988) Bước 1: Nuôi cấy vi khuẩn trong 5 ml môi trường LB lỏng, để qua đêm ở nhiệt độ 28 oC trong tủ nuôi cấy có lắc (250 rpm). Bước 2: Chuyển 2 ml dịch vi khuẩn ở bước 1 sang 50 ml môi trường LB lỏng đựng trong lọ định mức ở 500 ml. Ủ trong tủ nuôi cấy có lắc (250 rpm / 28 oC) cho tới khi mật độ quang OD600 đạt 0,5 - 1,0. Bước 3: Làm lạnh vi khuẩn bằng để bình trong đá khoảng 5 phút. Cho toàn bộ dung dịch chứa vi khuẩn ly tâm với tốc độ 3000 g trong vòng 5 phút ở 4oC. Bước 4: Loại bỏ dịch trên tủa (dùng pipes hút hết dịch trên tủa). Hoà cặn vi khuẩn với 1 ml dung dịch CaCl2 20 mM đã được làm lạnh trước trong đá. Sau đó phân phối cứ 0,1 ml dịch vi khuẩn thì cho vào 1 tube Eppendorf loại 1,5 ml được làm lạnh trước trong đá. Hoá đông vi khuẩn khả biến và bảo quản trong tủ lạnh sâu – 80oC. 3.2.11. Biến nạp cấu trúc xâm nhiễm vào tế bào vi khuẩn A. tumefaciens khả biến Các cấu trúc xâm nhiễm vừa được thiết kế được biến nạp vào tế bào vi khuẩn khả biến theo phương pháp đông tan (Hofgen & Willmitzer, 1988). Trong điều kiện phòng thí nghiệm, bước đông tan được thưc hiện với tủ lạnh sâu – 80 oC thay vì bằng nitơ lỏng. Các bước cụ thể là: Bước 1: Lấy tế bào A. tumefaciens từ tủ lạnh - 80 oC. Để vi khuẩn tan đông trong đá. Bước 2: Lấy 10 μl dịch DNA của mỗi cấu trúc cho vào tube tế bào vi khuẩn và trộn đều. Bước 3: Để hỗn hợp dịch vi khuẩn và DNA vào tủ lạnh sâu – 80oC trong vòng 15 phút. Bước 4: Để hỗn hợp dịch vi khuẩn và DNA vào block nhiệt 37 oC trong vòng 5 phút. Bước 5: Cho dịch vi khuẩn đã được transfomation vào ống nghiệm chứa 1 ml môi trường LB lỏng, ủ ống nghiệm trong tủ ấm có lắc ở 28 oC trong 1giờ. Bước 6: Chuyển dịch vi khuẩn vào tube 1,5 ml. Bước 7: Ly tâm trong 3 phút, lấy phần dịch trên tủa, loại cặn, sau đó cho tiếp 100 μl môi trường LB lỏng. Bước 8: Dịch vi khuẩn ở bước 8 được cấy trên đĩa môi trường LB - agar có 3 loại kháng sinh (Streptomicin 200 μg/mL, rifampicin 34 μg/mL và kanamycin 100 μg/mL). Bước 9: Các đĩa petri được ủ ở 28 oC trong vòng 2 ngày. Kiểm tra sự hình thành khuẩn lạc Bước 10: Dùng tăm nhọn đã được hấp khử trùng lấy một ít vi khuẩn ở mỗi khuẩn lạc rồi thả vào trong ống nghiệm chứa 4 mL môi trường LB lỏng chứa 3 kháng sinh ở trên. Bước 11: Các ống nghiệm được ủ 24 giờ trong tủ ấm có lắc (200 rpm / 28 oC). Bước 12: Kiểm tra đặc điểm sinh trưởng của vi khuẩn trong môi trường LB lỏng và kiểm tra sự có mặt của cấu trúc xâm nhiễm trong vi khuẩn bằng PCR sau khi chiết DNA plasmid 3.2.12.Xác định trình tự gen và xử lý số liệu bằng các phần mềm chuyên dụng Phản ứng sequence được chúng tôi gửi sang Macrogen (Hàn Quốc) để tiến hành giải trình tự các mẫu.Sử dụng 5µl sản phẩm cộng với 5µl mồi. Kết quả giải trình tự gen được phân tích trên máy tính bằng các phần mềm: Chương trình BLAST ( NCBI ), BioEdit 7.0.9, DNAstar 7.1 (Lasergene), Vecter NTI Advance 11.5 (Invitrogene), ClustalX 2.0 và Mega 4.0., Sequencing Analysis 5.2, Seqscape 2.5 và so sánh với trình tự của đoạn DNA với trình tự chuẩn. 3.2.9. Lây nhiễm nhân tạo sử dụng kỹ thuật agroinoculation Sử dụng kỹ thuật tiêm trực tiếp dịch vi khuẩn vào cây (Kheyr-Pour et al., 1991; Navot et al., 1991). Các bước thực hiện như sau : Nuôi cấy dòng vi khuẩn chứa cấu trúc xâm nhiễm trong 200 ml môi trường LB lỏng chứa 3 loại kháng sinh (streptomicin 200 μg/mL, rifampicin 34 μg/mL và kanamycin 100 μg/mL) trong tủ nuôi cấy có lắc (250 rpm / 28°C/ 2 ngày). Ly tâm dịch vi khuẩn (3000G/ 5 phút ) rồi hòa cặn vi khuẩn với 5 ml môi trường LB lỏng chứa 3 loại kháng sinh như trên. Dùng kim tiêm 18 gauge (đường kính 1.02362 mm) tiêm dịch vi khuẩn vào lá, chồi và 4 nách lá tiếp theo; mỗi vị trí tiêm 10 µl. Trong các công thức lây nhiễm hỗn hợp, các dòng vi khuẩn sẽ được trộn với thể tích tương đương. Bảng 3.6:Thí nghiệm lây nhiễm được thực hiện với các công thức STT CÔNG THỨC ĐỐI TƯỢNG CT1 Tiêm dòng vi khuẩn có chứa cấu trúc xâm nhiễm của VNP93-5-4 (DNA-A) Cà chua CT2 Tiêm dòng vi khuẩn có chứa cấu trúc xâm nhiễm của VNP93-5-4 (DNA-A) và VNP93-5-8 (DNA-B) Cà chua CT3 Tiêm dòng vi khuẩn có chứa cấu trúc xâm nhiễm của VNP93-5-4 (DNA-A) ớt CT4 Tiêm dòng vi khuẩn có chứa cấu trúc xâm nhiễm của VNP93-5-4 (DNA-A) và VNP93-5-8 (DNA-B) ớt CT5 Cây đối chứng không tiêm Cà chua và ớt 3.2.10. Đánh giá tính gây bệnh - Dựa vào triệu chứngcây bị bệnh có lá cong xuống dưới vào phía bên trong. Về sau, lá không có hình dạng, nhỏ hẹp, biến vàng từ mép và chóp lá lan vào giữa gân; lá cuốn cong lên phía trên thành hình thuyền; lá non biến vàng mạnh, giòn và nhỏ hẹp. Cuống lá có thể xoắn vặn. Cây lùn còi cọc, mọc nhiều cành nhánh nhỏ, đốt thân ngắn. - Dựa vào phản ứng PCR để phát hiện sự có mặt của virus Các phản ứng PCR được thực hiện trong tube 0.5 mL với tổng thể tích phản ứng 20 μL chứa 2.0 μL dung dịch đệm PCR X10 (Roche); 0.5 μL dNTPs (10mM mỗi loại A, T, G, C, Roche); 0.5 μL mỗi loại mồi đặc hiệu xuôi dòng và ngược dòng (đều đươc chuẩn bị ở nồng độ 20 μM); 0,5 μL Taq polymerase (Roche) và 0,5 μL khuôn DNA (DNA plasmid hoặc DNA chiết từ cây). Phản ứng PCR được thực hiện trên máy PCR PTC-100 (MJ Research Inc.) với điều kiện sau: khởi đầu biến tính ở 940C trong 4 phút; tiếp theo là 35 chu trình PCR (biến tính ở 940C trong 40 giây, gắn mồi ở 520C trong 35 giây và tổng hợp sợi ở 720C trong 1 phút 30 giây). Phản ứng được kết thúc với 5 phút ở 720C. Sản phẩm PCR được điện di trên gel agarose 1% đươc chuẩn bị bằng đệm TAE X 0.5 và chứa 0.5 mg/mL ethidium bromide. Gel được chạy trên thiết bị điện di là Mini-Sub Cell (Biorad) với đệm TAE 0.5X ở điện thế 100 V trong 25 - 30 phút. Bản gel được kiểm tra dưới ánh sáng tử ngoại và được chup bằng phim Polaroid với máy ảnh Polaroid Gel Cam (UK). KẾT QUẢ VÀ THẢO LUẬN Nhân dòng và giải trình tự toàn bộ bộ gene của mẫu virus trên ớt Trong năm 2013, Nguyễn Đức Anh (CNSH54B) đã phân lập được begomovirus chưa từng được phát hiện ở Việt Nam gây hại trên cây ớt. Tác giả đã giải trình tự trực tiếp được một phần bộ gen của virus này. Vì danh tính và vị trí phân loại của begomovirus chỉ có thể được xác định chính xác dựa trên toàn bộ trình tự của begomovirus nên mục tiêu của phần 4.1 của chúng tôi là giải trình tự toàn bộ bộ gen củavirus này. Hình 4.1. Triệu chứng của begomovirus gây hại trên ớt tại Đà Nẵng (mẫu VNP93) Chúng tôi tiến hành hồi phục lại nguồn E.coli chủng XL1 blue mang cấu trúc xâm nhiễm của virus này được giữ ở -800C. Sau đó tiến hành kiểm tra lại các clone bằng PCR và phản ứng cắt. Lây nhiễm nhân tạo Chilli Yellow Leaf Curl Virus (ChYLCV) nhờ vi khuẩn Agrobacterium tumerfaciens (Agroinoculation) Mục đích và phương pháp: Cà chua và ớt là những cây trồng quan trọng trong nền nông nghiệp hiện nay của nước ta. Chilli yellow leaf curl virus là loài mới lần đầu tiên phát hiện ở Việt Nam và lần đầu tiên trên cây ớt. Việc phát hiện ra loài này có ý nghĩa quan trong thực tiễn và khoa học. Sau khi biến nạp thành công cấu trúc xâm nhiễm của Chilli Yellow Leaf Curl Virusvào vi khuẩn Agrobacterium tumerfaciens thì chúng tôi tiến hành lây nhiễm nhân tạo nhờ vi khuẩn Agrobacterium tumerfaciens (Agroinoculation), từ đó có thể dễ dàng hơn trong việc đánh giá tính gây bệnh, đặc trưng sinh học của virus này và có biện pháp phòng trừ phù hợp. Các dòng vi khuẩn chứa cấu trúc xâm nhiễm bảo ở -800C được phục hồi bằng cách cấy trải trên môi trường LB agar chứa 3 loại kháng sinh (rifampicin – gen kháng nằm trên bộ gen vi khuẩn A.tumerfaciens dòng LBA4404; streptomycin – gen kháng nằm trên Ti plasmid pAL4404 và kanamycin – gen kháng nằm trên vector nhị nguyên pCAMBIA-2300). Như vậy, về lý thuyết, chỉ có tế bào vi khuẩn A. tumerfaciens dòng LBA4404 chứa Ti plasmid pAL4404 và các cấu trúc xâm nhiễm mới có thể sống được trên môi trường chứa 3 loại kháng sinh trên. Sau khi các khuẩn lạc đã mọc trên môi trường chúng tôi tiến hành nuôi trong môi trường LB lỏng có bổ xung ba loại kháng sinh trên ở nhiệt độ 370C có lắc để nhân sinh khối vi khuẩn chuẩn bị cho lây nhiễm. Dịch vi khuẩn thu được sau khi nuôi lỏng, lắc được mang đi li tâm lấy cặn vi khuẩn và hòa tan cặn vi khuẩn bằng đệm MgCl2 cùng với 1 µl/ml acetonringone 0.1M giúp kích thích sự phát triển của vi khuẩn trong tế bào ký chủ. Dịch vi khuẩn được sử dụng để lây nhiễm bằng cách tiêm trực tiếp vào mô lá sử dụng kim tiêm 18 gauge (đường kính 1.02362mm). Các cây thí nghiệm gồm cà chua HT7 và ớt sừng trâu đã được biết mẫn cảm với bệnh để thí nghiệm. Kết quả thu được sau 15 ngày lây nhiễm: Nghiên cứu begomovirus trên cà chua và ớt tại miền Trung và miền Nam Việt Nam. Begomovirs trên ớt tại miền Trung và miền Nam Việt Nam Kết quả chuẩn đoán begomovirus trên ớt bằng phản ứng PCR Mục đích:Chúng tôi tiến hành kiểm tra các mẫu ớt thu thập được tại miền Trung và miền Nambằng phản ứng PCR sử dụng cặp mồi chung phát hiện begomovirus là BegoA-F1 và BegoA-R1 Bảng 4.2: Các mẫu ớt ở miền Trung STT Ký hiệu Địa điểm, khu vực thu mẫu Kết quả kiểm tra Lần 1 Lần 2 1 VNP624 Túy Loan – Đà Nẵng + + 2 VNP626 Túy Loan – Đà Nẵng + + 3 VNP628 Túy Loan – Đà Nẵng + + (mờ) 4 VNP635 Điện Bàn – Quảng Nam + + 5 VNP722 Vinh – Nghệ An + + 6 VNP867 Túy Loan – Đà Nẵng - - 7 VNP868 Hòa Vang – Đà Nẵng - - 8 VNP869 Hòa Vang – Đà Nẵng - - 9 VNP870 Hòa Vang – Đà Nẵng - - 10 VNP871 Hòa Vang – Đà Nẵng - - 11 VNP872 Hòa Vang – Đà Nẵng - - 12 VNP873 Hòa Vang – Đà Nẵng - - 13 VNP874 Hòa Vang – Đà Nẵng - - 14 VNP875 Hòa Vang – Đà Nẵng - - 15 VNP876 Hòa Vang – Đà Nẵng - - 16 VNP877 Hòa Vang – Đà Nẵng - - 17 VNP878 Hòa Vang – Đà Nẵng - - 18 VNP879 Hòa Vang – Đà Nẵng - - 19 VNP880 Hòa Vang – Đà Nẵng - - 20 VNP883 Hòa Vang – Đà Nẵng - - 21 VNP884 Hòa Vang – Đà Nẵng - - 22 VNP885 Hòa Vang – Đà Nẵng - - 23 VNP886 Hòa Vang – Đà Nẵng - - 24 VNP887 Hòa Vang – Đà Nẵng - - 25 VNP888 Hòa Vang – Đà Nẵng - - 26 VNP889 Hòa Vang – Đà Nẵng - - 27 VNP890 Hòa Vang – Đà Nẵng - - 28 VNP891 Hòa Vang – Đà Nẵng - - 29 VNP892 Hòa Vang – Đà Nẵng - - 30 VNP907 Túy Loan – Đà Nẵng + + 31 VNP908 Túy Loan – Đà Nẵng - - 32 VNP909 Túy Loan – Đà Nẵng - - 33 VNP910 Túy Loan – Đà Nẵng - - 34 VNP911 Túy Loan – Đà Nẵng - - Hình 4.1: kết quả điện di sản phẩm PCR với mồi BegoA của các mẫu ớt ở miền Trung Marker à VNP624à VNP626à VNP628 àVNP867àVNP635à VNP722à VNP907 (ladder: 1kb) Bảng 4.3: Các mẫu ớt ở miền Nam STT Ký hiệu Địa điểm, khu vực thu mẫu Kết quả kiểm tra Lần 1 Lần 2 1 VNP313 Châu Thành – An Giang + + (mờ) 2 VNP319 Châu Thành – An Giang + + (mờ) 3 VNP323 Châu Thành – An Giang + + (mờ) 4 VNP641 Phú Mỹ - Bình Định + + 5 VNP646 Phù Cát – Bình Định + + (mờ) 6 VNP650 Phù Cát – Bình Định + + 7 VNP673 Châu Thành – An Giang + + 8 VNP675 Cao Lãnh – Đồng Tháp + (mờ) + 9 VNP683 Thanh Bình – Đồng Tháp - - 10 VNP687 Thanh Bình – Đồng Tháp + + (mờ) 11 VNP701 Châu Thành – An Giang + + 12 VNP704 Châu Thành – An Giang - - 13 VNP717 Bình Thủy – Cần Thơ - - 14 VNP718 Ô Môn – Cần Thơ + + 15 VNP826 Đan Dương – Lâm Đồng - - 16 VNP827 Đan Dương – Lâm Đồng - - 17 VNP828 Đan Dương – Lâm Đồng - - 18 VNP829 Đan Dương – Lâm Đồng - - 19 VNP831 Đan Dương – Lâm Đồng - - 20 VNP854 Playku – Gia Lai - - 21 VNP855 Playku – Gia Lai - + 22 VNP856 Playku – Gia Lai - - Hình 4.2: Kết quả điện di sản phẩm PCR với mồi begoA của các mẫu ớt miền Nam Mà VNP650à VNP683 àVNP675à VNP704à VNP831à VNP854à VNP673à VNP717à VNP718 (ladder 1kb) Hình 4.3. Triệu chứng của begomovirus trên ớt tại Quảng Nam và Cần Thơ Kết quả kiểm tra các mẫu ớt sử dụng các mồi đặc hiệu với một số loại begomovirus được phát hiện tại VN tính đến năm 2013 Mục đích và phương pháp: Chúng tôi tiến hành kiểm tra các mẫu trên sử dụng các mồi đặc hiệu của một số begomovirus được phát hiện tại VN bao gồmToLCHnV (F1/R1); TB101(F1/R1); VB65 (F1/R1); TY (F4/R4); To (F4/R4); To100 (F1/R1); TYKa-A (F1/R1)nhằm xác định những virus này có thuộc một trong những virus đã được phát hiện tại Việt Nam hay không. Kết quả kiểm tra được trình bày ở bảng 4.4. Bảng 4.4: kết quả chạy với các mồi đặc hiệu STT ID Khu vực thu mẫu Đối tượng TYKa-A (F1/R1) ToLCHnV (F1/R2) TB101 (F1/R1) VB65 (F1/R1) TY (F4/R4) To (F4/R4) To100 (F1/R1) 1 VNP313 An Giang ớt - - - - - - - 2 VNP319 An Giang ớt - - - - - - - 3 VNP323 An Giang ớt - - - - - - - 4 VNP624 Đà Nẵng ớt - - - - - - - 5 VNP626 Đà Nẵng ớt - - - - - - - 6 VNP628 Đà Nẵng ớt - - - - - - - 7 VNP635 Quảng Nam ớt - - - - - - - 8 VNP641 Bình Định ớt - - - - - - - 9 VNP646 Bình Định ớt - - - - - - + 10 VNP650 Bình Định ớt - - - - - - - 11 VNP673 An Giang ớt - - - - - - - 12 VNP675 Đồng Tháp ớt - - - - - - - 13 VNP683 Đồng Tháp ớt - - - - - - - 14 VNP687 Đồng Tháp ớt - - - - - - - 15 VNP698 Đồng Tháp ớt - - - - - - - 16 VNP701 An Giang ớt + (mờ) - - - - - - 17 VNP704 An Giang ớt - - - - - - - 18 VNP717 Cần Thơ ớt - - - - - - - 19 VNP718 Cần Thơ ớt - - - - - - + 20 VNP722 Nghệ An ớt - - - - - - - 21 VNP842 Lâm Đồng ớt - - - - - - - 22 VNP855 Gia Lai ớt - - - - - - - 23 VNP907 Đà Nẵng ớt - - - - - - - Từ kết quả trên kết luận hầu hết các virus này đều không phải thuộc những loài đã từng được phát hiện trước đây. Chúng tôi đưa ra dự đoán những mẫu này có thể loài begomovirus mới. Để xác định chính xác begomovirus trên tại Đà Nẵng (ChYLCV) có đúng là chủng begomovirus gây hại trên ớt tại miền Trung và miền Nam hay không hay là một loài mới, chúng tôi thiếtkế cặp mồi đặc hiệu phát hiện ChYLCV làVNP93A(F1/R1) và VNP93/97B (F1/R1) để phát hiện loài virus mới này. ·         Mồi xuôi VNP93-A-F: CATGCTAGTAATCCAGTGTATGC (996-1018) ·         Mồi ngược VNP93-A-R:  ATCTGCCAACGACGCATATGC (2194-2215) Kích thước sản phẩm: 1,2kb ·         VNP93/97-B-F: GTGATTCATGTTATACGCCTTCG (1363-1385) ·         VNP93/97-B-R: TCAATCGCTCTGCCTTCTCTC (2610-2622) Kích thước sản phẩm 1,2kbCho vào cái bảng nhé Bảng 4.5: Kết quả kiểm tra với mồi VNP93A và VNP93/97B STT ID Khu vực thu mẫu Đối tượng VNP93A (F1/R1) VNP93/97B (F1/R1) 2 VNP313 An Giang ớt - - 3 VNP319 An Giang ớt - - 4 VNP323 An Giang ớt - - 8 VNP624 Đà Nẵng ớt - - 9 VNP626 Đà Nẵng ớt - - 10 VNP628 Đà Nẵng ớt - - 11 VNP635 Quảng Nam ớt + + 12 VNP641 Bình Định ớt - - 13 VNP646 Bình Định ớt - - 14 VNP650 Bình Định ớt + + 15 VNP673 An Giang ớt + + 16 VNP675 Đồng Tháp ớt + + 17 VNP683 Đồng Tháp ớt - - 18 VNP687 Đồng Tháp ớt - - 19 VNP698 Đồng Tháp ớt + + 20 VNP701 An Giang ớt - - 21 VNP704 An Giang ớt - - 22 VNP717 Cần Thơ ớt - - 23 VNP718 Cần Thơ ớt - - 24 VNP722 Nghệ An ớt - - 27 VNP842 Lâm Đồng ớt + - 29 VNP855 Gia Lai ớt - - 37 VNP907 Đà Nẵng ớt - - Hình 4.5: Kết quả điện di chạy PCR với mồi VNP93A VNP635 à VNP650 à VNP673 à VNP675 à VNP698 à VNP842 à M (ladder 1kb) Hình 4.6: kết quả điện di chạy PCR với mồi VNP93/97B M à VNP635 à VNP650 à VNP673 à VNP675 à VNP698 à VNP842 (ladder 1kb) Từ kết quả trên cho thấy các mẫuthu được tại Lâm Đông, An Giang, Đồng Tháp, Quảng Nam, Bình Định dương tính với 2 cặp mồi phát hiện ChYLCV, chứng tỏ loài virus gây hại trên ớt tại những địa phương trên là giống với loài virus gây hại trên ớt tại Đà Nẵng. Tuy nhiên có mẫu VNP842 chỉ bắt cặp với mồi VNP93A mà không bắt cặp với mồi VNP93B, điều này đặt ra câu hỏi về vài trò của 2 phân tử DNA-A và DNA-B của virus này trong quá trình biểu hiện triệu chứng. Cả 6 mẫu này sẽ được chúng tôi nhân dòng và giải trình tự để đưa ra kết luận chính xác. Begomovirs trên cà chua tại miền Trung và miền Nam Việt Nam Kết quả chuẩn đoán begomovirus trên cà chua bằng phản ứng PCR Mục đích:Chúng tôi tiến hành kiểm tra các mẫu cà chua thu thập được tại miền Trung và miền Nambằng phản ứng PCR sử dụng cặp mồi chung phát hiện begomovirus là BegoA-F1 và BegoA-R1. Kết quả được trình bày ở bảng 4.6. Bảng 4.6: Các mẫu cà chua thu được ở miền Trung STT Ký hiệu Địa điểm, khu vực thu mẫu Kết quả kiểm tra Lần 1 Lần 2 1 VNP436 Diễn Châu – Nghệ An + + 2 VNP441 Diễn Châu – Nghệ An - - 3 VNP725 Vinh – Nghệ An + + (mờ) 4 VNP727 Diễn Châu – Nghệ An + (mờ) + 5 VNP893 Diễn Châu – Nghệ An - + 6 VNP894 Diễn Châu – Nghệ An - - 7 VNP895 Diễn Châu – Nghệ An - - 8 VNP896 Diễn Châu – Nghệ An - - 9 VNP897 Diễn Châu – Nghệ An + + 10 VNP898 Diễn Châu – Nghệ An - - 11 VNP899 Diễn Châu – Nghệ An + + 12 VNO900 Diễn Châu – Nghệ An + + 13 VNP901 Diễn Châu – Nghệ An - - 14 VNP902 Diễn Châu – Nghệ An - - 15 VNP903 Diễn Châu – Nghệ An - - 16 VNP904 Diễn Châu – Nghệ An - - 17 VNP905 Diễn Châu – Nghệ An + + 18 VNP906 Diễn Châu – Nghệ An - - Hình 4.7: Kết quả chạy điện di sản phẩm PCR với mồi BegoA các mẫu cà chua miền Trung Mà VNP425àVNP725à VNP727à VNP441à VNP896à VNP899àVNP900à VNP906à VNP893à VNP905 (ladder 1kb) Bảng 4.7: Các mẫu cà chua thu ở miền Nam STT Ký hiệu Địa điểm, khu vực thu mẫu Kết quả kiểm tra Lần 1 Lần 2 1 VNP310 Long Xuyên – An Giang + + 2 VNP326 Long Xuyên – An Giang - - 3 VNP820 Đan Dương – Lâm Đồng - - 4 VNP821 Đan Dương – Lâm Đồng - - 5 VNP822 Đan Dương – Lâm Đồng + + 6 VNP823 Đan Dương – Lâm Đồng - - 7 VNP843 Buôn ma thuật – Đăk Lăk + + 8 VNP844 Buôn ma thuật – Đăk Lăk + + 9 VNP845 Buôn ma thuật – Đăk Lăk - - 10 VNP846 Buôn ma thuật – Đăk Lăk - - 11 VNP847 Buôn ma thuật – Đăk Lăk - - 12 VNP848 Buôn ma thuật – Đăk Lăk - - 13 VNP857 Playku – Gia Lai - - 14 VNP862 Playku – Gia Lai + + 15 VNP863 Playku – Gia Lai - - 16 VNP864 Playku – Gia Lai - - 17 VNP865 Playku – Gia Lai - - 18 VNP866 Playku – Gia Lai - - Hình 4.8: Kết quả chạy điện di sản phẩm PCR với mồi BegoA các mẫu cà chua miền Nam M1à VNP901à VNP902à VNP903à VNP822à VNP823àVNP843àVNP844à VNP845à VNP846à VNP847àVNP848à VNP857à VNP863à VNP864à VNP865à VNP866à VNP821à VNP310à VNP326à VNP862à VNP820à VNP895àVNP895à VNP896à M2 (ladder 1kb) Phải có ảnh triệu chứng 4.3.1.2. Kết quả kiểm tra các mẫu cà chua sử dụng các mồi đặc hiệu với một số loại begomovirus được phát hiện tại VN tính đến năm 2013 Mục đích và phương pháp: Chúng tôi tiến hành kiểm tra các mẫu trên sử dụng các mồi đặc hiệu của một số begomovirus được phát hiện tại VN bao gồm ToLCHnV (F1/R1); TB101(F1/R1); VB65 (F1/R1); TY (F4/R4); To (F4/R4); To100 (F1/R1); TYKa-A (F1/R1)nhằm xác định những virus này có thuộc một trong những virus đã được phát hiện tại Việt Nam hay không. Kết quả kiểm tra được trình bày ở bảng 4.8. Bảng 4.8: Kết quả kiểm tra các mẫu cà chua với các cặp mồi đặc hiệu STT ID Khu vực thu mẫu Đối tượng TYKa-A (F1/R1) ToLCHnV (F1/R2) TB101 (F1/R1) VB65 (F1/R1) TY (F4/R4) To (F4/R4) To100 (F1/R1) 1 VNP310 An Giang Cà chua - - - - - - + 2 VNP326 An Giang Cà chua - - - - - - - 3 VNP436 Nghệ An Cà chua - - - - - - - 4 VNP441 Nghệ An Cà chua - - - - - - - 5 VNP725 Nghệ An Cà chua - - - - - - - 6 VNP827 Nghệ An Cà chua - - - - - - - 7 VNP843 Đăk Lăk Cà chua + (rõ) - - - - - + 8 VNP857 Gia Lai Cà chua - - - - - - - 9 VNP862 Gia Lai Cà chua + (mờ) - - - - - - 10 VNP893 Nghệ An Cà chua - - - - - - - 11 VNP897 Nghệ An Cà chua - - - - - - - 12 VNP899 Nghệ An Cà chua - - - - - - - 13 VNP900 Nghệ An Cà chua - - - - - - - 14 VNP905 Nghệ An Cà chua - - - - - - - Kết quả kiểm tra các mẫKiểm tra với mồi VNP93A (F1/R1) và VNP93B (F1/R1) Sau đó chúng tôi cũng tiến hành kiểm tra các mẫu này với cặp mồi mới được thiết kế Bảng 4.9: Kết quả PCA các mẫu cà chua với mồi VNP93A và VNP93/97BCho vào 1 bảng thôi, k cần nhiều bảng thế này đâu STT ID Khu vực thu mẫu Đối tượng VNP93A (F1/R1) VNP93/97B (F1/R1) 1 VNP310 An Giang Cà chua - - 2 VNP326 An Giang Cà chua - - 3 VNP436 Nghệ An Cà chua - - 4 VNP441 Nghệ An Cà chua - - 5 VNP725 Nghệ An Cà chua + - 6 VNP827 Nghệ An Cà chua - - 7 VNP843 Đăk Lăk Cà chua - - 8 VNP857 Gia Lai Cà chua - - 9 VNP862 Gia Lai Cà chua + - 10 VNP893 Nghệ An Cà chua - - 11 VNP897 Nghệ An Cà chua + - 12 VNP899 Nghệ An Cà chua - - 13 VNP900 Nghệ An Cà chua - - 14 VNP905 Nghệ An Cà chua - - Từ kết quả trên cho thấy một số mẫu cà chua bắt cặp với mồi VNP93A mà không bắt cặp với mồi VNP93B. Số còn lại thì không bắt 2 cặp mồi này. Nhân dòng và giải trình tự các mẫu virus trên ớt 4.2.3.1.Chuẩn bị vector pCAMBIA2300 Vector nhị nguyên được sử dụng để làm cấu trúc xâm nhiễm là vector pCAMBIA2300 được tạo ra bởi viện CAMBIA.pCAMBIA-2300 là vector cho chuyển gen thực vật và được sử dụng tốt trong thí nghiệm agroinoculation. Hình 4.9.Sơ đồ vector pCAMBIA2300 Vector pCAMBIA2300 dạng khô được bảo quản ở tủ -80 oCđược hòa loãng với nước và biến nạp vào E.coli chủng XL1-Blue sử dụng phương pháp sốc nhiệt và được cấy trải trên môi trường LB với tetracyline và kanamycine để chọc lọc các dòng mang cấu trúc xâm nhiễm. Sau khi ủ 18h ở 37oC thì có 200 khuẩn lạc đơn mọc trên môi trường LB với đặc điểm đặc trưng của E.coli ( màu trắng sữa, có viền bao quanh, bề mặt trơn). Một số khuẩn lạc đơn được chuyển qua nuôi lắc trong ống nghiệm, mỗi ống nghiệm có 5ml môi trường LB lỏng chứa tetracyline và kanamycine, nuôi lắc 200 rpm. Sau đó plasmid sẽ được tinh chiết bằng Purelink quick plasmid miniprep kit (Invitrogen), một lượng nhỏ sản phẩm minipreps sẽ được kiểm tra bằng PCR sử dụng cặp mồi đặc hiệu của vector pCAMBIA2300 là mồi pCAMseqF1 và pCAMseqR. Phản ứng PCR được thực hiện với điều kiện sau: khởi đầu biến tính ở 940C trong 4 phút; tiếp theo là 35 chu trình PCR (biến tính ở 940C trong 40 giây, gắn mồi ở 500C trong 35 giây và tổng hợp sợi ở 720C trong 1 phút 30 giây). Phản ứng được kết thúc với 5 phút ở 720C. Hình 4.10. Điện di sản phẩm PCR kiểm tra plasmid sử dụng cặp mồi pCAMseqF1/R Vector pCAMBIA2300 sau khi được tinh chiết và kiểm tra sẽ được mở vòng bằng enzyme Bam HI sau đó desphosphoryl hóa bằng alkaline phosphase và được tinh sạch bằng Purelink PCR purification kit (Invitrogen). Hình 4.11: Điện di sản phẩm khi mở vòngpCAMBIA 2300 bằng BamHI Phản ứng RCA nhân lên toàn bộ bộ gen của virus Chúng tôi tiến hành phản ứng RCA được thực hiện với 6 mẫu VNP635, VNP650, VNP673, VNP675, VNP698, VNP842 để nhân toàn bộ bộ gen của begomovirus dạng multimer sau đó xử lý sản phẩm để thu sản phẩm 3kb. Sau khi đã tối ưu hóa việc xử lý các sản phẩm RCA, chúng tôi tiến hành cắt hoàn toàn 6 mẫu trên với cả 3 loại enzyme là BamHI, PstI và E.coRI (kết quả thu được bảng 4.10, hình 4.12,hình 4.13 và hình 4.14):Thí nghiệm tối ưu hóa đâu, cho vào đây chứ Bảng 4.10: kích thước sản phẩm thu được sau khi cắt STT ID Địa điểm thu mẫu Kết quả cắt bằng các RE Bam HI E.co RI PstI 1 VNP 635 Đại An, Điện Bàn, Quảng Nam 2,7 2,7 2,7 ; 2,3 ; 0,7 2 VNP 650 Cát Lâm, Phù Cát, Bình Định 2,2 ; 0,7 2,7 2,7 3 VNP 673 Hòa An, Châu Thành, An Giang 2,7 2,3 ; 0,5 2,7 4 VNP 675 Hòa An, cao Lãnh, Đồng Tháp 2,7 2,3 ; 0,5 2,7 5 VNP 698 Ấp Tần Thuận, TT thanh Bình, Thanh Bình, Đồng Tháp 2,7 2,3 ; 0,5 2,7 6 VNP 842 Thạch Mỹ, Lâm Đồng 2,7 2,3 ; 0,7 2,3 ; 0,5 Hình 4.12: Cắt hoàn toàn sản phẩm RCA bằng EcoRI VNP842à VNP635à VNP650à VNP673à VNP675à VNP698à M (ladder 1kb) Hình 4.13: Cắt hoàn toàn sản phẩm RCA bằng BamHI Mà VNP635à VNP650à VNP673à VNP675à VNP698à VNP842 (ladder 1kb) Hình 4.14: Cắt hoàn toàn sản phẩm RCA bằng PstI Mà VNP635à VNP650à VNP673à VNP675à VNP698à VNP842 (ladder 1kb) Từ kết quả cắt hoàn toàn 6 mẫu bởi 3 loại enzyme chúng tôi chọn sử dụng enzyme BamHI để cắt hoàn toànLý do chọn Biến nạp cấu trúc xâm nhiễm vào E.coli chủng XL1-Blue khả biến Cắt lại 6 mẫu trên bằng BamHI thu băng ~3kb, sau đó thì băng 3kb được cắt ra khỏi bản gel agarose và tinh chiết bằng Accuprep gel purification kit (Bioneer) sau đó được nối vào vector pCAMBIA 2300 đã được mở vòng bằng enzyme T4 ligase (Fermentas).Sản phẩm nối sau đó sẽ được biến nạp vào E.coli XL1-Blue khả biến. Bảng 4.9: số clone thu được sau lần biến nạp đầu tiên Mẫu Số clone thu được trong lần biến nạp đầu tiên VNP635 3 VNP650 2 VNP673 3 VNP675 1 VNP698 4 VNP842 5 Sau khi đã thu được các clone thì chúng tôi tiến hành kiểm tra liệu đã có genome của virus được nối vào trong vector hay chưa.Có 2 phương pháp để kiểm tra đó là: Phản ứng PCR với cặp mồi BegoAFor1 và BegoARev1 hoặc là phản ứng cắt kiểm tra sản phẩm nối sử dụng enzyme cắt BamHI. Tất cả khuẩn lạc đơn sẽ được nuôi lắc 200 rpm trong 5ml LB lỏng cộng với kanamycine và tetracycline.Sau đó tinh chiết plasmid bằng phương pháp minipreps (Sambrook và cs.).Sau khi thu được plasmid chúng tôi tiến hành kiểm tra cả 14 clones bằng cách cắt bằng enzyme Bam HI để chắc chắn rằng có sản phẩm nối trong vector pCAMBIA2300. Bảng4.10 : Kiểm tra vector tái tổ hợp (miniprep) bằng BamHI Mẫu biến nạp Dòng (clone) Sản phẩm cắt bằng BamHi Kết luận sản phẩm nối VPN635 635-1 4.5 Do nối cả dimer vào vector 635-2 4.5 Do nối cả dimer vào vector 635-3 5.0 Do nối cả dimer vào vector VNP698 689-1 2.7 Do nối cả dimer vào vector 689-2 5.0 Do nối cả dimer vào vector 689-3 2.7 Đúng 689-4 - Do quá trình tinh chiết VNP650 650-1 - Tự nối 650-2 - Nhiễm tạp/tinh chiết? VNP673 673-1 - Tự nối 673-2 - Nhiễm tạp 673-3 - Nhiễm tạp/tinh chiết VNP675 675-1 - Do quá trình tinh chiết VNP842 842-1 2.7 Đúng 842-2 2.7 Đúng 842-3 2.7 Đúng 842-4 - Tự nối 842-5 - Tự nối Hình 4.14: Hình ảnh điện di sản phẩm cắt bằng BamHI của một số clone thu được sau khi biến nạp và XL1-Blue Mà VNP635(1)à VNP635(2)à VNP635(3)à VNP698(1)à VNP698(2)à VNP698(4) Hình 4.15: Điện di sản phẩm cắt một số clone thu được bằng BamHI MàVNP650(1)à VNP650(2)à VNP673(1)à VNP673(2)à VNP673(3)à VNP675(1)à VNP698(3)à VNP842(1)à VNP842(2)à VNP842(3)à VNP842(4)à VNP842(5) Từ kết quả trên chúng tôi quyết định chọn 2 clone VNP698(3) và VNP842(1) để giải trình tự nhằm định danh chính xác loài begomovirus trên 2 mẫu VNP689 và VNP842. Bảng 4.11: Bảng các clone và mồi sequencing STT Mã sequencing ID Clone Mồi 1 13D1ZAB039 VNP698 VNP-698-3 (A) pCAMBIASeqF 2 13D1ZAB040 VNP698 VNP-698-3 (A) pCAMBIASeqR 3 13D1ZAB041 VNP698 VNP-698-3 (A) VNP93-A-F 4 13D1ZAB042 VNP698 VNP-698-3 (A) VNP93-A-R 5 13D1ZAB043 VNP842 VNP-842-1 (A) pCAMBIASeqF 6 13D1ZAB044 VNP842 VNP-842-1 (A) pCAMBIASeqR 7 13D1ZAB045 VNP842 VNP-842-1 (A) VNP93-A-F 8 13D1ZAB046 VNP842 VNP-842-1 (A) VNP93-A-R TÀI LIỆU THAM KHẢO TÀI LIỆU TIẾNG VIỆT Hà Viết Cường (2010), Bệnh cây. NXB Đại học Nông nghiệp. Hà Viết Cường (2010), Công nghệ sinh học trong bệnh cây. Hà Viết Cường (2010), Virus. NXB Đại học Nông nghiệp. Vũ Triệu Mân (2003), Chẩn đoán nhanh bệnh hại thực vật, NXB Nông Nghiệp. Vũ Triệu Mân – Lê Lương Tề chủ biên (2001). Giáo trình Bệnh cây Nông Nghiệp. NXB Nông Nghiệp. Lê Lương Tề, Vũ Triệu Mân (1999), Bệnh vi khuẩn và virus hại cây trồng. NXB Giáo dục, Hà Nội. Nguyễn Thị Hà Uyên (2012). Xác định và đánh giá khả năng gây bệnh của một số begomovirus trên cây cà chua bằng phương pháp lây nhiễm nhân tạo dùng vi khuẩn Agrobacterium tumerfaciens. Trần Ngọc Tiệp (2010). Xác định và đặc trưng phân tử của một số virus thuộc chi Begomovirus (họ Geminiviridae). Báo cáo thực tập tốp nghiệp, chuyên ngành CNSH. Nguyễn Đức Anh (2012) .Nghiên cứu Mungbean yellow mosaic virus (MYMV) trên đậu xanh và begomovirus trên ớt tại miền Trung Việt Nam. TÀI LIỆU TIẾNG ANH 10. G. Argüello-Astorga and R. Ruiz-Medrano (2001). An iteron-related domain is associated to Motif 1 in the replication proteins of geminiviruses: identification of potential interacting amino acid-base pairs by a comparative approach. Archives of Virology 146(8): 1465. 11. R. Briddon, J. Brown, E. Moriones, J. Stanley, M. Zerbini, X. Zhou and C. Fauquet (2008). Recommendations for the classification and nomenclature of the DNA-β satellites of begomoviruses. Archives of virology 153(4): 763. 12. R. W. Briddon (2003). Cotton leaf curl disease, a multicomponent begomovirus complex. Molecular Plant Pathology 4(6): 427. 13. S. Chakraborty, P. Pandey, M. Banerjee, G. Kalloo and C. Fauquet (2003). Tomato leaf curl Gujarat virus, a new begomovirus species causing a severe leaf curl disease of tomato in Varanasi, India. Phytopathology 93(12): 1485. 14. C. Fauquet, R. Briddon, J. Brown, E. Moriones, J. Stanley, M. Zerbini and X. Zhou (2008). Geminivirus strain demarcation and nomenclature. Archives of virology 153(4): 783. 15. C. Fauquet and J. Stanley (2005). Revising the way we conceive and name viruses below the species level: a review of geminivirus taxonomy calls for new standardized isolate descriptors. Archives of virology 150(10): 2151. 16. P. T. Ferreira, T. O. Lemos, T. Nagata and A. K. Inoue-Nagata (2008). One-step cloning approach for construction of agroinfectious begomovirus clones. J Virol Methods 147(2): 351. 17. R. Fujii, M. Kitaoka and K. Hayashi (2006). Error-prone rolling circle amplification: the simplest random mutagenesis protocol. Nature protocols 1(5): 2493. 18. Y. Gafni and B. L. Epel (2002). The role of host and viral proteins in intra-and inter-cellular trafficking of geminiviruses. Physiological and Molecular Plant Pathology 60(5): 231. 19. M. Ghanim, S. Morin and H. Czosnek (2001). Rate of Tomato yellow leaf curl virus translocation in the circulative transmission pathway of its vector, the whitefly Bemisia tabaci. Phytopathology 91(2): 188. 20. (2001). Molecular characterization of begomoviruses associated with leafcurl diseases of tomato in Bangladesh, Laos, Malaysia, Myanmar, and Vietnam. Plant Disease 85(12): 1286. 21. C. Ha, S. Coombs, P. Revill, R. Harding, M. Vu and J. Dale (2008). Molecular characterization of begomoviruses and DNA satellites from Vietnam: additional evidence that the New World geminiviruses were present in the Old World prior to continental separation. Journal of General Virology 89(1): 312. 22. C. V. Ha (2007). Detection and identification of potyviruses and geminiviruses in Vietnam. 23. D. Haible, S. Kober and H. Jeske (2006). Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses. J Virol Methods 135(1): 9. 24. B. Harrison, M. Swanson and D. Fargette (2002). Begomovirus coat protein: serology, variation and functions. Physiological and molecular plant pathology 60(5): 257. 25. T. Hartz, G. Miyao, J. Mickler, M. Le Strange, S. Stoddard, J. Nunez and B. Aegerter (1997). Processing tomato production in California, UCANR Publications. 26. A. K. Inoue-Nagata, L. C. Albuquerque, W. B. Rocha and T. Nagata (2004). A simple method for cloning the complete begomovirus genome using the bacteriophage phi29 DNA polymerase. J Virol Methods 116(2): 209. 27. D. R. Jones (2003). Plant viruses transmitted by whiteflies. European Journal of Plant Pathology 109(3): 195. 28. D. Knierim and E. Maiss (2007). Application of Phi29 DNA polymerase in identification and full-length clone inoculation of tomato yellow leaf curl Thailand virus and tobacco leaf curl Thailand virus. Arch Virol 152(5): 941. 29. P. Markham, I. Bedford, S. Liu, D. Frolich, R. Rosell and J. Brown (1996). transmission of geminiviruses by biotypes of Bemisia tabaci (Gennadius). Bemisia: 1995, taxonomy, biology, damage, control and management. 30. E. Moriones, S. García-Andrés and J. Navas-Castillo (2007). Recombination in the TYLCV complex: a mechanism to increase genetic diversity. Implications for plant resistance development. Tomato Yellow Leaf Curl Virus Disease, Springer: 119. 31. E. Moriones and J. Navas-Castillo (2000). Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Research 71(1): 123. 32. M. Padidam, S. Sawyer and C. M. Fauquet (1999). Possible emergence of new geminiviruses by frequent recombination. Virology 265(2): 218. 33. B. Picó, M. J. Díez and F. Nuez (1996). Viral diseases causing the greatest economic losses to the tomato crop. II. The Tomato yellow leaf curl virus—a review. Scientia Horticulturae 67(3): 151. 34. S. Ribeiro, A. Inoue‐Nagata, J. Daniels and A. DeÁvila (2006). Potato deforming mosaic disease is caused by an isolate of Tomato yellow vein streak virus. Plant Pathology 55(4): 569. 35. E. Rybicki (1994). A phylogenetic and evolutionary justification for three genera of Geminiviridae. Archives of Virology 139(1-2): 49. 36. K. Sarkar and K. Kulshreshtha (1978). Crotalaria striata DC. a new natural host of bean common mosaic virus. Current Science 47(7). 37. R. Tice, E. Agurell, D. Anderson, B. Burlinson, A. Hartmann, H. Kobayashi, Y. Miyamae, E. Rojas, J. Ryu and Y. Sasaki (2000). Single cell gel/comet assay: guidelines for in vitro and in vivo genetic toxicology testing. Environmental and molecular mutagenesis 35(3): 206. 38. A. VARMA and V. Malathi (2003). Emerging geminivirus problems: a serious threat to crop production. Annals of Applied Biology 142(2): 145. 39. C. Y. Wu, Y. C. Lai, N. S. Lin, Y. H. Hsu, H. T. Tsai, J. Y. Liao and C. C. Hu (2008). A simplified method of constructing infectious clones of begomovirus employing limited restriction enzyme digestion of products of rolling circle amplification. J Virol Methods 147(2): 355. 40. P. S. Wyant, D. Gotthardt, B. Schafer, B. Krenz and H. Jeske (2011). The genomes of four novel begomoviruses and a new Sida micrantha mosaic virus strain from Bolivian weeds. Arch Virol 156(2): 347. 41. H. Zhang, G. Hu and X. Zhou (2010). Molecular characterization of Tomato leaf curl Hainan virus, a new begomovirus, and evidence for recombination. Journal of Phytopathology 158(11‐12): 829. CÁC TRANG WEB PHỤ LỤC Phụ lục 1: Các môi trường Môi trường LB-agar: Trypton (10 g/L), yest extract (5 g/L), NaCl (5 g/L) và agar (15 g/L). Các thành phần được hòa trong nước cất và môi trường được hấp khử trùng ở 121 0C trong 30 phút. Để môi trường nguội khoảng 55 0C rồi rót vào đĩa petri đương kính 9 cm. Các kháng sinh cần thiết được bổ sung trước khi rót môi trường ra đĩa petri. Môi trường LB lỏng: được chuẩn bị như đối với môi trường LB-agar nhưng thiếu agar. Phụ lục 2:Các dung dịch gốc và đệm EDTA (ethylenediaminetetraacetic acid) 0,5 M, pH = 8. EDTA được hòa trong nước cất và pH được chỉnh với NaOH tinh thể ( khoảng 2g / 100 mL). Dung dịch được hấp khử trùng ở 1210C trong vòng 30 phút. Chú ý: EDTA sẽ không tan cho tới khi PH ≈ 8. Tris - HCl 1M, pH = 8. Hòa Tris base (Tris kiềm) trong nước cất và chỉnh pH bằng HCl đặc (khoảng 4,2 mL /100 mL). Dung dịch được hấp khử trùng ở 1210C trong vòng 30 phút. SDS (sodium dodecyl sulfate) 20 %. Hòa SDS trong nước cất. NaOH 1 M. Hòa NaOH trong nước cất. TE, pH = 8. Tris-Cl 10 mM và EDTA 1 mM. Dung dịch đệm được chuẩn bị từ dung dịch EDTA 0,5 M (pH = 8) và Tris-Cl 10 mM (pH = 8) được hấp khử trùng ở 121 0C trong vòng 30 phút và bảo quản trong tủ lạnh thường TAE (X1): 10 mM Tris-acetate chứa 0.5 mM EDTA (pH = 7.8). Đệm đậm đặc (5X) được chuẩn bị từ Tris base (24,2 g/L), acid acetic băng (5.71 mL/L) và EDTA 0.5 M pH = 8 (10 mL / L). Đệm được hấp khử trùng ở 121 0C trong vòng 30 phút và bảo quản trong tủ lạnh thường. Đệm được sử dụng để chạy điện di gel agarose. Phụ lục 3:Trình tự toàn bộ bộ gen của VNP93, VNP698, VNP842 >VNP93-A-cg ACCGGATGGCCGCGATTTTTTTTTAACGTGGTCCCCGCACGCATGCCCGTCCAATCACAGCCATTCCTCAAAGCTTATTTATGCAGTGGTCCCCCTATATAACTTAGTCTCCAAGTACCCACATCAAAACATGTGGGATCCTTTACTAAACGAGTTTCCTGAAACCGTGCATGGTTTTAGGTGTATGTTAGCTATTAAGTATTTGCAACAAGTAGAAAATACATACTCTCCCGATACATTAGGCTACGACCTAATACGTGATCTCATCTTGGTGATTCGTGCTAGGGATTATGGCGAAGCGTCCCGCAGATATAGTCATTTCCACACCCGCCTCGAAGGTTCGTCGCCGTCTGAACTTCGACAGCCCATATCTCAGCCGTGTTGCTGCCCCCACTGTCCTCGTCACAAACAAAAAGAGGTCATGGGCCAATCGGCCCATGTACAGAAAGCCCAGGATATACAGGATGTACAAAAGCCCTGATGTTCCTCGGGGGTGTGAAGGCCCATGTAAGGTCCAGTCCTATGAACAACGGCATGATGTAGCCCATGTAGGTAAGGTA ATATGTGTCTCTGATGTCACTCGAGGTAATGGGCTGACACATCGTGTTGGTAAGAGGTTCTGTATCAAGTCTGTCTATGTACTGGGCAAAATCTGGATGGATGAGAATATTAAGACGAAGAACCATACCAATACTGTCATGTTCTTTTTAGTTCGTGATAGGAGACCATTTGGCACGCCACAGGATTTTGGTCAAGTGTTCAACATGTATGATAATGAGCCCAGTACTGCCACTGTGAAGAACGACAACAGAGATCGATTCCAAGTTCTTCGTCGTTTTCAGGCAACTGTGACAGGTGGTCAATATGCAAGCAAGGAACAAGCCATAGTTAGGAAATTTATGAAGGTCAACAATCATGTGACCTACAACCATCAAGAAGCTGCGAAGTATGACAATCACACGGAGAATGCTCTTTTATTGTATATGGCATGTACTCATGCTAGTAATCCAGTGTATGCGACCTTGAAGATCAGAATCTATTTCTATGATTCAGTTCAAAATTAATAAATATTAAATTTTATTATATCCGAAAGATGAGCATCAATTGTGCCCTCAAGTACATTGTACAATACATGTCGAATTGCCCGAATTACATTGTTGATACTAATCACTCCTAAATGGTCTAAATACTTTATACATTGGTATTTAAATACTCGTAAGAAACGCGAGGTCTGAGGACGTAAACGAGTCCAGATTTGGCAGATTAGGTAGCATTGGTGTAGTCCCAACACTCTCCTCAGGTTGTAGTTGAACTGGATCTGTACTGTGATGATGTCGTGGTTCATCATGAATGGTCTCTCGCGGTGGTGGGTTATTTTGAAATATAGGGGATTGTTGACCATCCAGATATATACGCCATTCTCTGCCTGAGCTGCAGTGATGCGTTCCCCTGTGCGTGAATCCATGGTTGTGGCAACCTAGAGCGACGAAATACGAACAACCACAAGGGAGATCAACTCTTCTCCTTCTATTGGTCTTCTTGGCGATTCGGTGTTGCACCTTGATAGGTACCTGAGTAGAGTGGGCCTTGGAGGGTGATGAAGATTGCATTCTTCACAGCCCAATTTTTAAGTGCGGTGTTCTTTTCTTCCTGCAAGAACTCTTTATAACTGGAATGTGG TCCTGGATTGCAGAGGAAGATAGTGGGAATTCCCCCTTTAATTTGAACTGGTCGCCCGTACTTGGTGTTGCTTTGCCAGTCTCTTTGGGCCCCCATAAACTCTTTAAAGTGCTTTAAGTAATGCGGATCGACGTCATCAATGACGTTATACCAAGCAGCATTACTGTACACTTTTGGACTTAAGTCTAAATGACCACATAAGTAGTTATGTGGTCCCAATGATCTGGCCCACATTGTCTTCCCCGTACGACTACCGCCCTCTACCACTATGCTTATCGGTCTTATTGGCCGCGCAGCGGCAGCACTCACATTCGCAGAAACCCACTCTTCAAGTTCTTCTGGAACTTGATCGAAAGAAGAAGACAAAAAAGGACAAACAAAAACCTCTAAAGGAGGTGTAAAAATCCTATCTAAATTACTACTTAAATTATGAAACTGTAAAACAAAATCTTTGGGAGCCTTCTCCTTTAATATATTGAGGGCCGCTGCTTTGGACCCTGAATTGATTGCCTCGGCATATGCGTCGTTGGCAGATCGGCAACCTCCTCTAGCTGATCTTC CATCGATCTGGAAAACTCCATGATCAAGCACGTCTCCGTCTTTTTCCATGTATGCTTTAACATCTGAAGAGCTCTTAGCTCCCTGAATGTTCGGATGGAAATGTGCTGACCTGCTTGGAGAGTTGAGATCGAAGAATCGGTTGTTTTGGCACTTGAATTTGCCTTCGAACTGGATGAGGACATGCAGGTGAGGAGACCCATCTTCGTGTAGCTCCCTGCAAATACGTATGAATAATTTATTAGTCGGGGTTGATAAGCCTGAGATTTGGGAAAGTGCCTCTTCTTTAGTAAGGGAGCAGTGTGGATAAGTGAGGAAATAATTCTTGGCATTTATTAAAAATTTTCTGGGCGGAGGCATATTGACTGGTCAATCAGGTCCTCTCAAACTTGGCTATGCAATCGGGGAATGGGTCCTTACTTATAGTTGAGGACCTAAATGGCATTATTGTAATTTCTTAAAGAAATTCAAATTCCAAAAGCGGCCATCCGTATAATATT >VNP93-B-cg ACCGGATGGCCGCGATTTTTTTTTAACGTGGTCCCCGCACGCGTTTGTGACATTTTCCTCATTTTGAACAATCGCATCCATTGAATCTGAACACGTGTTACGATCTTAAGGCAGGAATGTTTCCATGTCTGTTTCTATATATTTGTCCTATGTATTTCCTCACTCATTTGTAACTAAAAATGAGAGTTCCAATCCGGAGGATTTCAGGCTTCAATTCTGACCGTCGTCCTTTCAATGGCTCAATCCACCGTTGGAACTACCCATATTCCAGCTATTTTGGGAGGAGGATTGGCAACCGTGTATACGGCATGCCATTCGGAAACCAACAAGGTCAACGACGTGAGTGTAAGCAAACTCAACGTCTTACCAAGACTGTTGAGCAAGTTGCATCTAGGAGGAAGTGTATGAAGACGGTTGAGGAAATTCATGATGGTACTGACTACTTGCTGTGCAGTAACACGTCTAAGGTGTCGTACATTAGCTACCCGCCTCTATCCGGCACTGAATATGGTAGCAGAGCGGAATCCTATATCAAAGTCTTGGGAGTCACTGTATCTGGGTCTGCGGTGCTGAAGCAGACAGGCATGCGTGAAGCAGATGGGTCTCAAGGAATTCATGGGATATTTACCACAGTAATCGTTCGTGACAAGAGACCATGTCAGTTCTCTGCCGTGGATCCTATTATCCCACTTGCGGAGCTGTTTGGACAAGAGAAGAGAGCATGCTCCTCATTACGTGTTAGAGAGTCTTATAAGAATCGATTTAGTGTTGTCTACCAGAAGAAACATGTAGTAAATAGTGCTCTGTCAACACATGTATTTAGGTATAATTTCAACGTTAAATTCTCTAGGTTTCCTTTCTGGGTATCTTTCAAAGACACCTGTAACGCAGATCCTACGGGGCGATATTCCAATGTCTCTAAGAACGCATTGATTGTGTATTACGTGTGGCTATGTGATTCAAATGTAACAGCCGAAGTGCACGTACAATATGATTTGAACTACATTGGATAAATAAAATTATATTTTTTTTACATTTGAGGATACATTACTCCCCTCCATACATAGTTCAACAGTTTTTTTAATAATATTAATTACATCTTCATTCACTTTGTTGCTACCTGCAATAACCTCTGACGCCGAAGGGCCTGGATCTAGAGTTGCATCTTGTAGCTGATGCAAATGTCTATATGGGTGCTCTTCCATTTCATTGTTCCCCACGGTGCTGGCCGAAGCCCAAGTAAGCCCTTGTGGAATGGCATTTGTAGTGTATCTGGAAGACTGTGACCTCATTTGTGTTAGGGCTTGCACTGGTTTTCGTGATACAGTTGATTGAGGCACATGCCAGAAATCGATGTGATTCATGTTATACGCCTTCGATAGTATTTCAATCTTAGGGGACTTAAATGTTATTTCCGAGGACTGTTTTGCAGAGGACATTTTTAACTTTCCTTGCATCCTGCAGAAGTGAACACCATTGATCACGTTAGTGTCGTCCACCCGGTACAGCACCCTCCATGGGTTTGGGTCTTTGGGGGAGAAGTATGAGGATGAGTAGTAGTGTATATTGCAGTTGCACCCTATGGGTATTGTGAACTCAGCCTGCTTGGAGTCCCCTTCGAGCAACCTTGTGTCGTGCATCTCTATGACCACATGGCCAGTTGCATTTCCAGGAACTTGGTTCCTGTATTGGAGGATTACGTGGTCAATCCTGAGACACTTTCCTAAAAGCATCGATAATTTTTGGTCGACAGTTGATGGAAACAACAGAGTTACCTCTGTCTTTTCATTTGACAGCTGAAACTCAGTCCTAGCCGACGTCGTATAGGCAATATTGTTATTGCTGGATTCCATTATTGAGTAAGCCATTAAAATAATAGTAATTCATCTTTTATAGACTTTTCAGAGTCTGTCAGGATAGTGGAATGTGACTATTTGGGTCGTTGCCTTTAAATTCCACTATCTCAAAGCACCAGTGAGCGAAGTCCACGTATGTACTTGTACTGACAAGAGATAAGGTATATACTTGGATGTGGTTCAGCCACGTCGCATAGTCGAAAATGGAAGACATCTGTCTTCCACTAAATATTTTTGATATGTTTCGAAGTGTATTAATTTAATTAACAAGTAAATTAAACGTTAGAAATAAATATATGTACTTCAGTACCACAAGTTAGGCGCTAATCTGGACAAGATATTTGGCTCACCGAAAGAATTATTGGTTAAGCCTTATGAGTTGTCGTGTAATCGACAACCTAAACTAATATTTAACTGATCCAACAATCTAATTATGAGAAAACACACACACTTGAACATACTAATCTTGAGAAAATCAGGCCGCGCAGCGGCTATGTCCCCAAATTATTAAGTAATCCAGAAGTGCGAACCCCAATTTATTATATTCAAATCGAAAAGGACTTATATGTAATCTGTATCAGTTGAAGGTATTTAGTAGCTGTAGCTAATATTATTAAAGTTAACAACATTAATGCAATATAATTATTGCATATTTGAAGAAAATAGGGTGAATTAAAGTTTTAGAGAGAGAAAGTCTAGAGAGAAGGCAGAGCGATTGACCAGTCAATTAGGTCCTCTCAAACTTGGCTATGCAATCGGGGAATGGGTCCTTACTTATAGTTGAGGACCTAAATGGCATTATTGTAATTTCTTAAAGAAATTCAAATTCCAAAAGCGGCCATCCGTATAATATT >VNP698-A-cg ACCGGATGGCCGCGATTTTTTTTCAAGTGGTCCCCGCACGCATGCCTGTCCAATCCTGGCCACTCCTCAAAGCTTAATTATTTATGTGGTCCCCTATATAACTTAGTCTCCAAGTACCCACATCAAAACATGTGGGATCCTTTACTAAACGAGTTTCCTGAAACCGTACATGGTTTTAGGTGTATGTTAGCTATTAAGTATTTGCAAGTAGTAGAAAATACATACTCTCCCGATACACTAGGCTACGATCTAATACGTGATCTTATCCTGGTGATTCGTGCTAGGGATTATGGCGAAGCGTCCCGCAGATATAGTCATTTCCACTCCCGCCTCGAAGGTTCGTCGCCGTCTGAACTTCGACAGCCCATATCTCAGCCGTGCTGCTGCCCCCACTGTCCTCGTCACAAACAAAAAGAGGTCGTGGGCCAATCGGCCCATGTACAGAAAGCCCAGGATATACAGGATGTACAAAAGCCCTGATGTTCCGCGGGGCTGTGAAGGCCCATGTAAGGTCCAGTCCTATGAACAACGTCATGACGTAGCCCATGTAGGTAAGGTAA TTTGTGTTTCAGATGTCACCCGAGGTAATGGGCTCACACATCGTGTTGGTAAGAGGTTCTGTATCAAGTCCGTGTATGTGTTGGGCAAAATCTGGATGGATGAGAATATCAAGACAAAGAACCATACTAATACGGTCATGTTCTTCTTAGTTCGTGATAGGAGACCATTTGGCACGCCACAGGATTTTGGGCAGGTGTTCAACATGTATGATAATGAGCCTAGTACTGCCACTGTGAAGAACGACAATAGAGATCGATTCCAAGTCCTTCGTCGTTTTCAGGCAACTGTGACAGGTGGTCAATATGCAAGCAAGGAGCAAGCCATAGTTAGGAAATTCATGAAGGTGAACAACCATGTGACCTACAACCATCAAGAAGCTGCGAAGTATGACAACCACACGGAGAATGCCCTTTTATTGTATATGGCATGTACGCATGCCAGTAATCCAGTGTATGCGACCTTGAAGATCAGAATCTATTTCTATGATTCGGTTCAAAATTAATAAATATTGAATTTTATTATATCCGAAAGATGAGCATCTATTGTGCCCTCAAGTACATTGTACAATACATGTCTAATTGCTCTAATAACATTGTTGATGCTAATAACTCCTAAACGGTCTAAATACTTTATACATTGGTATCTAAATACTCTTAAGAAACGCAAGGTCTGAGGACGTAAACGAGTCCAGATTTGGCAGATTAGATGTCCCAACGCTTTCCTCAGGTTGTAGTTGAACCGGATCTGCACTGTGATTATGTCGTGGTTCATCATGAATGGTCTCTCGCGGTGGTGGGTTATGTTGAAATAGAGGGGATTGTTGACCGTCCAGATATACACGCCATTCTCTGCCTGAGCTGCAGTGATGCGTTCCCCTGTGCGTGAATCCATGGTTGTGGCAACCTAGAGCGACGAAGTACGAACAACCACAAGGGAGATCAATTCTTCTCCTTCTATTGGTCTTCTTGGCGATTCGGTGTTGCACCTTGATTGGTACCTGAGTAGAGTGGGCCTTGGAGGGTGACGAAGATTGCATTCTTTAAAGCCCAATGTTTTAGTGCGGTGTTCTTTTCCTCTTCCAAGAACTCTTTATAGCTGGAATGTGGTCCTGGATTGCAGAGGAAGATAGTTGGAATCCCGCCTTTAATTTGGACCGGTTTCCCGTACTTGGTGTTGCTTTGCCAGTCTCTTTGGGCCCCCATGAACTCTTTAAAGTGCTTTAGATAATGCGGATCGACGTCATCAATGACGTTATACCAAGCAGCATTATTGAACACTTTAGGACTTAAGTCTAAATGCCCACATAAGTAGTTATGTGGGCCCAACGACCTGGCCCACATTGTCTTC CCTGTACGACTATCGCCCTCTAACACAATGCTTATCGGTCTTAATGGCCGCGCAGCGGCACTAACAACGTTTCCGGCAACCCATTCATCAAGTTCCTCGGGAACTTGGTCAAAAGAAGAAGACGAAAAAGGACAAACAAAAACCTCTAAAGGAGGTGCAAAAATCCTATCTAAATTACTATGTAAATTATGAAACTGTAAAACAAAATCTTTGGGGGCCTTCTCCTTTAATATATTGAGGGCCTCTGCTTTGGACCCTGAATTGATTGCCTCGGCATATGCGTCGTTGGCAGATCGGCAACCTCCTCTAGCTGATCTGCCATCGATCTGGAAAACTCCATGATCAAGCACGTCTCCGTCTTTCTCCATGTATGCTTTAACATCTGAAGAGCTCTTAGCTCCCTGAATGTTTGGATGGAAATGTGCTGACCTGGTTGGGGATCTGAGGTCGAAGAACCTTTGATTTTTGCATTGGAATTTACCTTGGAATTGGATGAGGACATGCAAGTGAGGAGTCCCATCTTCGTGCAATTCCCTGCAAATCCTGATAAACAGTTTATT TGTTGGTGTTTCTATGGCTTGAATTTGGGAAAGGGCCTCTTCTTTTGTGAGAGAGCAGTGTGGGTATGTGAGGAAATAGTTTTTAGCATTTATTCTGAATTTGTTTGGAGGAGCCATTGACCGGTCAATCGGTGTCTCTCAACTTGGGCTATGTAATTGGTGTCTGGGGTCTTATTTATATGGAGACCCTAAATGGCATTATTGTAATTTCTTAAAGAAATTCAAATTCCAAAAGCGGCCATCCGTATAATATT >VNP842 ACCGGATGGCCGCGATTTTTTTTACATGGTCCCCACCACTAACAAATGTTCTCCACTTAGAACGCTCCCTCAAAGCCTATTTAATTCAAATCCATTATATATACTTGGTCCCCAAGTACTCACTTTAAAATATGTGGGATCCTTTACTGAATGAGTTTCCCGAAACCGTACACGGTTTTAGGTGTATGTTAGCGATTAAATATTTGCAATTAGTAGAAAATACATACTCTCCTGATACATTAGGGTACGATTTGCTTCGTGATTTAATTTCAGTTATTCGTGCTAAGGACTATGTCGAAGCGTCCCGCAGATATAGTCATTTCCACTCCCGCATCCAAGGTGCGTCGCCGGCTGAATTTCGACAGCCCGTATGCCAGCCGTGCTGCTGCCCCCACTGTCCTCGTCACAAACAAAAGGAGGTCATGGGTGAATCGGCCCATGTACCGAAAGCCCAGGATGTACAGAATGTACAAAAGCCCTGATGTTCCTCGAGGATGTGAAGGCCCATGTAAGGTTCAGTCCTATGAACAGCGTCATGATGTAGCGCACGTAGGTAAAGT CATTTGTGTGTCTGATGTTACTCGTGGTAACGGGTTGACTCATCGAGTGGGAAAGAGGTTTTGTGTTAAGTCTGTTTATGTTTTGGGCAAGATATGGATGGATGAGAACATTAAGACCAAGAATCACACTAATACTGTGATGTTTTTTTTAGTGCGTGATAGGAGACCATTTGGGACTCCACAGGATTTTGGTCAGGTGTTTAACATGTATGATAACGAGCCAAGTACAGCCACGGTGAAGAACGACAACAGAGATCGCTTTCAAGTTCTACGGCGTTTTCAGGCTACTGTTACTGGTGGTCAGTATGCAAGTAAGGAGCAAGCAATAGTTAGGAAGTTTATGAAGGTGAACAACCATGTGACGTATAATCATCAAGAAGCTGCGAAGTATGACAATCACACAGAGAATGCTCTTTTGTTGTATATGGCATGTACTCATGCTAGTAATCCTGTGTATGCTACTTTGAAAATCAGAATCTATTTCTATGATTCTGTTCAGAATTAATAAAGATTGAATTTTATTATATTTGAATGTGTTACATATTCTGTTTTTTCCAATA CATCCCATAATACATGATCACATGCTCTAATTACATTGTTAATACTAATTACACCCAAATTATCTAAATATTTCATACATTGAACCCTAAATACTCTTAAGAAACGCCAAGTCTGAGGACGTAAACGAGTCCAGATCTGGAAGATTAGAAAACATTGGTGTATTCCCAACGCTTTCCTCAGGTTGTAATTGAATTGGACTTGTATTGTGATGATGTCGTTGTTCATCAGAAATGGTCTCTCGTCGTGGCTGATTATCTTGAAATATAGGGGATTTTTGACCGTCCAGATATATACGCCACTCTCTGCTTGAGTTGCAGTGATAGCTTCCCCTGTGCGAGAATCCATGATTGTGACAGCCTAGTGCAATGAAGTATGAACAACCACAAGGGAGATCAACTCTCCGTCTCCTCGTTGCTTTCTTGGCGTTGCGGTGTTGCACTTTGATAGGAACCTGAGTAGAGTGCGCCTTGGAGGGTGACGAAGATCGCATTTTTTATTGCCCAGTTTTTAAGTGCGCTGTTTTTATCTTCGTCCAAGAATTCTTTATAGCTTGAATTGG GGCCGGGATTGCAGAGGAAGATAGTGGGAATTCCCCCTTTAATTTGAACGGGTTTTCCGTACTTTGTGTTGCTTTGCCAGTCCCTTTGGGCCCCCATGAATTCTTTAAAATGCTTTAGGTAGTGCGGATCAACGTCATCAATGACGTTGTACCAGGCATCATTATTGTATACCTTCGGACTCAAATCAAGATGACCACACAAATAATTATGTGGTCCTAATGACCTAGCCCACATCGTCTTTCCCGTCCGACTATCGCCTTCGATAACTATACTTATCGGTCTTAAAGGCCGCGCAGCGGCACTGACAACGTTCTCTGCAGCCCACTCTTCGAGTTCCTCTGGAACTCGATCAAACGAAGAAGAAGAAAAAGGCGAAACATAAACCTCCATTGGAGGAGTAAAAATCCTATCTAAATTATTATTTAAATTATGAAACTGTAAAACATAATCTTTAGGTGCCTTTTCCCTTAGTATATTGAGGGCCGAAGCTTTGGACCCTGAATTGATTGCCTCGGCATATGCGTCGTTGGCAGATTGGCAACCTCCTCTAGCCGATCTT CCATCGATCTGGAAAAGTCCATGATCAAGCACGTCTCCGTCTTTGTCCATATAGGACTTGACATCTGTTGAGCTTTTAGCTGCCTGAATGTTCGGATGGAAATGTGCTGACCTGCTTGGGGATATGAGATCGAAGAATCTTTGGTTTTTACATTGGAATTTCCCTTCGAATTGGATGAGAACATGCAGGTGAGGAGTTCCATCTTCGTGGAATTCTCTGCAGATGCGGATAAATAGTTTATTTACTGGGGTTTCTAGGTTTTTAAGTTGGGAAAGTGCTTCTTCTTTAGTGAGAGAGCAGTGTGGATATGTGAGGAAATAATTTTTGGCATTTATTCTGAATTTATTAGGAGGAGCCATTGACTGGTCAATCGGTGTCTCATAAACTTGGCTATGCAATTGGTGTCTGGTGTCTTATTTATATGTGGACACCAAATGGCATTATCGTAATTCCCAAAAGAAATTCAAAATTCAAATTGGTAAAGCGGCCATCCGTATAATATT

Các file đính kèm theo tài liệu này:

  • docxkhoa_luan_4977_2081723.docx