Luận văn Chẩn đoán và đặc điểm sinh học của begomovirus hại ớt

Các dòng vi khuẩn A.tumerfaciens có chứa cấu trúc xâm nhiễm của PepYLCVNV chứa bộ gen (DNA-A và DNA-B) riêng rẽ, đã được nuôi trong môi trường LB–lỏng. Dịch vi khuẩn thu được sau khi nuôi lỏng, lắc được mang đi li tâm lấy cặn vi khuẩn và hòa tan cặn vi khuẩn bằng đệm MgCl2 cùng với 1 µl/ml Acetonringone 0.1M giúp kích thích sự phát triển của vi khuẩn trong tế bào ký chủ. Sau đó dịch vi khuẩn được sử dụng để lây nhiễm bằng cách tiêm trực tiếp vào mô lá và thân khi cây ở giai đoạn có 3-4 lá thật. Cây thí nghiệm là cà chua mẫn cảm giống Hồng Lan và cây chỉ thị: thuốc lá cảnh (Nicotiana benthamiana). Các công thức thí nghiệm bao gồm: 1. Chỉ lây nhiễm một mình dòng VNP1500-1(A) 2. Lây nhiễm hỗn hợp 2 dòng vi khuẩn: VNP1500-1(A) và VNP1500-20(B) 3. Đối chứng: không tiêm Vì nhiệt độ tối thích cho vi khuẩn A. tumefeciens chuyển gen là 28oC–30oC nên cây thí nghiệm được chuyển vào phòng điều hòa nhiệt độ ở 28oC trước, sau và trong suốt quá trình lây nhiễm nhân tạo để tạo

docx111 trang | Chia sẻ: anhthuong12 | Ngày: 26/09/2020 | Lượt xem: 8 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận văn Chẩn đoán và đặc điểm sinh học của begomovirus hại ớt, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
TH05 Chỉ thiên Chùn ngọn, khảm quả chín Hoài Đức - Hà Nội 2017 0.162 - 0.288 - 67 TH06 Ớt ngọt Xoăn lá, khảm vàng ra hoa, đậu quả Cổ Nhuế 2 - Hà Nội 2017 0.180 - 0.551 + 68 TH07 Chỉ thiên Khảm, phiến lá dài ra hoa, đậu quả Thạch Thất - Hà Nội 2017 0.196 - 0.189 - 69 TH08 Chỉ thiên Khảm ra hoa, đậu quả Hoài Đức - Hà Nội 2017 0.169 - 0.216 - 70 TH09 Chỉ thiên Chùn ngọn quả chín Cổ Nhuế 2 - Hà Nội 2017 0.174 - 0.205 - 71 TH10 Chỉ thiên Khảm, phiến lá dài quả chín Phúc Thọ - Hà Nội 2017 0.168 - 0.191 - 72 TH11 Ớt ngọt Cuốn lá quả chín Cổ Nhuế 2 - Hà Nội 2017 0.168 - 0.223 - OD: Mật độ quang học đo bước sóng 405 nm; ( -) : Cây không nhiễm bệnh; (+): Cây nhiễm bệnh; KL: Kết luận. Bảng 4.6. Kết quả phát hiện Begomovirus trên ớt bằng TAS-ELISA (tiếp) STT Mã mẫu Giống Triệu chứng Giai đoạn Địa điểm Năm thu TYLCTHV TYLCVs OD KL 73 TH12 Chỉ thiên Xoăn lá, khảm vàng ra hoa, đậu quả Cổ Nhuế 2 - Hà Nội 2017 0.183 - 0.198 - 74 TH13 Chỉ thiên Cuốn lá ra hoa, đậu quả Thạch Thất - Hà Nội 2017 0.176 - 0.236 - 75 TH14 Chỉ thiên Khảm xanh quả chín Phúc Thọ - Hà Nội 2017 0.186 - 0.235 - 76 TH15 Chỉ thiên Khảm vàng ra hoa, đậu quả Phúc Thọ - Hà Nội 2017 0.175 - 0.187 - 77 TH16 Chỉ thiên Xoăn lá, khảm vàng ra hoa, đậu quả Hoài Đức - Hà Nội 2017 0.169 - 0.210 - 78 TH17 Ớt ngọt Xoăn lá, khảm vàng ra hoa, đậu quả Cổ Nhuế 2 - Hà Nội 2017 0.184 - 0.196 - 79 TH18 Chỉ thiên Xoăn lá quả chín Thạch Thất - Hà Nội 2017 0.182 - 0.227 - 80 TH19 Chỉ thiên Xoăn nhẹ ra hoa, đậu quả Thạch Thất - Hà Nội 2017 0.167 - 0.235 - 81 TH20 Chỉ thiên Khảm nhẹ ra hoa, đậu quả Phúc Thọ - Hà Nội 2017 0.155 - 0.226 - 82 Đối chứng (-) 0.200 - 0.301 - 83 Đối chứng (-) 0.244 - 0.268 - 84 Đối chứng (-) 0.209 - 0.354 - Ngưỡng nhiễm 0.264 0.395 Số mẫu dương 0 1 Tổng số mẫu 81 81 Tỉ lệ nhiễm bệnh 0.00 1.23 OD: Mật độ quang học đo bước sóng 405 nm; ( -) : Cây không nhiễm bệnh; (+): Cây nhiễm bệnh; KL: Kết luận. Hình 4.6. Phát hiện TYLCVs trên ớt bằng DAS-ELISA 4.3. PHÁT HIỆN CÁC BEGOMOVIRUS VÀ PEPYLCVNV BẲNG PCR 4.3.1. Phát hiện begomovirus bằng PCR dùng mồi chung Mục đích: Chúng tôi tiến hành kiểm tra các mẫu ớt thu thập tại Việt Nam bằng phản ứng PCR sử dụng cặp mồi chung phát hiện begomovirus là BegoA-F1 và BegoA-R1. Kết quả kiểm tra ELISA cho thấy, nhiều mẫu với triệu chứng rất điển hình như khảm vàng, cuốn lá, biến dạng lá lại không dương với các virus được kiểm tra. Chính vì thế chúng tôi nghi ngờ các mẫu trên có thể nhiễm begomovirus. Vì vậy, chúng tôi chọn một số mẫu âm với các virus được kiểm tra, cùng với một số mẫu nghi ngờ nhiễm begomovirus đã thu thập được để kiểm tra PCR. Tiến hành tạo phản ứng PCR với cặp mồi chung đặc hiệu cho phân tử DNA-A của nhiều loài thuộc chi Begomovirus là BegoARev1 và BegoAFor1. Chúng tôi đã kiểm tra 18 mẫu, trong đó có 14 mẫu ớt và 4 mẫu cà chua.. Kết quả kiểm tra (bảng 4.7) cho thấy, đã phát hiện thấy 10 mẫu phản ứng PCR (+), tức là cây nhiễm bệnh chiếm tỷ lệ 55,56%. Trong số 6 mẫu ớt có phản ứng (+) đều là các mẫu thu tại miền Nam và miền Trung trong giai đoạn 2012-2013; cả 4 mẫu cà chua đều có phản ứng dương (2 mẫu ở miền Nam và 2 mẫu ở miền Trung) . Các mẫu có phản ứng dương với cặp mồi chung BegoA–For1/BegoA–Rev1 tạo các băng đơn trên bản gel, trùng kích thước sản phẩm băng điện di mong muốn là ~1.2 kb, mẫu đối chứng dương có phản ứng. Như vậy, kết quả kiểm tra đã xác nhận sự có mặt của begomovirus trong 10 mẫu (6 mẫu ớt và 4 mẫu cà chua) được kiểm tra. Bảng 4.7. Kết quả kiểm tra các mẫu ớt và cà chua bằng PCR sử dụng cặp mồi BegoA – For1 và BegoA – Rev1 STT Mã mẫu Cây Giống Triệu chứng Giai đoạn Địa điểm Năm thu Kết quả PCR 1 TH3 Ớt Chỉ thiên Chùn ngọn, khảm, đốm vàng ra hoa, đậu quả Thạch Thất - Hà Nội 2017 - 2 TH4 Ớt Chỉ thiên Chùn ngọn, đốm vàng quả chín Cổ Nhuế 2 - Hà Nội 2017 - 3 TH5 Ớt Chỉ thiên Chùn ngọn, khảm, đốm vàng quả chín Hoài Đức - Hà Nội 2017 - 4 TH6 Ớt Ớt ngọt Xoăn lá, khảm vàng ra hoa, đậu quả Cổ Nhuế 2 - Hà Nội 2017 - 5 TH8 Ớt Chỉ thiên Khảm ra hoa, đậu quả Hoài Đức - Hà Nội 2017 - 6 VNP93 Ớt Chỉ thiên Xoăn vàng lá ra hoa Túy Loan- Đà Nẵng 2012 + 7 VNP624 Ớt Chỉ địa Xoăn vàng lá cây con Túy Loan - Đà Nẵng 2012 + 8 VNP636 Ớt India Xoăn vàng lá cây con Điện Bàn - Quảng Nam 2013 + 9 VNP648 Ớt Chỉ địa Xoăn vàng lá cây con Phù Cát - Bình Định 2013 + 10 VNP673 Ớt Chỉ thiên Xoăn vàng lá cây con Châu Thành - An Giang 2013 + 11 VNP675 Ớt Chỉ thiên Xoăn vàng lá cây con Cao Lãnh - Đồng Tháp 2013 + 12 VNP701 Ớt 2 mũi tên Vàng lá thu quả Châu Thành - An Giang 2013 - 13 VNP717 Ớt Chỉ thiên Lá nhỏ, cứng, vàng thu quả Bình Thủy- Cần Thơ 2013 - 14 VNP839 Ớt Chỉ thiên Lá với ngọn xoăn nhỏ thu quả Đơn Dương – Lâm Đồng 2013 - 15 VNP97 Cà chua Hồng Lan Xoăn vàng lá, khảm lá thu quả Túy Loan- Đà Nẵng 2013 + 16 VNP164 Cà chua Hồng Lan Xoăn vàng lá, khảm lá thu quả Đông Quang - Gia Lai 2013 + 17 VNP310 Cà chua Hồng Lan Xoăn vàng lá, khảm lá thu quả Long Xuyên – An Giang 2013 + 18 VNP759 Cà chua Hồng Lan Xoăn vàng lá, khảm lá thu quả Đông Kbang – Gia Lai 2013 + Số mẫu dương/Tổngsố mẫu thử 10/18 Tỷ lệ(%) 55,56 Hình 4.7. Triệu chứng begomovirus trên ớt Thứ tự các giếng từ 1 đến 11: Đối chưng (+) à TH3à TH4à TH5à TH6à TH8à VNP93à VNP624à VNP636 àVNP648àVNP673à VNP675. M là thang DNA 1 kb. Thứ tự các giếng từ 12 đến 18: VNP701à VNP717à VNP839à VNP97 à VNP164à VNP310à VNP759. M là thang DNA 1 kb. Hình 4.8. Hình ảnh kiểm tra các mẫu ớt và cà chua bằng PCR sử dụng cặp mồi BegoA-For1 và BegoA-Rev1 4.3.2. Phát hiện TYLCKaV bằng PCR dùng mồi đặc hiệu Tomato yellow leaf curl Kachanaburi virus (TYLCKaV) là 1 begomovirus đã được phát hiện thấy trên cây họ cà gồm cà chua và cà pháo tại miền Nam Việt Nam (Ha et al., 2008). Kết quả kiểm tra được trình bày ở bảng 4.8. Sau khi kiểm tra 18 mẫu bệnh bằng PCR sử dụng cặp mồi chung BegoA-For1/Rev1 kết quả cho thấy có 10 mẫu ớt và cà chua có phản ứng (+). Nhằm kiểm tra liệu begomovirus có phải là TYLKaV hay không, chúng tôi đã tiến hành kiểm tra 9 mẫu có phản ứng (+) với cặp mồi chung gồm 5 mẫu ớt và 4 mẫu cà chua. Cặp mồi sử dụng là cặp mồi đặc hiệu với DNA-A của TYLCKaV: TYKa-A–F1/R1. Kết quả được thể hiện ở bảng 4.8 và hình 4.9 cho thấy trong số 9 mẫu kiểm tra chỉ có duy nhất 1 mẫu cà chua VNP310 thu tại An Giang có phản ứng PCR dương tính với cặp mồi này chứng tỏ mãu này bị nhiễm TYLCKaV. Kết quả này chứng tỏ ớt và cà chua tai miền Nam Việt Nam còn nhiễm thêm các begomovirus khác. Bảng 4.8. Kết quả kiểm tra các mẫu ớt và cà chua bằng PCR sử dụng cặp mồi đặc hiệu TYKa-A–F1/R1 STT Mã mẫu Giống Triệu chứng Địa điểm Năm thu Kết quả PCR 1 VNP624 Ớt chỉ địa Xoăn vàng lá Túy Loan - Đà Nẵng 2012 - 2 VNP636 Ớt India Xoăn vàng lá Điện Bàn - Quảng Nam 2013 - 3 VNP648 Ớt chỉ địa Xoăn vàng lá Phù Cát - Bình Định 2013 - 4 VNP673 Ớt chỉ thiên Xoăn vàng lá Châu Thành - An Giang 2013 - 5 VNP675 Ớt chỉ thiên Xoăn vàng lá Cao Lãnh - Đồng Tháp 2013 - 6 VNP97 Cà chua Hồng Lan Xoăn vàng lá Túy Loan - Đà Nẵng 2013 - 7 VNP164 Cà chua Hồng Lan Xoăn vàng lá Đông Quang - Gia Lai 2013 - 8 VNP310 Cà chua Hồng Lan Xoăn vàng lá Long Xuyên - An Giang 2013 + 9 VNP759 Cà chua Hồng Lan Xoăn vàng lá Đông Kbang - Gia Lai 2013 - Số mẫu dương/Tổng số mẫu thử 1/9 Tỷ lệ(%) 11,1 Thứ tự các giếng từ 1 đến 9: VNP624à VNP636 àVNP648àVNP673à VNP675à VNP97 à VNP164à VNP310à VNP759. M là thang DNA 1 kb. Mũi tên chỉ băng có kích thước mong muốn. Hình 4.9. PCR phát hiện TYLCKaV trên mẫu ớt và cà chua (dương tính với begomovirus) bằng cặp mồi đặc hiệu TYKa-A–F1/R1 4.3.3. Phát hiện PepYLCVNV bằng PCR dùng mồi đặc hiệu Bên cạnh TYLCKaV, chúng tôi cũng tiếp tục kiểm tra sự có mặt của PepYLCVNV trên các mẫu có phản ứng (+) với cặp mồi chung BegoA For1/Rev1trên sử dụng các mồi đặc hiệu cho cả 2 thành phần DNA-A và DNA-B của virus này là VNP93–A-F1/VNP1500–A-R1 (đặc hiệu DNA-A) và cặp mồi 1500–B–F1/R2 (Đặc hiệu DNA-B). Kết quả bảng 4.9 và hình 4.9 cho thấy có 8/9 mẫu có phản ứng dương (88,89%) trên cả DNA-A và DNA-B; 8 mẫu có phản ứng dương với DNA-A đều có phản ứng dương với DNA-B. Trong số 4/5 mẫu ớt kiểm tra được thu thập trong gian đoạn 2012-2013 và tất cả 4 mẫu cà chua thu thập năm 2013 tại miền Trung và miền Nam của Việt Nam có phản ứng dương với cặp mồi đặc hiệu VNP93–A-F1/VNP1500–A-R1 và cặp mồi 1500–B–F1/R2. Điều đó cho thấy tỉ lệ nhiễm bệnh PepYLCVNV là rất cao. Đáng chú ý, sản phẩm PCR của cả DNA-A và DNA-B của 3 mẫu cà chua dương tính thu tại miền Nam đều mờ hơn rõ rệt so với các mẫu cũng gợi ý có một mức độ biến động trên trình tự gen, ít nhất tại các vị trí gắn mồi của PepYLCVN trên 3 mẫu cà chua miền Nam so với các mẫu ớt và cà chua thu tại miền Trung. Như vậy trong chẩn đoán Begomovirus hại ớt dùng phương pháp PCR có kết quả kiểm tra chính xác hơn kiểm tra bằng phương pháp TAS-ELISA. Chính vì vậy muốn khẳng định chắc chắn mẫu kiểm tra có nhiễm bệnh không nên kiểm tra lại bằng PCR. Virus hại trên ớt ở Việt Nam là PepYLCVNV. Bảng 4.9. PCR phát hiện PepYLCVNV trên các mẫu ớt và cà chua sử dụng cặp mồi đặc hiệu VNP93–A-F1/1500–A-R1 và 1500–B–F1/R2. STT Mã mẫu Giống Triệu chứng Địa điểm Năm thu Kết quả PCR DNA-A DNA-B 1 VNP624 Ớt chỉ địa Xoăn vàng lá Túy Loan - Đà Nẵng 2012 + + 2 VNP636 Ớt India Xoăn vàng lá Điện Bàn - Quảng Nam 2013 + + 3 VNP648 Ớt chỉ địa Xoăn vàng lá Phù Cát - Bình Định 2013 - - 4 VNP673 Ớt chỉ thiên Xoăn vàng lá Châu Thành - An Giang 2013 + + 5 VNP675 Ớt chỉ thiên Xoăn vàng lá Cao Lãnh - Đồng Tháp 2013 + + 6 VNP97 Cà chua Hồng Lan Xoăn vàng lá Túy Loan - Đà Nẵng 2013 + + 7 VNP164 Cà chua Hồng Lan Xoăn vàng lá Đông Quang - Gia Lai 2013 + + 8 VNP310 Cà chua Hồng Lan Xoăn vàng lá Long Xuyên - An Giang 2013 + + 9 VNP759 Cà chua Hồng Lan Xoăn vàng lá Đông Kbang - Gia Lai 2013 + + Số mẫu dương/ Tổng số mẫu thử 8/9 8/9 Tỷ lệ(%) 88,89 88,89 Thứ tự các giếng từ 1-9: VNP93à VNP624à VNP636 àVNP648àVNP673à VNP675à VNP97 à VNP164à VNP310à VNP759 àMarker à VNP93à VNP624à VNP636 àVNP648àVNP673à VNP675à VNP97 à VNP164à VNP310à VNP759. M là thang DNA 1 kb. Mũi tên chỉ kích băng có kích thước mong muốn Hình 4.10. PCR phát hiện PepYLCVNV trên mẫu ớt và cà chua (dương tính với begomovirus) bằng cặp mồi đặc hiệu DNA-A (VNP93–A-F1/VNP1500–A-R1) và đặc hiệu DNA-B (VNP1500–B–F1/R2) 4.4. ĐÁNH GIÁ TÍNH GÂY BỆNH CỦA PEPYLCVNV ĐƯỢC BẰNG LÂY NHIỀM NHÂN TẠO 4.4.1. Đánh giá tính gây bệnh của PepYLCVNV được bằng lây nhiềm nhân tạo dùng kĩ thuật Agroinoculation Cà chua và ớt là những cây trồng quan trọng trong nền nông nghiệp hiện nay của nước ta. Trong đó, cây ớt được coi là một trong năm loại cây trồng chủ lực trong chương trình chọn tạo giống rau của Bộ nông nghiệp và phát triển nông thôn trong giai đoạn 2006-2010. Vì vậy việc phát hiện virus PepYLCVNV gây hại trên cà chua và cây ớt rất có ý nghĩa trong thực tiễn cũng như nghiên cứu khoa học. Đây là loài virus mới được phát hiện tại Việt Nam nên trên thế giới cũng như ở Việt Nam chưa có nhiều tài liệu cũng như công trình nghiên cứu về loài virus PepYLCVNV này. Mục tiêu của phần nghiên cứu này là đánh giá tính gây bệnh của virus trên cà chua cũng như cây chỉ thị họ cà là thuốc lá cảnh N. benthamiana. Chúng tôi sử dụng phương pháp tiêm trực tiếp vi khuẩn vào mô cây (Kheyr-Pour et al., 1991) để thực hiện kĩ thuật lây nhiễm này. Đây là phương pháp tiêm trực tiếp dung dịch vi khuẩn chứa các cấu trúc xâm nhiễm của PepYLCVNV vào mô lá và chồi nách của cây, cây ở giai đoạn 3-4 lá thật. 4.4.1.1. Phục hồi các dòng vi khuẩn A. tumefaciens mang 2 cấu trúc xâm nhiễm của PepYLCVNV Lấy cặp dòng vi khuẩn AT-VNP1500-1 (mang cấu trúc xâm nhiễm của DNA-A) và AT-VNP1500-20 (mang cấu trúc xâm nhiễm của DNA-B) bảo quản ở -80oC để làm nguồn lây nhiễm. Hai dòng này sau khi phục hồi được bảo quản ngắn hạn trong nước cất vô trùng ở điều kiện 4oC cho các nghiên cứu lây nhiễm trong quá trình thực tập. Hai dòng vi khuẩn trên được cấy zic zắc trên môi trường LB-agar có bổ sung thêm ba loại kháng sinh Streptomycin, Rifamycin, Kanamycin. Nuôi vi khuẩn trong điều kiện nhiệt độ dưới 280C và đánh giá kết quả sau 1-2 ngày. Sau 1 ngày thì vi khuẩn bắt đầu mọc, đến ngày thứ 2 nhìn chung các dòng vi khuẩn nuôi cấy trên môi trường LB–agar, có khuẩn lạc mọc đều và đẹp, khuẩn lạc hình tròn, màu trắng sữa, rìa nhẵn, bề mặt khuẩn lạc ướt (hình ảnh 4.11). Khuẩn lạc đặc trưng cho dòng vi khuẩn Agrobacterium. Hình 4.11. Hình ảnh khuẩn lạc trên môi trường LB-Agar sau 2 ngày nuôi cấy 4.4.1.2. Kết quả đánh giá tính gây bệnh của PepYLCVNV bằng phương pháp Agroinoculation Các dòng vi khuẩn A.tumerfaciens có chứa cấu trúc xâm nhiễm của PepYLCVNV chứa bộ gen (DNA-A và DNA-B) riêng rẽ, đã được nuôi trong môi trường LB–lỏng. Dịch vi khuẩn thu được sau khi nuôi lỏng, lắc được mang đi li tâm lấy cặn vi khuẩn và hòa tan cặn vi khuẩn bằng đệm MgCl2 cùng với 1 µl/ml Acetonringone 0.1M giúp kích thích sự phát triển của vi khuẩn trong tế bào ký chủ. Sau đó dịch vi khuẩn được sử dụng để lây nhiễm bằng cách tiêm trực tiếp vào mô lá và thân khi cây ở giai đoạn có 3-4 lá thật. Cây thí nghiệm là cà chua mẫn cảm giống Hồng Lan và cây chỉ thị: thuốc lá cảnh (Nicotiana benthamiana). Các công thức thí nghiệm bao gồm: Chỉ lây nhiễm một mình dòng VNP1500-1(A) Lây nhiễm hỗn hợp 2 dòng vi khuẩn: VNP1500-1(A) và VNP1500-20(B) Đối chứng: không tiêm Vì nhiệt độ tối thích cho vi khuẩn A. tumefeciens chuyển gen là 28oC–30oC nên cây thí nghiệm được chuyển vào phòng điều hòa nhiệt độ ở 28oC trước, sau và trong suốt quá trình lây nhiễm nhân tạo để tạo điệu kiện cho vi khuẩn hoạt động thuận lợi. Sau đó cây thí nghiệm được chuyển ra nhà lưới và đề đảm bảo cho cây sạch bọ phấn tất cả cây thí nghiệm được xử lý bằng thuốc trừ côn trùng chích hút với mật độ phun 2 tuần/lần. Thí nghiệm lây nhiễm Agroinoculation được minh họa ở hình 4.12. Hình 4.12. Phương pháp tiêm trực tiếp dịch vi khuẩn vào mô lá a. Tính gây bệnh của chỉ DNA-A của PepYLCVNV mẫu VNP1500 (lây nhiễm bằng agroinoculation) PepYLCVNV là một begomovirus có bộ gen kép (có cả DNA-A và DNA-B). Tuy nhiên, nhiều begomovirus có bộ gen đơn đã được chứng minh là có thể tạo ra triệu chứng điển hình mà không cần sự có mặt của DNA-B chẳng hạn như đối với Tomato yellow curly shoot virus (TYLCSV) (Kheyr-Pour et al., 1991). Trần Thị Chi (2013) đã thí nghiệm lây nhiễm nhân tạo và kết luận DNA-A của PepYLCVNV cũng có có thể gây bệnh trên cà chua. Trong nghiên cứu này, chúng tôi tiến hành lặp lại thí nghiệm của Trần Thị Chi (2013) để khẳng định chính xác tính gây bệnh của DNA-A của PepYLCVNV. Thí nghiệm được thực hiện với một loạt cây bao gồm cà chua, là ký chủ tự nhiên của PepYLCVNV và cây trồng mẫn cảm với begomovirus như thuốc lá cảnh N. benthamiana. Triệu chứng mỗi lần lây đều được theo dõi ở tuần 1, 2, 3, 4 sau khi lây. Kết quả thí nghiệm được trình bày ở bảng 4.11. Bảng 4.11. Lây nhiễm nhân tạo bằng agroinoculation DNA-A của PepYLCVNV mẫu VNP1500 trên cây cà chua và thuốc lá cảnh N. benthamiana Lần lây nhiễm Tên giống Số cây lây Số cây có triệu chứng Số cây PCR (+)/ số cây kiểm tra 1 Cà chua Hồng Lan 10 0 Không kiểm tra Thuốc lá cảnh N. benthamiana 10 0 2 Cà chua Hồng Lan 10 0 Thuốc lá cảnh N. benthamiana 10 0 Lần lây nhiễm 1: ngày 15/11/2017; Lần lây nhiễm 2: ngày 15/12/2017. Kết luận: Qua các thí nghiệm lây nhiễm chỉ thành phần DNA-A của PepYLCVNV mẫu VNP1500 trên 2 giống: cà chua Hồng Lan và thuốc lá cảnh N. benthamiana chúng tôi kết luận DNA-A của mẫu virus này không có cảm ứng tạo triệu chứng trên cả hai cây được dùng làm thí nghiệm. Chính vì thế mà chúng tôi tiếp tục tiến hành thí nghiệm tiếp theo liên quan đến tính gây bệnh của PepYLCVNV bằng cách lây nhiễm đồng thời cả DNA-A và DNA-B. b. Tính gây bệnh của cả DNA-A & DNA-B của PepYLCVNV mẫu VNP1500 (lây nhiễm bằng agroinoculation) Giống như kiểm tra tính gây bệnh trên phân tử DNA-A, chúng tôi tiến hành kiểm tra tính gây bệnh của cả DNA-A và DNA-B với 2 thí nghiệm 1, 2 lần lượt trên cây cà chua Hồng Lan, thuốc lá cảnh N. benthamiana.Mục tiêu của nghiên cứu này là đánh giá tính gây bệnh, đặc biệt là triệu chứng biểu hiện của PepYLCVNV trên cây cà chua và thuốc lá. Bảng 4.12. Lây nhiễm nhân tạo bằng agroinoculation DNA-A và DNA-B của PepYLCVNV mẫu VNP1500 trên cà chua và thuốc lá N. benthamiana Lần lây nhiễm Tên giống Số cây lây Số cây có triệu chứng Số cây PCR (+)/ số cây kiểm tra DNA-A DNA-B 1 Cà chua Hồng Lan 10 0 Không kiểm tra Thuốc lá cảnh N. benthamiana 10 0 2 Cà chua Hồng Lan 10 0 Thuốc lá cảnh N. benthamiana 10 0 Lần lây nhiễm 1: ngày 15/11/2017; Lần lây nhiễm 2: ngày 15/12/2017. Kết luận: Như vậy, từ 2 thí nghiệm đánh giá tính gây bệnh của chỉ phân tử DNA-A và của cả phân tử DNA-A và DNA-B, kết quả lây nhiễm trên các giống đều không biểu hiện triệu chứng. Nguyên nhân có thể là do việc lây nhiễm virus bằng agroinoculation trên cây cà chua và thuốc lá cảnh N. benthamiana vốn dĩ đã rất khó, tỉ lệ lên cực thấp và hơn nữa có thể do hiệu quả chuyển gen của vi khuẩn không cao. Do đó, thí nghiệm cần được thực hiện lây nhiễm lặp lại nhiều lần để đánh giá chính xác tính gây bệnh của PepYLCVNV trên cây cà chua và cây chỉ thị. 4.4.2. Đánh giá tính gây bệnh của PepYLCVNV bằng lây nhiễm nhân tạo dùng bọ phấn Do PepYLCVNV được phát hiện đầu tiên ở cây cà chua và ớt tại Đà Nẵng, đồng thời gần đây chúng tôi phát hiện thấy virus này trên ruộng ớt và cà tím tại Đồng Tháp. Vậy một câu hỏi đặt ra là liệu nguồn bệnh PepYLCVNV từ trên cà pháo có lây sang được cây ớt hay không và ngược lại, và liệu PepYLCVNV có lan truyền nhờ bọ phấn như các begomovirus khác. Với những mục đích đó, chúng tôi đã tiến hành thí nghiệm thử khả năng lan truyền của PepYLCVNV trên cây ớt, cà pháo, thuốc lá và cà chua bằng côn trùng môi giới là bọ phấn (B. tabaci) dùng nguồn bệnh là cây cà pháo đã được lây nhiễm bằng agroinoculation từ trước. Cây nguồn cà pháo không biểu hiện triệu chứng nhưng được kiểm tra PCR trước khi lây nhiễm bằng bọ phấn. Kết quả PCR được thể hiện ở bảng 4.13. Bảng 4.13. Kết quả kiểm tra các mẫu cà pháo nguồn bằng PCR sử dụng cặp mồi đặc hiệu VNP93–A-F1/VNP1500–A-R1 và cặp mồi 1500–B–F1/R2 STT Mẫu PepYLCVNV DNA-A DNA-B 1 Đối chứng (+) + + 2 Cà pháo (1) + + 3 Cà pháo (2) + + Bọ phấn trưởng thành nuôi trên cây nguồn bệnh trong lồng cách ly bọ phấn được chuyển sang cây thí nghiệm. Thả ít nhất 10 bọ phấn /cây và cho bọ phấn chích hút trong thời gian 2 ngày. Kết quả lây nhiễm được tổng kết lại ở bảng 4.14. Bảng 4.14. Kết quả lây nhiễm PepYLCV bằng bọ phấn trên ớt, cà chua và một số cây chỉ thị STT Cây thí nghiệm Số cây lây Số cây có triệu chứng PCR DNA-A DNA-B 1 Cà chua Hồng Lan T20 5 0 Không kiểm tra 2 Cà pháo xanh Phương Lâm 5 0 3 Ớt hiểm lai F1 5 0 4 Thuốc lá cảnh N. benthamiana 5 0 Sau 4 tuần theo dõi và đánh giá, không có cây nào biểu hiện triệu chứng. Nhận xét: Kết quả lây nhiễm cho thấy mẫu PepYLCVNV VNP1500 không biểu hiện triệu chứng trên cây cà chua, thuốc lá cảnh khi được lây nhiễm bằng agroinoculation lẫn bọ phấn. Kết quả này là bất thường vì cây ớt hay cà chua nhiễm PepYLCVNV ngoài đồng ruộng biểu hiện triệu chứng xoăn vàng lá rất điển hình. Rất có thể bộ gen virus của mẫu VNP1500 trên cấu trúc xâm nhiễm đã xuất hiện lỗi trong quá trình xây dựng cấu trúc. Điều này chỉ có thể có thể được xác định khi giải trình tự toàn bộ bộ gen virus trên cấu trúc xâm nhiễm. 4.5 ĐẶC TRƯNG PHÂN TỬ CỦA PEPYLCVNV MẪU VNP1500 4.5.1. Hoàn thiện giải trình tự mẫu PepYLCVNV (VNP1500) Mẫu virus PepYLCVNV VNP1500 đã được xây dựng cấu trúc xâm nhiễm trên vector pCAMBIA2300. Tuy nhiên trình tự đầy đủ của cả 2 thành phần DNA-A và DNA-B của mẫu virus vẫn chưa hoàn thiện. Trên cấu trúc VNP1500-1 (DNA-A), có 2 đoạn chất lượng kém hoặc chưa giải trình tự là đoạn 550-1050 và đoạn 2170-2400. Trên cấu trúc VNP1500-20, có 1 đoạn chất lượng kém là đoạn 2430-2650. Mục tiêu của phần nghiên cứu này là giải trình tự bổ sung các đoạn còn thiếu và qua đó có thể giải thích kết quả nghiên cứu về lây nhiễm nhân tạo. 4.5.1.1. Biến nạp cấu trúc xâm nhiễm vào tế bào vi khuẩn E.coli khả biến bằng phương pháp xung điện Để tạo đủ nguồn plasmid cho giải trình tự bổ sung, 2 plasmid tái tổ hợp, VNP1500-1 (DNA-A) và VNP1500-20 (DNA-B), đã được biến nạp vào tế bào E. coli chủng XL1 Blue bằng phương pháp xung điện bằng máy máy điện xung Multiporator hãng Eppendorf. Kết quả biến nạp (bảng 4.15, hình 4.13) cho thấy cả 2 mẫu đều hình thành khuẩn lạc trên môi trường chọn lọc với số lượng khoảng 1000 khuẩn lạc/đĩa. Bảng 4.15. Kết quả biến nạp plasmid tái tổ hợp vào tế bào XL1 Blue bằng xung điện STT Plasmid Điện thế (V) sau xung điện Thời gian xung điện (ms) Số khuẩn lạc hình thành 1 VNP1500-1 1335 5.0 ~1000 2 VNP1500-20 1342 5.0 ~1000 Ghi chú: Hiệu điện thế được set ở 1400 V và thời gian được set ở 5 ms. Hình 4.13. Số khuẩn lạc thu được sau lần biến nạp đầu tiên 4.5.1.2. Giải trình tự bổ sung mẫu PepYLCVNV VNP1500 Từ 2 đĩa khuẩn lạc bạn đầu chọn mỗi đĩa 3 khuẩn lạc, đồng thời nuôi lỏng trong ống LB lỏng (6 ống) có bổ sung tetracyline và kanamycine. Lấy đồng thời khuẩn lạc trên đĩa cấy dùng chung đầu côn (dùng banh) thả vào ống nghiệm. Nuôi trong tủ ấm có lắc 350C/250rpm để qua đêm. Từ vi khuẩn nuôi cấy, plasmid tái tổ hợp được tinh chiết dùng kít thương mại miniprep của hãng Bioneer. Plasmid tinh chiết được gửi giải trình tự tại hãng First Base (Singapore). Kết quả giải trình tự cho thấy chất lượng trình tự tốt (Bảng 4.16) Bảng 4.16. Kết quả giải trình tự bổ sung mẫu PepYLCVNV (VNP1500) Plasmid Đoạn cần giải trình tự (vị trí trên bộ gen)* Mồi giải trình tự** Chất lượng trình tự VNP1500-1 (DNA-A) 550-1050 BegoCP-R1 Tốt 2170-2400 BegoRep-F1 Tốt VNP1500-20 (DNA-B) 2430-2650 BegoIR-R1 Tốt * Vị trí trên bộ gen được tham khảo từ trình tự đầy đủ mẫu VN93. ** Trình tự 3 mồi: BegoCP-F1 GTATATGGCATGTACTCATGC BegoRep-F1 ACGTCATCAATGACGTTRTACCA BegoIR-R1 CGGTAATATTATACGGATGG > VNP1500-1 (DNA-A) ACCGGATGGCCGCGATTTTTTTTCAAGTGGTCCCCGCACGCATGCCTGTCCAATCCTGGCCACTCCTCAAAGCTTAATTATTTATGTGGTCCCCTATATAACTTAGTCTCCAAGTACCCACATCAAAACATGTGGGATCCTTTACTAAACGAGTTTCCTGAAACCGTACATGGTTTTAGGTGTATGTTAGCTATTAAGTATTTGCAAGTAGTAGAAAATACATACTCTCCCGATACACTAGGCTACGATCTAATACGTGATCTTATCCTGGTGATTCGTGCTAGGGATTATGGCGAAGCGTCCCGCAGATATAGTCATTTCCACTCCCGCCTCGAAGGTTCGTCGCCGTCTGAACTTCGACAGCCCATATCTCAGCCGTGCTGCTGCCCCCACTGTCCTCGTCACAAACAAAAAGAGGTCGTGGGCCAATCGGCCCATGTACAGAAAGCCCAGGATATACAGGATGTACAAAAGCCCTGATGTTCCGCGGGGCTGTGAAGGCCCATGTAAGGTCCAGTCCTATGAACAACGGCATGATGTAGCCCATGTAGGTAAGGTAATATGTGTCTCTGATGTCACTCGAGGTAATGGGCTGACACATCGTGTTGGTAAGAGGTTCTGTATCAAGTCTGTCTATGTACTGGGCAAAATCTGGATGGATGAGAATATTAAGACGAAGAACCATACCAATACTGTCATGTTCTTTTTAGTTCGTGATAGGAGACCATTTGGCACGCCACAGGATTTTGGTCAAGTGTTCAACATGTATGATAATGAGCCCAGTACTGCCACTGTGAAGAACGACAACAGAGATCGATTCCAAGTTCTTCGTCGTTTTCAGGCAACTGTGACAGGTGGTCAATATGCAAGCAAGGAACAAGCCATAGTTAGGAAATTTATGAAGGTCAACAATCATGTGACCTACAACCATCAAGAAGCTGCGAAGTATGACAATCACACGGAGAATGCTCTTTTATTGTATATGGCATGTACTCATGCTAGTAATCCAGTGTATGCGACCTTGAAGATCAGAATCTATTTCTATGATTCGGTTCAAATTAATAAATATTGAATTTTATTATATCCGAAAGATGAGCATCAATTGTGCCCTCAAGTACATTGTACAATACATGTCTAATTGCCCTAATAACGTTGTTGATACTAATAACTCCTAAATGGTCTAAATACTTTATACATTGGTATCTAAATACTCTTAAGAAACGCGAGGTCTGAGGACGTAAACGAGTCCAGATTTGGCAGATTAGATAGCATTGGTGTAGTCCCAACGCTTTCCTCAGGTTGTAGTTGAACTGGATCTGCACTGTGATCATGTCGTGGTTCATCATGAATGGTCTCTCGCGGTGGTGGGTTATGTTGAAATAGAGGGGATTGTTGACCGTCCAGATATACACGCCATTCTCTGCCTGAGCTGCAGTGATGCGTTCCCCTGTGCGTGAATCCATGGTTGTGGCAACCTAGAGCGACGAAGTACGAACAACCACAAGGGAGATCAATTCTTCTCCTTCTATTGGTCTTCTTGGCGATTCGGTGTTGCACCTTGATTGGTACCTGAGTAGAGTGGGCCTTGGAGGGTGACGAAGATTGCATTTTTTAAAGCCCAATGTTTAAGTGCGGTGTTCTTTTCCTCTTCCAAGAACTCTTTATAGCTGGAATGTGGTCCTGGATTGCAGAGGAAGATAGTGGGAATCCCGCCTTTAATTTGAACTGGTTTCCCGTACTTGGTGTTGCTTTGCCAGTCTCTTTGGGCCCCCATGAACTCTTTAAAGTGCTTTAGATAATGCGGATCGACGTCATCAATGACGTTATACCAAGCAGCATTATTGAACACTTTAGGACTTAAGTCTAAATGCCCACATAAGTAGTTATGTGGGCCCAATGACCTGGCCCACATTGTCTTCCCTGTACGACTATCGCCCTCTAACACAATGCTTATCGGTCTTAATGGCCGCGCAGCGGCACTAACAACGTTTCCGGCAACCCATTCATCAAGTTCCTCGGGGACTTGGTCAAAAGAAGAAGACAAGAAAGGACAAACAAAAACCTCTAAAGGAGGTGCAAAAATCCTATCTAAATTACTATGTAAATTATGAAACTGTAAAACAAAATCTTTGGGGGCCTTCTCCTTTAATATATTGAGGGCCGCTGCTTTGGACCCTGAATTGATTGCCTCGGCATATGCGTCGTTGGCAGATCGGCAACCTCCTCTAGCTGATCTTCCATCGATCTGGAAAACTCCATGATCAAGCACGTCTCCGTCTTTTTCCATGTATGCTTTAACATCTGACGAGCTCTTAGCTCCCTGAATGTTCGGATGGAAATGTGCTGACCTGGTTGGGGATCTGAGGTCGAAGAACCTTTGATTTTTGCATTGGAATTTACCTTCGAATTGGATGAGGACATGCAAGTGAGGAGTCCCATCTTCGTGCAATTCCCTGCAAATCCTGATAAACAGTTTATTTGTTGGTGTTTCTATGGCTTGAATTTGGGAAAGTGCCTCTTCTTTGGTGAGAGAGCAGTGTGGGTATGTGAGGAAATAGTTTTTAGCATTTATTCTGAATTTGCTTGGGGGAGCCATTGACCGGTCAATCGGTGTCTCTCAACTTGGGCTATGTAATTGGTGTCTGGGGTCTTATTTATATGGAGACCCTAAATGGCAATATTGTAATTTCTTAAAGAAATTTAAATTCCAAAAGCGGCCATCCGTATAATATT >VNP1500-20 (DNA-B) ACCGGATGGCCGCGATTTTTTTTTTACGTGGTCCCCGCACGCGTTTCTGACATTTGTGTCCATTCGATCAATCCCACCCATTGAAACTGAACACGTGTTACCATCTTAAGTCAGGGATGTTTCCACGTCTGTTTTCTATATATTGGTCCTATTCATCTCCTCTCTCATTTGTAAATAAAAATGAGAGTTCCAATCCGGAGGAATTCAGGCGTCAATTCTGATCGTCGTCCTTCCAATGGGTCAATCCACCGGTGGAACTACCCATATTCCAACTATTTTGGGAGGAGGATTGGCAACCGTGTATACGGCATGCCATTCGGAAACCAACAAGTGCAACGACGTGAGTTTAAGCAAACTCAACGTCTTACCAAGTCTGCTGAGCAGGTTTCATGTAGGAGGAAGTCTATGAAGACGGTTGAGGAAATACACGATGGCACTGACTACTTGCTGTGCAGTAACATGTCTAAGGTGTCGTATATTAGCTACCCGCCTCTATCCGGCACTGAATATGGTAGTAGAGCTGAGTCCTATATCAAAGTCTTGGGAGTCACTGTATCTGGGTCTGCTGTGCTGAAGCAGACGGGCATGCGTGAAGCAGATGGGTCTCAAGGAATTCATGGGATATTTACTACAGTACTTGTTCGTGACAAGAGACCATGTCAGTTCTCTGCCGTGGATCCGATCATCCCATTTGCGGAGCTGTTTGGACAAGAGAAGAGAGCATGCTCCTCATTACGTGTTAGAGATTCTTATAAGAATCGATTTAGTGTTGTCTACCAGAAGAAGCATGTAGTAAATAGTGCTCTATCAACACATGTATTTAGGTATAATTTTAATGTGAAATTCTCTAGATTTCCTTTCTGGGTGTCTTTCAAAGACACCTCCAACGCAGAGCCTACTGGGCGATATTCTAATGTGTCGAAGAACGCATTGGTTGTGTACTATGTTTGGCTATGTGATTCAAATGTAACAGCCGAAGTGCACGTGCAATATGATTTGAACTACATTGGATAAATAAAATCATATTTTTTTTACATTCGAGGAGACATTACTCCCCTCCATACATAGCTCAACAGTTTTTTTAATAATATTAATTACATCGTCATTTACTTTGTTGCTA CCTGCAACAACTTCCGACGCCGAAGGGCCTGGATCTAGGGTTCCATCTTGCAGCCGATGTAAATGTCTATATGGGTGCTCCTCTATGTCGTTGTTCTCCACTGTGCTGGCTGAAGCCCAAGTATGCCCCTGTGGAATGGCATTTGTAGTGTATCTGGAAGACTGTGACCTCATGTGTGTTAGGGCTTGTACTGGTTTTCTTGATACAGTTGATTGAGGCACATGCCAGAAATCTATGTGGTTCATGTTATACGCCTTTGATAGTATTTCAATCTTAGGGGACCGAAATGATATCTCGGAGGACTGTTTTGCAGAGGACATTTTTAACTTCCCTTGCATCCTGCAGAAGTGAACACCATTGATCACGTTAGTGTCTTCCACCCTGTACAACACCCTCCATGGGTTTGGGTCCTTGGGGGAGAAGTATGAGGATGAGTAGTAGTGTATATTACAGTTGCACCCTATGGGTATTGTGAACTCAGCCTGTTTTGAGTCCCCTTCGTGCAACCTTGTGTCGTGCATCTCTATGACCACATGACCAGTTGCATTTCCAGGTACTTGGTTCCGGTACTGGAGGATGACATGGTCAATCCTGAGACACTTTCCCAGAAGCATCGATAATTTTTGGTCGACGGTTGAGGGAAATAACAGAGTTACTTCTGTCTTCTCATTTGATAACTGAAATTCAGTCCTACCCGACGTCGTATAGGCAATATTGTTATTGCTGGACTCCATTATTGAATCTGCCAATACAATAATAGTAATTTAGCTTTTTATAGACTTTTCAGAGTCTGTCAGGATATTGGAATGTGACTAGCTGGGTCTTTGCATTTAAATTCCACTATATCAAAGGACCAACGAGATACTTCCACGTATGTACTTGACCTGAGAAGAGATAAGGTTATATACTTGGATGTGGTTCAGCCACGTCGCCAATTAGATAATGGACGACAGCTGTCGTCCACTATCAGGTCATTGATAGTTTCCAATATTAATAATTTAATTAACAGTTAAATTAAATGGAAACATATATTTGTATACGGTAGCAGCACAAGTTAACCGCTAAGCAGGACAAGATATCTTCTTCAAATAAACAATTATTTGTTAATCCCTACGAGTTG TCGTGGAATCGACAACCTAGTCTAATATTTAACTGATCCAACAATCGAATTATGAGCAAACACACACACTTGAACATACTAATCTTGAGAAAATCAGGCCGCGCAGCGGCTATGTGTCGAAATGTATCTACTATTCCGGAAGTGTTAACCCAGATTTATTATATGTAAATCTAAAAGAAAGCATATGAATTGTGTATTAGTGAAGGAATTGCAGAAGTTGTAGCTGACCTTGTTAGAGGGGAGCAAAACCAATGCAATATAATTATTGCATATGTTAATTAAATATTTCGAATTAAATTGTTGTAGAGAGAGAAAGTCTAGAGAGAAGGCAGAGCAATTGACCGGTCAATTGGTGTCTCTCAACTTGGGCTATGTAATTGGTGTCTGGGGTCTTATTTATATGGAGACCCTAAATGGCATTATTGTAATTTCTTAAAGAAATTAAAATTCCAAAAGCGGCCATCCGTATAATATT 4.5.1.3. Tổ chức bộ gen của mẫu PepYLCVNV (mẫu VNP1500) PepYLCVNV là một begomovirus có bộ gen kép (bipartite) gồm 2 phân tử genome là DNA-A và DNA-B. Sơ đồ minh họa tổ chức bộ gen gồm cả DNA-A và DNA-B của mẫu virus PepYLCVNV được xác định bằng phần mềm Vector NTI Suite 7 được trình bày ở hình 4.14, bảng 4.17 và bảng 4.18. DNA-A ( Bảng 4.17) DNA-A của PepYLCVNV VNP1500 có kích thước, cấu trúc tương tự như các virus thuộc chi Begomovirus - nhóm Cựu thế giới. Toàn bộ phân tử DNA-A có kích thước 2733 nt. Trên DNA-A, chúng tôi đã xác định được 6 ORF (open reading frame, khung dịch mã, là trình tự DNA được bắt đầu bằng mã khởi đầu ATG và kết thúc bằng mã kết thúc TAA hoặc TGA hoặc TAG) đặc trưng của các begomovirus, gồm 2 ORF trên sợi virus (AV2, AV1, cùng chiều kim đồng hồ) và 4 ORF trên sợi bổ sung với sợi virus (AC4, AC1, AC2, AC3, ngược chiều kim đồng hồ). Trên sợi virus, ORF AV2 (mã hóa cho protein AV2 có chức năng cảm ứng triệu chứng, di chuyển hệ thống và tích lũy DNA của virus) có kích thước 348 nt. Phía đầu 3’ của ORF AV2 là ORF AV1 (mã hóa cho protein vỏ CP) có kích thước 790 nt (263 aa). Tương tự như các begomovirus khác, trên sợi bổ sung, ORF lớn nhất là ORF AC1 (mã hóa protein Rep là protein có chức năng tái sinh và tương tác với protein của ký chủ điều khiển chu kỳ tế bào), có kích thước 1068 nt, ORF nhỏ nhất là ORF AC4 (mã hóa protein AC4 có chức năng cảm ứng triệu chứng và di chuyển hệ thống) có kích thước 291 nt. Hai ORF còn lại là AC2 (mã hóa protein TrAP có chức năng hoạt hóa phiên mã và ức chế phản ứng phòng thủ của cây) có kích thước 402 nt và AC3 có kích thước 402 nt (mã hóa protein REn). Cũng giống như tất cả các beomovirus, ORF AC4 và ORF AC2 luôn nằm trên một khung đọc mã (c3). DNA-A có một vùng liên gen không phiên mã (IR, Intergenic Region) kích thước khoảng 266 nt có vị trí tính từ đầu 5’ của ORF AC1 tới đầu 5’ của ORF AV2 tương tự như IR của các begomovirus khác. Giống như các begomovirrus có bộ gen kép khác, trên vùng IR của DNA-A chứa một vùng chung CR có trình tự giống như vùng tương ứng trên DNA-B. Vùng này của DNA-A của PepYLCVNV VNP1500 dài 174 nts và chứa nguồn gốc tái bản (ori, origin of replication) với nhiều dấu hiệu quan trọng. Bảng 4.17. Đặc điểm phân tử DNA-A của mẫu PepYLCVNV VNP1500 Vị trí (từ nt đến nt) Kích thước (nt) DNA-A Toàn bộ phân tử 2733 Vùng liên gen IR 2597 – 129 266 Vùng chung CR 2601-41 174 AV1(CP) 290-1069 790 AV2 (AV2) 130-477 348 AC1(Rep) 1529-2596 1068 AC2 (TrAP) 1207-1608 402 AC3 (REn) 1062-1463 402 AC4 (AC4) 2149-2439 291 Ghi chú: CP (coat protein), IR (intergenic region), CR (common region), Rep (replication associated protein), TrAP (transcriptional activator protein), REn (replication enhancer), nt là nucleotide DNA-B (Bảng 4.18) DNA-B của PepYLCVNV VNP1500 có kích thước 2715 nt và chỉ chứa 2 ORF tương tự như DNA-B của các begomo có bộ gen kép khác. Trên sợi virus (chiều kim đồng hồ) là ORF BV1 mã hóa protein vận chuyển MP, có kích thước 831 nt. Trên sợi bổ sung, DNA-B chứa 1 ORF là BC1 mã hóa protein nhập nhân (NSP) với kích thước 831 nt. DNA-B chứa một vùng liên gen không phiên mã IR lớn, có kích thước 1041 nts. Tương tự DNA-A, vùng này chứa một đoạn ngắn dài 175 nt gọi là vùng chung (common region, CR) có trình tự bảo thủ cao với vùng chung CR của DNA-A. Mức độ đồng nhất giữa vùng chung CR của 2 thành phần tới 96.6% (Hình 4.15) và do đó cũng chứng tỏ 2 thành phần này thuộc cùng 1 virus. Vì trình tự vùng chung này giống với của DNA-A nên protein Rep được mã hóa trên DNA-A có thể nhận biết để khởi đầu quá trình tái sinh của DNA-B. Bảng 4.18. Đặc điểm phân tử DNA-B của mẫu PepYLCVNV VNP1500 Vị trí (từ nt đến nt) Kích thước (nt) DNA-B Toàn bộ phân tử 2715 Vùng liên gen IR 1855-180 1041 Vùng chung CR 2583-42 175 BV1 (MP) 181-1011 831 BC1 (NSP) 1024-1854 831 Hình 4.14. Tổ chức bộ gen của mẫu PepYLCVNV VNP1500 Hình 4.15. Vùng chung CR của mẫu PepYLCVNV VNP1500 với cấu trúc thứ cấp chứa điểm khởi đầu tái bản bộ gen được chỉ rõ Nhận xét: Phân tích đặc điểm phân tử của mẫu virus PepYLCVNV VNP1500 chứng tỏ cấu trúc xâm nhiễm dựa trên mẫu virus này có bộ gen hoàn chỉnh. Ngoài ra, cây nguồn cà pháo được lây nhiễm bằng agroinoculation có phản ứng PCR dương tính với cả 2 thành phần chứng tỏ virus đã có thể tái sinh và di chuyển hệ thống trong cây. Vì các mô tiph chức năng liên quan tới cảm ứng triệu chứng của begomovirus khá đa dạng và nằm trên tất cả các gen nên chúng tôi đã không thể xác định được các đột biến này chỉ dựa trên phân tích phân tử. Thiết kế lại cấu trúc có lẽ cần thiết để nghiên cứu đặc điểm sinh học của virus PepYLCVNV. PHẦN 5. KẾT LUẬN VÀ KIẾN NGHỊ 5.1. KẾT LUẬN - Đã điều tra và thu thập các mẫu triệu chứng bệnh begomovirus trên ớt tại Hà Nội năm 2017. Dạng triệu chứng điển hình là triệu chứng khảm lá. Tỉ lệ nhiễm virus cao nhất tại huyện Thạch Thất vào giai đoạn quả chín đạt 43,2%. - Đã kiểm tra ELISA trên 81 mẫu ớt thu thập khắp cả nước, phát hiện 2 mẫu phản ứng dương tính ChiVMV, 5 mẫu phản ứng dương tính PMMoV, 1 mẫu phản ứng dương tính PepMoV, 1 mẫu phản ứng dương tính PepYMV và 1 mẫu phản ứng dương tính TYLCVs. - Kiểm tra PCR phát hiện begomovirus bằng cặp mồi chung BegoA-F1 và BegoA-R1 trên 14 ớt và 4 mẫu cà chua, kết quả kiểm tra cho thấy có 6 mẫu ớt và 4 mẫu cà chua thu tại miền Trung và miền Nam có phản ứng dương. - Dùng mồi đặc hiệu để kiểm tra 9 mẫu dương tính với begomovirus, kết quả kiểm tra PCR cho thấy chỉ có 1 mẫu cà chua thu tại An Giang có phản ứng dương với Tomato yellow leaf curl Kachanaburi virus  (TYLCKaV), có 8/9 mẫu nhiễm với cả DNA-A và DNA-B của Pepper yellow leaf curl Vietnam virus (PepYLCVNV). - Đã giải trình tự bổ sung và nhận được trình tự đầy đủ bộ gen mẫu PepYLCVNV VNP1500 từ 2 cấu trúc xâm nhiễm. Phân tích bộ gen cho thấy bộ gen của virus trên cấu trúc xâm nhiễm là hoàn chỉnh, đảm bảo sự xâm nhiễm hệ thống của virus trong cây. Kết hợp kết quả lây nhiễm nhân tạo và phân tích trình tự đã gợi ý có lẽ xuất hiện đột biến của virus trên cấu trúc xâm nhiễm liên quan cảm ứng triệu chứng. 5.2. KIẾN NGHỊ - Tiếp tục xác định thành phần loài virus trên cây ớt tại Hà Nội - Nghiên cứu sâu hơn về đặc trưng sinh học, phân bố của PepYLCVNV. TÀI LIỆU THAM KHẢO TIẾNG VIỆT: Bùi Bách Tuyến (1998). Bệnh hại cây ớt. Tài liệu hướng dẫn đồng ruộng (bản dịch tiếng việt). Trung tâm nghiên cứu và phát triển rau châu Á (AVRDC). Bùi Thị Oanh (2010). Nghiên cứu ảnh hưởng của một số biện pháp kỹ thuật đến khả năng sinh trưởng, phát triển và năng suất của giống ớt lai số 03 năm 2009 - 2010 tại huyện Nam Đàn - Nghệ An. tr. 5-22. Hà Viết Cường (2010). Bài giảng Công nghệ sinh học trong bệnh cây. Trường Đại học Nông Nghiệp Hà Nội. Hà Viết Cường (2011).Virus thực vật, phytoplasma và viroid. Trường Đại học Nông nghiệp Hà Nội. Vũ Triệu Mân và Lê Lương Tề (1999). Bệnh vi khuẩn và virus hại cây trồng. Nhà xuất bản Giáo dục, Hà Nội. Mai Thị Phương Anh, Trần Văn Lài, Trần Khắc Thi (1996). Rau và trồng rau- giáo trình cao học nông nghiệp. Nhà xuất bản Nông nghiệp, Hà Nội. Mai Thị Phương Anh (1999). Kỹ thuật trồng một số loại rau cao cấp. Nhà xuất bản Nông nghiệp, Hà Nội. Nguyễn Thị Hà Uyên (2012). Xác định và đánh giá khả năng gây bệnh của một số begomovirus trên cây cà chua bằng phương pháp lây nhiễm nhân tạo dùng vi khuẩn Agrobacterium tumerfaciens. Nhà xuất bản Nông nghiệp, Hà Nội. Nguyễn Văn Viên (1999). Nghiên cứu tình hình phát sinh phát triển và biện pháp phòng trừ một số bệnh nghiên cứu và bệnh xoăn lá hại cà chua vùng Hà Nội và phụ cận. Luận án Tiến sĩ nông nghiệp. Vũ Triệu Mân và Lê Lương Tề chủ biên (2001). Giáo trình Bệnh cây Nông Nghiệp. Nhà xuất bản Nông nghiệp, Hà Nội . Viện Bảo vệ thực vật (2000). Phương pháp nghiên cứu Bảo vệ thực vật. Nhà xuất bản Nông nghiệp, Hà Nội.Tập 03. tr. 60-61. TIẾNG ANH: Avgelis A. D. (1986). A pepper strain of TMV who is new in Crete (Greece). Phytopathologia Mediterranea. 25(1-3). pp. 33-38. Bérenger J., M. F. Fabre, A. Palloix and B. Moury (2008). Charactezation of a new potyvirus infecting pepper crops in Ecuador, Brief report. Archives of Virology 153(1). pp. 1543-1548. Boulton M. I. (1995). Agrobacterium-mediated transfer of geminiviruses to plant tissues. Methods Mol Biol. 49(1). pp. 77-93. Bosland P.W. (1996). Capsicums: Innovative uses of an ancient crop. In: J. Janick (ed.), Progress in new crops. ASHS Press, Arlington, VA. pp. 479-487. Bosland P.W. and Votava 2000. Pepper: Vegetable and spice Capsicums. CABI Publishing. pp. 230. Briddon R., J. Brown, E. Moriones, J. Stanley, M. Zerbini, X. Zhou and C. Fauquet (2008). Recommendations for the classification and nomenclature of the DNA-β satellites of begomoviruses. Archives of virology. 153(4). pp. 763. Briddon R. W. (2003). Cotton leaf curl disease, a multicomponent begomovirus complex. Molecular Plant Pathology. 4(1). pp. 427-434. Britton G. and D. Hornero-Méndez (1997). Carotenoids and Colour in Fruits and Vegetables. In: Tomás-Barberán FA, Robins RJ, editors. Photochemistry of Fruits and Vegetables. Oxford, England: Clarendon Press. pp. 11–28. Brunt A. A, K. Crabtree, M. J. Dallwitz, A. J. Gibbs, L. Watson (1996). Viruses of Plants: Descriptions and Lists from the VIDE Database. C.A.B. International, U.K. pp. 148. Brunt A.A. and R.H. Kenten (1972). Pepper veinal mottle virus, Descriptions of Plant Viruses, No. 104/1972. Dowload date 15/11/2017 from Cerkauskas R. (2004). Pepper diseases, In the Fact Sheet, Asian Vegetable Research and Development Center. AVRDC Publication 04. pp. 586-596. Chakraborty S., P. Pandey, M. Banerjee, G. Kalloo and C. Fauquet (2003). Tomato leaf curl Gujarat virus, a new begomovirus species causing a severe leaf curl disease of tomato in Varanasi, India. Phytopathology. 93(12). pp. 1485. Chomchalow N. (2001). Spice production in Asia - An overview. AU journal of Technology. Vol 5, no 2. pp. 1. Doyle J. J. (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem bull. Vol. 19 (1987). pp. 11-15. FAO (2012). Ngày truy cập 17/12/2018 tại FAO (2014). Ngày truy cập 20/12/2018 tại Fauquet C. M. & Stanley J. (2003). Geminivirus classification and nomenclature: progress and problems. Annals of Applied Biology. 142(2). pp. 165-189. Fauquet C. M., R. W. Briddon, J. K. Brown, E. Moriones, J. Stanley, M. Zerbini, X. Zhou (2008). Geminivirus strain demarcation and nomenclature. Arch Virol. 153(4). pp. 783-821. Fauquet and Stanley (2005). Revising the way we conceive and name viruses below the species level: a review of geminivirus taxonomy calls for new standardized isolate descriptors. Archives of virology. 150(10). pp. 2151-2179. Pickersgill B (1997). Genetic resources and breeding of Capsicum spp. Euphytica. 96(1). pp. 129-133. Gafni and Yedidya (2003). Tomato yellow leaf curl virus, the intracellular dynamics of a plant DNA virus. Molecular plant pathology. 4(1). pp. 9-15. Galanihe L. D., M. G. D. L. Priyantha, D. R. Yapa, H. M. S. Bandara, J. A. D. A. R. Ranasinghe (2004). Insect pest and disease incidences of exotic hybrids chilli pepper varieties grown in the low country dry zone of Sri Lanka. Annals of Sri Lanka Department of Agriculture. 6(1). pp. 99-106. Ghanim and Czosnek (2000). Tomato yellow leaf curl geminivirus (TYLCV-Is) is transmitted among whiteflies (Bemisia tabaci) in a sex-related manner. Journal of Virology. 74(10). pp. 4738-4745. Gibbs A. J., Trueman J. W. H., Gibbs M. J. (2008). The bean common mosaic virus lineage of potyviruses: where did it arise and when?. Arch Virol 153. pp. 2177–2187. Green S.K. and J.S. Kim (1991). Characteristics and control of viruses infecting peppers: a literature review, Asian Vegetable Research and Development Center, Technical Bulletin. AVRDC Publication. No. 18. Green S.K. (1992a). Integrated control of diseases of vegetables in Taiwan, Asian Vegetable Research and Development Center, Tainan, Taiwan. AVRDC Publication. pp. 35-68. Green S.K. (1992b). Virus in Asia Pacific region. In the Proceedings of the Coference on chilli pepper production in the tropics, 13-14 October, 1992, Kuala Lumpua, Malaisia. pp. 99-129. Green S. K. (1993). Pepper virus research in Taiwan and other Asian countries. In the Proceedings of the Symposium on Plant viruses and Virus – like diseasea, Council of Agriculture Plant Protection. AVRDC Publication. Series No.1. pp. 213 – 243. Green S., W. Tsai, S. Shih, L. Black, A. Rezaian, M. Rashid, M. Roff, Y. Myint and L. Hong (2001). Molecular characterization of begomoviruses associated with leafcurl diseases of tomato in Bangladesh, Laos, Malaysia, Myanmar, and Vietnam. Plant Disease. 85(2). pp. 1286-1286. Gutierrez C., E. RamirezParra, M. Mar Castellano, A. P. Sanz-Burgos, A. Luque, and R. Missich (2004). Geminivirus DNA replication and cell cycle interactions. Veterinary microbiology. 98(2). pp. 111-119. Ha C. (2007). Detection and identification of potyviruses and geminiviruses in Vietnam. A thesis submitted for the degree of Doctor of Philosophy to the Queensland University of Technology. pp. 203-215. Ha C., S. Coombs, P. Revill, R. Harding, M. Vu and J. Dale (2008). Molecular characterization of begomoviruses and DNA satellites from Vietnam: additional evidence that the New World geminiviruses were present in the Old World prior to continental separation. Journal of General Virology. 89(1). pp. 312-326. Harrison and Robinson (2005). Another quarter century of great progress in understanding the biological properties of plant viruses. Annals of applied biology. 146(1). pp. 15-37. Hellens R., P. Mullineaux and H. Klee (2000). Technical Focus:a guide to Agrobacterium binary Ti vectors. Trends Plant. Sci 5. pp. 446-451. Hornero-Méndez D., J. Costa-García , M. I. Mínguez-Mosquera (2002). Characterization of carotenoids high-producing Capsicum annuum cultivars selected for paprika production. Journal of Agricultural and Food Chemistry. 50(20). pp. 5711–5716. Hussain M., S. Mansoor, S. Iram, Y. Zafar, R. W. Briddon (2004). First report of Tomato leaf curl New Delhi virus affecting chilli pepper in Pakistan. Plant Pathology. 53(1). pp. 794. Inoue N. A. K., M. E. N. Fonseca, R. O. Resend, L. S. Boiteux, D. C. Monte, A. N. Dusi, A. C. de Avila and R. A. A. vanderVlugt(2002). Pepper yellow mosaic virus, a new potyvirus in sweet pepper Capsicum annuum. Brief report, Archives of Virolog. 147(4). pp. 849-855. Jones D. R. (2003). Plant viruses transmitted by whiteflies. European Journal of Plant Pathology. 109(3). pp. 195. Than Po Po , Haryudian Prihastuti, Sitthisack Phoulivong, Paul, W.J. Taylor and Kevin D. Hyde (2008). Chilli anthracnose disease caused by Colletotrium species. J Zhejiang Univ Sci B. pp. 764-778. Tsai W. S., S. L. Shih, S. K. Green, A. Rauf, S. H. Hidayat, F. J. Jan (2006). Molecular characterization of Pepper yellow leaf curl Indonesia virus in leaf curl and yellowing diseased tomato and pepper in Indonesia. Plant Disease. 90(1). pp. 247. Jacquemond M. (2012). Cucumber mosaic virus. Adv Virus Res. Vol 84. pp. 439-504. Khan M. S., S. K. Raj, R. Singh (2006). First report of Tomato leaf curl New Delhi virus infecting chilli in India. Plant Pathology. 55(1). pp. 289. Kheyr-Pour A., M. Bendahmane, V. Matzeit, G. P. Accotto, S. Crespi and B. Gronenborn (1991). Tomato yellow leaf curl virus from sardinia is a whitefly-transmitted monoparatite geminivirus. Nucleic Acids Research. 19(24). pp. 6763-6769. Lipert L. F., P. G. Smith and B. O. Bergh (1996). Cytogenertics of thevegetable crops. Garden pepper, Capsicum ssp. Botanical Rev. 32(1). pp. 24-55. Markham P., I. Bedford, S. Liu, D. Frolich, R. Rosell and J. Brown (1996). Transmission of geminiviruses by biotypes of Bemisia tabaci (Gennadius). Bemisia: 1995, taxonomy, biology, damage, control and management. pp. 69-75. Martínez Y., M. Quiñones, D. Fonseca, J. Potter J, D. P. Maxwell (2002). First report of Tomato yellow leaf curl virus infecting bean (Phaseolus vulgaris) in Cuba. Plant Disease. 86(7). pp. 814. Martínez‐Ayala A., S. Sánchez‐Campos, F. Cáceres, J. Navas‐Castill,  E. Moriones (2013). Characterisation and genetic diversity of pepper leafroll virus, a new bipartite begomovirus infecting pepper, bean and tomato in Peru. Annals of Applied Biology. 164 (1). pp. 62-72. Moury B., A. Palloix, C. Caranta, P. Gognalons, S. Souche, S. K. Gebre and G. Marchoux (2005). Serological, molercular and pathotype diversity of Pepper veinal mottle virus and Chilli veinal mottle virus. Phythopathology. 95(1). pp. 227-232. Moriones E. and J. Navas-Castillo (2000). Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Research. 71(1-2). pp. 123-134. Murugan and Uthamasamy (2001). Dispersal behaviour of cotton whitefly Bemisia tabaci (Genn.) under cotton based gardenland agro ecosystem of Coimbatore, Tamil Nadu. Madras agricultural journal. 88(1/3) . pp. 1-6. Navas Castillo J., G. P. Accotto, E. Noris, E. Moriones and D. Louro (2000). Typing of Tomato yellow leaf curl viruses in Europe. European Journal of Plant Pathology. 106(2). pp. 179-186. Navot N., E. Pichersky, M. Zeidan, D. Zamir and H. Czosnek (1991). Tomato yellow leaf curl virus: a whitefly-transmitted geminivirus with a single genomic component. Virology 185(1). pp. 151-161. Padidam M., S. Stanley and C. M. Fauquet (1999). Possible emergence of new geminiviruses by frequent recombination. Virology 265(2). pp.: 218-225. Perry L., S. Zamillo, Host, D. M. Pearsall, D. R. Pipemo and M. J. Berman (2007). Starch fossils and the domestication and dispersal of chili peppers (Capsicum spp. L.) in the Americas. Science. 315(5814). pp. 986-988. Pérez-Gálvez A., H. D. Martin, H. Sies, W. Stahl (2003). Incorporation of carotenoids from paprika oleoresin into human chylomicron. British Journal of Nutrition. 89(6) . pp. 787–793. Picó B., Díez M. J. and F. Nuez (1996). Viral diseases causing the greatest economic losses to the tomato crop. II. The Tomato yellow leaf curl virus-a review. Scientia Horticulturae. 67(3-4). pp. 151-196. Purcifull D.E. and E. Hiebert (1982). Tobacco etch virus. Descriptions of Plant Viruses. Retrieved on 10 November 2017 at Quiñones M., D. Fonseca, G. P. Acotto, Y. Martínez (2002). Viral infection associated with the presence of Begomoviruses in pepper plants in Cuba. Plant Disease. 86(2). pp. 73. Rashid M. H., K. M. Khalequzzaman, M. S. Alam, S. A. Uddin and S. K. Greenn (2007). Screening of different sweet pepper lines against Cucumber mosaic virus and Chili veinal mottle virus, Int. J. Sustain. Crop Prod. 2(3). pp. 1-4. Ravi K. S., J. Joseph, N. Nagaraju, P. S. Krishna, H. R. Reddy and H. S. Savithri (1997). Characterization of Pepper vein banding virus from chili pepper in India. Plant Disease. 81(6). pp. 673 - 676. Rochester D. E., W. Kositratana and R. N. Beachy (1990). Systemic movement and symptom production following agroinoculation with a single DNA of tomato yellow leaf curl geminivirus (Thailand). Virology 178. . pp. 520-526. Rybicki (1994). A phylogenetic and evolutionary justification for three genera of Geminiviridae."Archives of Virology . 139(1-2). pp. 49-77. Sarkar K. and K. Kulshreshtha (1978). Crotalaria striata DC. a new natural host of bean common mosaic virus. Current Science. 47(7). pp. 241. Shih S. L., W. S. Tsai, S. K. Green (2003). Molecular characterization of tomato and chilli leaf curl begomoviruses from Pakistan. Plant Disease 87. pp. 200. Shih S. L., W. S. Tsai, L. M. Lee, J. T. Wang, S. K. Green, and L. Kenyon (2010). First Report of Tomato yellow leaf curl Thailand virus Associated with Pepper Leaf Curl Disease in Taiwan. First Report of Tomato yellow leaf curl Thailand virus Associated with Pepper Leaf Curl Disease in Taiwan. Volume 94, Number 5. pp. 637. Stanley J., D. M. Bisaro, R. W. Briddon, J. K. Brown, C. M. Fauquet, B. D. Harrison, E. P. Rybicki and D. C. Stenger (2005). Geminiviridae. In: Virus Taxonomy. VIIIth report of the International Committee on Taxonomy of Viruses. (C.M. Fauquet, M.A Mayo, J. Maniloff, U. Desselberger and L.A. Ball, eds). London, UK: Elsevier/Academic Press. pp. 301 - 326. Varma A. and V. G. Malathi (2003). Emerging geminivirus problems: A serious threat to crop production. Annals of Applied Biology. 142(2). pp. 145-164. Wang M. Qi and A. J. Cutler (1993). A simple method of preparing plant samples for PCR. Nucleic Acids Research. 21(17). pp. 4153-4154. Wang T. C., R. D. Cardiff, L. Zukerberg, E. Lees , A. Arnold and E. V. Schmidt (1994). Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice. US National Library of MedicineNational Institutes of Health. 369 (6482). pp. 669-671. Wetter C., M. Conti, D. Altschuh, R. Tabillion, M. H. V. Regenmortel (1984). Pepper mild mottle virus, a tobamovirus infecting pepper cultivars in Sicily. Phytopathology. 74(4). pp. 405-410. Wijs J. (1973). Pepper veinal mottle virus in Irovy Coast. Netherlands Journal of Plant Pathology.79(5). pp. 189 – 193. Yoon J. Y., S. K. Green, A. T. Tschanz, S. C. S. Tson and L. C. Chang (1990). Pepper improvement for the tropics: problems and the AVRDC approach, In: Tomato and Pepper production in the tropics. Asian Vegetable Research and Development Center, Tainan, Taiwan. pp. 86-98. Zhang C., Wege and H. Jeske (2001). Movement proteins (BC1 and BV1) of Abutilon mosaic geminivirus are cotransported in and between cells of sink but not of source leaves as detected by green fluorescent protein tagging. Virology. 290(2) . pp. 249-260. Zhang D. Y., Y. Liu, C. R. Zhuang, W. S. Tsai, S. L. Shih, L. M. Lee, J. T. Wang and S. K. Green (2006). Survey for viruses-particularly begomovirses infecting pepper crops in China. Agricultural Science and Technology. 7(4). pp. 24.

Các file đính kèm theo tài liệu này:

  • docxthuy_luan_van_hc_5826_2081720.docx
Luận văn liên quan