Luận văn Nghiên cứu đặc điểm và vai trò của Lactobacillus Acidophilus trong chế phẩm Probiotic

Kết luận Từ những thực nghiệm trên chúng tôi đã thu được kết luận sau: 1 - Từ 16 loại chế phẩm probiotic phổ biến trên thị trường thuốc ở Thành phố Hồ Chí Minh, chúng tôi đã phân lập đươc 31 chủng VK sinh acid và chọn được 2 chủng Lactobacillus PA2 và Lactobacillus PP có đặc điểm sinh học: thuộc chi Lactobacillus, tế bào hình que, GP+ P, vi hiếu khí, lên men lactic đồng hình, catalase âm tính, không tạo hoạt tính protease, bacteriocin âm tính, sản sinh acid lactic cao (1,46 -1,47 g/l). 2 – Có hoạt tính đối kháng mạnh, phổ kháng khuẩn rộng với các VSV kiểm định (gây bệnh đường ruột). Đặc biệt, có khả năng đối kháng được một số VK gây bệnh đường ruột kháng thuốc như S. aureus kháng methicillin, E. coli kháng ampicillin. 3 - Có khả năng sống sót cao trong các điều kiện bất lợi ở đường ruột của người:  Khả năng đề kháng tốt với các chất KS (điều trị bệnh đường ruột) như ciprothokacin, neomycin, kanamycin, clindamycin.  Khả năng chịu đựng pH thấp của cả hai chủng là cao: ở pH 1,5, tỷ lệ sống sót lớn hơn 55% tại thời điểm 120 phút.

pdf98 trang | Chia sẻ: builinh123 | Ngày: 02/08/2018 | Lượt xem: 198 | Lượt tải: 3download
Bạn đang xem trước 20 trang tài liệu Luận văn Nghiên cứu đặc điểm và vai trò của Lactobacillus Acidophilus trong chế phẩm Probiotic, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
ng ruột. Nhờ khả năng sống sót khi qua dạ dày mà các chủng này mới có thể phát huy vai trò ở ruột. Do vậy khả năng sống sót cao ở pH thấp chính là đặc tính probiotic nổi bật của 2 chủng này. 3.4.3. Khả năng chịu acid mật Trong hệ tiêu hóa, sau khi trải qua điều kiện khắc nghiệt pH thấp ở dạ dày, các VK lại phải tiếp xúc với các acid mật và muối mật trong đường ruột. Acid mật được coi là chất kháng khuẩn trong đường tiêu hóa, bảo vệ ruột khỏi sự xâm nhập của các VSV gây bệnh. Do vậy, VSV probiotic khi qua ruột non chịu tác động của acid mật. Khả năng chịu đựng acid mật cũng là một tiêu chuẩn chọn lọc của các VSV probiotic. Ở ruột non, nơi dịch mật toàn phần tiết ra có thể có nồng độ cao nhất khoảng 2%. Vì thế, chúng tôi tiến hành khảo sát khả năng chịu mật của 2 chủng Lactobacillus PA2 và Lactobacillus PP với các nồng độ acid mật 0,5; 1; 1,5; 2% (nồng độ acid mật 0% ở mẫu đối chứng) tại các thời điểm 0; 1; 5 và 10 giờ. Bảng 3.11. Mật độ tế bào và tỷ lệ sống sót của chủng Lactobacillus PA2 ở các nồng độ acid mật khác nhau Nồng độ acid mật 0 giờ 1 giờ 5 giờ 10 giờ Mật độ tế bào (ODR610) Tỷ lệ sống sót (%) Mật độ tế bào (ODR610 Tỷ lệ sống sót (%) Mật độ tế bào (ODR610R) Tỷ lệ sống sót (%) Mật độ tế bào (ODR610 Tỷ lệ sống sót (%) (%) 0,0 0,275 100 0,320 100 1,160 100 2,254 100 0,5 0,275 100 0,290 90,63 0,987 85,09 1,889 83,81 1,0 0,275 100 0,287 89,69 0,454 39,14 0,784 34,78 1,5 0,275 100 0,279 87,19 0,383 33,02 0,553 24,53 2,0 0,275 100 0,267 83,44 0,276 23,79 0,452 20,05 Bảng 3.12. Mật độ tế bào và tỷ lệ sống sót của chủng Lactobacillus PP ở các nồng độ acid mật khác nhau Nồng độ acid mật (%) 0 giờ 1 giờ 5 giờ 10 giờ Mật độ tế bào (ODR610) Tỷ lệ sống sót (%) Mật độ tế bào (ODR610R) Tỷ lệ sống sót (%) Mật độ tế bào (ODR610R) Tỷ lệ sống sót (%) Mật độ tế bào (ODR610R) Tỷ lệ sống sót (%) 0,0 0,225 100 0,247 100 1,123 100 2,237 100 0,5 0,225 100 0,241 97,57 0,970 86,38 1,593 71,21 1,0 0,225 100 0,220 89,07 0,428 38,11 0,507 31,83 1,5 0,225 100 0,212 85,83 0,290 25,82 0,385 17,21 2,0 0,225 100 0,205 83,00 0,205 18,25 0,343 15,33 Nhận xét: Qua các số liệu bảng 3.11, 3.12 chúng tôi nhận thấy, cả 2 chủng đều có khả năng chịu acid mật tốt. Tỷ lệ sống sót giảm dần theo thời gian và theo nồng độ acid mật đổ vào ruột non. Cụ thể: + Ở nồng độ acid mật 0,5%, tỷ lệ sống sót của cả 2 chủng tại thời điểm 1 giờ là rất cao (trên 80% ở các nồng độ muối mật 0,5 - 2,0%). Tỷ lệ này giảm theo thời gian nhưng không đáng kể, hay nói cách khác tỷ lệ sống sót ở nồng độ acid mật 0,5% của cả 2 chủng đều rất cao tại các thời điểm 5 và 10 giờ (trên 70% đối với cả 2 chủng). + Ở nồng độ acid mật 1,0%, tỷ lệ sống sót của 2 chủng này tương đối cao. Tuy nhiên, giảm dần theo thời điểm 5 giờ (độ sống sót ≤ 39%) và 10 giờ. (34,78% đối với chủng Lactobacillus PA2 và 31,83% với chủng Lactobacillus PP). + Ở nồng độ acid mật 1,5%, tỷ lệ sống sót giảm rõ rệt, ở thời điểm 5 giờ (33,02% với Lactobacillus PA2 và 25,82% với chủng Lactobacillus PP), thời điểm 10 giờ (24,53% với chủng Lactobacillus PA2 và 17,21% với chủng Lactobacillus PP). + Ở nồng độ muối mật 2,0%, đây là nồng độ acid mật cao nhất đổ vào ruột non, tỷ lệ sống sót của cả 2 chủng đều rất thấp, chủng Lactobacillus PA2 cao hơn chủng Lactobacillus PP nhưng không đáng kể, ở thời điểm 5 giờ (23,79% với chủng Lactobacillus PA2 và 18,25% với chủng Lactobacillus PP) và thời điểm 10 giờ (20,05% với chủng Lactobacillus PA2 và 15,33% với chủng Lactobacillus PP). So sánh với các kết quả nghiên cứu của nhóm tác giả Nguyễn Văn Thanh (2007) về khả năng chịu acid mật của chủng L. acidophilus: khả năng chịu acid mật của chủng L. acidophilus khảo sát là âm tính với tất cả các nồng độ acid mật từ 0 -2%, ở tất các thời điểm 1; 5 và 10 giờ. Từ đây cho thấy khả năng chịu acid mật của 2 chủng Lactobacillus PA2 và Lactobacillus PP là rất cao. Đây chính ưu điểm nổi bật của 2 chủng VK này khi sử dụng làm probiotic. Trong điều kiện khắc nghiệt của đường tiêu hóa với sự hiện diện của acid mật ở các nồng độ (0 – 2%), chúng vẫn có khả năng ST gia tăng số lượng tế bào, cạnh tranh về vị trí bám cũng như sản sinh chất có hoạt tính kháng khuẩn, ức chế sự phát triển của các VK gây bệnh trong đường ruột, góp phần thiết lập và duy trì sự cân bằng hệ VSV có lợi ở đường ruột. 3.5. Ảnh hưởng điều kiện nuôi cấy đến sự sinh trưởng và hoạt tính kháng khuẩn của chủng tuyển chọn 3.5.1. Ảnh hưởng của thời gian nuôi cấy Để xác định thời điểm nuôi cấy thích hợp cho sự ST và sinh chất kháng khuẩn của 2 chủng Lactobacillus PA2 và Lactobacillus PP, nhằm thu nhận sinh khối hiệu quả. Chúng tôi tiến hành nuôi cấy các chủng LAB đã tuyển chọn trong môi trường MRS lỏng ở 37P0PC. Thu nhận mẫu tại các thời điểm 0; 12; 24; 36; 48; 60; 72; 84; 96 giờ. Xác định sự tăng trưởng, sự thay đổi pH và hoạt tính kháng khuẩn của 2 chủng trên. Kết quả được thể hiện qua bảng 3.13 và biểu diễn qua đồ thị 3.1; 3.2. Bảng 3.13. Ảnh hưởng thời gian nuôi cấy đến sự ST, hoạt tính kháng khuẩn của chủng Lactobacillus PA2 và Lactobacillus PP Thời gian (giờ) Mật độ tế bào, (ODR610nmR) Hoạt tính đối kháng, (D - d, cm) pH sau Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP 0 0,020 0,025 0,00 0,00 6,35 6,35 12 0,496 0,352 0,00 0,00 6,25 6,30 24 2,418 2,245 3,18 3,03 3,94 4,35 36 2,482 2,354 3,65 3,36 3,84 3,94 48 2,482 2,382 3,50 3,54 3,84 3,90 60 2,459 2,346 3,42 3,42 3,86 3,92 72 2,386 2,323 3,27 3,26 3,87 3,95 84 2,350 2,294 3,22 3,13 3,94 3,96 96 2,334 2,270 3,11 3,04 3,98 3,98 Đồ thị 3.1. Ảnh hưởng thời gian nuôi cấy đến sự ST và hoạt tính kháng khuẩn của chủng Lactobacillus PA2 Đồ thị 3.2. Ảnh hưởng thời gian nuôi cấy đến sự ST và hoạt tính kháng khuẩn của chủng Lactobacillus PP 12 giờ 24 giờ 36 giờ Hình 3.9. Hoạt tính kháng khuẩn của chủng Lactobacillus PA2 đối vB. subtilis được nuôi cấy qua các thời gian khác nhau 0 0,5 1 1,5 2 2,5 3 3,5 4 0 0,5 1 1,5 2 2,5 3 3,5 4 0 12 24 36 48 60 72 84 96 Mật độ tế bào Hoạt tính đối kháng M ật độ t ế bà o (O D 61 0 H oạ t tí nh đ ối k há ng D -d (c m ) Thời gian nuôi cấy (giờ) 48 giờ 60 giờ 72 giờ Hình 3.9. Hoạt tính kháng khuẩn của chủng Lactobacillus PA2 đối với B. subtilis được nuôi cấy qua các thời gian khác nhau (tiếp theo) Nhận xét: Qua số liệu ở bảng 3.13 và đồ thị 3.1; 3.2 chúng tôi nhận thấy, sự tăng trưởng của cả 2 chủng bắt đầu gia tăng ở thời điểm 12 giờ. Tuy nhiên, ở mỗi chủng sự tăng trưởng đạt cực đại ở thời điểm khác nhau, đối với chủng Lactobacillus PA2 đạt cực đại ở thời điểm 36 giờ và tương đối ổn định đến 48 giờ, sau đó giảm dần nhưng giảm không đáng kể. Còn chủng Lactobacillus PP tăng trưởng và hoạt tính kháng khuẩn đạt cực đại ở thời điểm 48 giờ và giảm dần theo thời gian. Như vậy, có thể xác định qúa trình ST của các chủng như sau: + Chủng Lactobacillus PA2: pha tiềm phát từ 0 – 12 giờ, pha logarit từ 12–36 giờ, pha cân bằng từ 36 – 48 giờ, pha suy vong ở thời điểm sau 48 giờ. + Chủng Lactobacillus PP: pha tiềm phát từ 0 – 12 giờ, pha logarit từ 12 – 48 giờ, pha cân bằng từ 48 – 60 giờ, pha suy vong sau 60 giờ. Kết quả này phù hợp với kết quả nghiên cứu của tác giả Nguyễn Văn Thanh (2002) và nghiên cứu của tác giả Lê Thị Hồng Tuyết (2004). Mặt khác, chúng tôi nhận thấy rằng giá trị pH của MT sau nuôi cấy tỷ lệ nghịch với sự tăng trưởng và hoạt tính kháng khuẩn của các chủng này. Cụ thể, ở chủng Lactobacillus PA2 tăng trưởng và hoạt tính kháng khuẩn tăng lên từ 12 đến 36 giờ, không đổi đến 48 giờ, bắt đầu giảm từ thời điểm 48 giờ. Ngược lại, pH bắt đầu giảm từ thời điểm 12 giờ và giảm cực đại đến 48 giờ, sau đó lại bắt đầu tăng lên, chủng PP cũng tương tự. Điều này có thể giải thích là do sản phẩm chính của quá trình lên men lactic đồng hình là acid lactic. Do vậy, sự tăng trưởng của VK sản sinh ra acid lactic làm pH của MT sau nuôi cấy giảm, đồng thời acid tạo ra đã ức chế VSV gây bệnh do vậy hoạt tính kháng khuẩn tăng lên tỷ lệ thuận cùng với sự tăng trưởng. Như vậy, để thu sinh khối đạt cao nhất và hiệu quả nhất thì nên thu sinh khối đối với chủng Lactobacillus PA2 ở thời điểm 36 giờ, chủng Lactobacillus PP ở thời điểm 48 giờ. 3.5.2. Ảnh hưởng pH ban đầu Giá trị pH ban đầu trong MT có ảnh hưởng rất lớn đến sự ST và sinh tổng hợp các chất của VSV. Đối với LAB thì đây là một đặc điểm rất quan trọng vì sự ST của chúng phụ thuộc rất nhiều vào pH ban đầu của MT. Để xác định độ pH tối ưu cho sự ST và tạo hoạt tính kháng khuẩn cao nhất của hai chủng Lactobacillus PA2 và Lactobacillus PP, chúng tôi tiếp tục khảo sát pH ban đầu của MT ở các giá trị pH 5,5; 6,0; 6,5; 7,0 và 7,5. Điều chỉnh pH môi trường bằng NaOH 1N và HCl 1N. Thu nhận mẫu sau 36 giờ đối với chủng Lactobacillus PA2 sau 48 giờ với chủng Lactobacillus PP. Xác định sự tăng trưởng, sự thay đổi pH và hoạt tính kháng khuẩn của 2 chủng trên. Kết quả được thể hiện qua bảng 3.14 và biểu diễn qua đồ thị 3.3; 3.4. Bảng 3.14. Kết quả khảo sát ảnh hưởng pH môi trường nuôi cấy đến sự ST, hoạt tính kháng khuẩn của chủng Lactobacillus PA2 và Lactobacillus PP Độ pH ban đầu Mật độ tế bào, (ODR610nmR) Hoạt tính đối kháng, (D - d, cm) pH sau Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP 5,5 2,358 2,358 3,63 3,59 3,69 3,70 6,0 2,378 2,372 3,70 3,68 3,78 3,79 6,5 2,395 2,382 3,93 3,85 3,83 3,84 7,0 2,382 2,373 3,55 3,55 3,90 3,94 7,5 2,370 2,346 3,49 3,47 4,25 4,25 Đồ thi 3.3. Ảnh hưởng pH ban đầu của MT đến sự ST và hoạt tính kháng khuẩn của chủng Lactobacillus PA2 Đồ thị 3.4. Ảnh hưởng pH ban đầu của MT đến sự ST và hoạt tính kháng khuẩn của chủng Lactobacillus PP Nhận xét: Qua kết quả bảng 3.14 chúng tôi nhận thấy, cả hai chủng đều có khả năng phát triển tốt ở khoảng pH từ 5,5 đến 7,5. Khả năng ST và tạo hoạt tính kháng khuẩn cao nhất trên cả hai chủng đều ở pH 6,5. Cụ thể, ở pH 6,5 mật độ tế bào đạt cao nhất (ODR610R = 2,395 đối với chủng Lactobacillus PA2, ODR610R = 2,382 đối với chủng Lactobacillus PP) và hoạt tính kháng khuẩn cũng đạt cao nhất (chủng Lactobacillus PA2: D – d = 3,93 cm và chủng Lactobacillus PP: D - d = 3,85cm). pH = 5,5 pH = 6,0 pH = 6,5 pH = 7,0 pH = 7,5 Hình 3.10. Hoạt tính kháng khuẩn của chủng Lactobacillus PA2 đối với B. subtilis khi được nuôi cấy ở các pH ban đầu khác nhau Theo chúng tôi, pH ban đầu của MT có vai trò quan trọng, góp phần tạo điều kiện thuận lợi cho VK trong giai đoạn đầu của quá trình đồng hóa và tổng hợp các chất cần thiết. Cả hai chủng đều có thể ST tốt ở pH = 5,5 – 7,5. Do vậy, chúng có thể ST và sinh chất kháng khuẩn cao ở pH của MT trong đường ruột của người. Tại đây, chúng có khả năng ST, đồng thời sản sinh acid lactic làm pH môi trường thấp, tạo điều kiện bất lợi và ức chế sự phát triển của VK gây bệnh đường ruột. Đặc biệt, trong cùng MT khi LAB tồn tại và phát triển được ở pH kiềm sẽ có khả năng ức chế, tiêu diệt các VK gây thối, gây bệnh. Đây cũng là một đặc điểm nổi bật góp phần tạo nên vai trò probiotic của 2 chủng này, khi chúng ST trong đường ruột của người. Kết quả của chúng tôi phù hợp với kết quả nghiên cứu của Trần Thị Mỹ Trang (2007), Nguyễn Văn Thanh (2002). Như vậy, pH ban đầu tối ưu cho sự tăng sinh khối tế bào và hoạt tính kháng khuẩn đối với cả hai chủng là 6,5. 3.5.3. Ảnh hưởng nhiệt độ nuôi cấy Nhiệt độ nuôi cấy là một trong những yếu tố của MT có ảnh hưởng mạnh đến sự ST và sinh tổng hợp các chất có hoạt tính sinh học của VSV. Do đó, việc xác định nhiệt độ tối ưu cho sự tạo sinh khối là cần thiết. Để xác định được nhiệt độ thích hợp cho sự ST và tạo hoạt tính kháng khuẩn của 2 chủng nghiên cứu, chúng tôi tiến hành nuôi cấy các chủng này trong môi trường MRS lỏng ở các nhiệt độ 200C; 250C; 300C; 350C; 370C; 400C; 450C; 500C. Kết quả được thể hiện qua bảng 3.15 và biểu diễn trên đồ thị 3.5; 3.6. Bảng 3.15. Ảnh hưởng nhiệt độ MT nuôi cấy đến sự ST, hoạt tính kháng khuẩn của chủng Lactobacillus PA2 và Lactobacillus PP Nhiệt độ (P0PC) Mật độ tế bào, (ODR610nmR) Hoạt tính đối kháng, (D - d, cm) pH sau Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP 20 2,214 2,214 2,94 2,82 4,23 4,25 25 2,422 2,334 3,13 3,03 4,07 4,12 30 2,516 2,346 3,63 3,47 3,94 3,96 35 2,574 2,428 3,80 3,63 3,91 3,92 37 2,602 2,482 3,89 3,79 3,84 3,85 40 2,463 2,466 3,60 3,59 4,03 4,04 45 2,106 2,171 3,04 3,01 4,00 4,05 50 1,824 1,838 2,74 2,72 4,31 4,32 Đồ thị 3.5. Ảnh hưởng nhiệt độ MT nuôi cấy đến sự ST và hoạt tính kháng khuẩn của chủng Lactobacillus PA2 Đồ thị 3.6. Ảnh hưởng nhiệt độ môi trường nuôi cấy đến sự ST và hoạt tính kháng khuẩn của chủng Lactobacillus PP 20P0PC 25P0PC 30P0PC 35P0PC 37P0PC 40P0PC Hình 3.11. Hoạt tính kháng khuẩn của chủng Lactobacillus PA2 đối với B. subtilis khi nuôi ở các nhiệt độ MT khác nhau Nhận xét: Qua đồ thị 3.5 và 3.6, nhận thấy cả 2 chủng đều có khả năng phát triển tốt trong khoảng nhiệt độ từ 25P0PC – 40P0PC, nhiệt độ tối ưu từ 35P0PC - 37P0PC với mật độ tế bào đạt ở mức cao nhất (ODR610R = 2,602 đối với chủng Lactobacillus PA2, ODR610R = 2,482 đối với chủng Lactobacillus PP). Hoạt tính kháng khuẩn tỷ lệ thuận với khả năng ST, cao nhất (D – d = 3,89 cm với chủng Lactobacillus PA2 và 3,79 cm với chủng Lactobacillus PP) đạt được ở nhiệt độ 35P0PC - 37P0PC. Mặt khác, qua bảng số liệu cho thấy, độ pH của MT sau nuôi cấy có sự biến đổi cùng với sự ST của 2 chủng này, pH thấp nhất (3,84 đối với chủng PA2 và 3,85 chủng PP) ở nhiệt độ ST tối ưu 35P0PC - 37P0PC. Điều này có thể giải thích, do quá trình ST của hai chủng này đã tạo ra acid lactic là sản phẩm chính của quá trình lên men lactic đồng hình, làm pH môi trường nuôi cấy giảm xuống thấp nhất. Do vậy, đã ức chế sự ST của VSV kiểm định, tạo hoạt tính kháng khuẩn cao nhất. Qua đây ta có thể thấy, nhiệt độ ST tối ưu của cả hai chủng từ 35P0PC - 37P0P, là khoảng nhiệt độ gần với nhiệt độ cơ thể người (37P0PC). Chính điều này là đặc điểm có lợi cho sự ST của chúng trong đường tiêu hóa của người. Trong ruột người, chúng có thể ST tốt, đồng thời sinh các chất kháng khuẩn ức chế VK gây bệnh. Vì thế, có khả năng ức chế sự ST, phát triển và gây bệnh của các VK sống trong ruột người. 3.5.4. Ảnh hưởng điều kiện nuôi cấy tĩnh và lắc Cả hai chủng Lactobacillus PA2 và Lactobacillus PP là vi hiếu khí. Do đó, mục đích của của thí nghiệm là khảo sát ở điều kiện nuôi cấy thích hợp nhất cho sự ST cũng như hoạt tính kháng khuẩn của chủng nghiên cứu. Chúng tôi tiến hành nuôi cấy chủng đã được tuyển chọn ở hai điều kiện tĩnh và lắc (200 vòng/ phút) ở pH 6,5 và nhiệt độ 37P0PC. Thu nhận mẫu, kiểm tra sự tạo thành sinh khối và hoạt tính kháng khuẩn của 2 chủng. Kết quả được thể hiện qua bảng 3.16 và biểu diễn trên đồ thị 3.7; 3.8. Bảng 3.16. Ảnh hưởng điều kiện nuôi cấy tĩnh và lắc lên sự ST, hoạt tính kháng khuẩn của chủng Lactobacillus PA2 và Lactobacillus PP Điều kiện Mật độ tế bào ODR610nm Hoạt tính đối kháng, (D - d, cm) pH sau Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP Lắc 1,961 1,830 1,80 1,43 4,63 4,65 Tĩnh 2,527 2,470 3,60 3,56 3,98 3,89 Biểu đồ 3.7. Ảnh hưởng của điều kiện nuôi tĩnh và lắc lên chủng Lactobacillus PA2 Biểu đồ 3.8. Ảnh hưởng của điều kiện nuôi tĩnh và lắc lên chủng Lactobacillus PP Nuôi cấy tĩnh Nuôi cấy lắc Hình 3.12. Hoạt tính kháng khuẩn của chủng Lactobacillus PA2 đối với B. subtilis trong điều kiện nuôi cấy tĩnh và lắc Nuôi cấy tĩnh Nuôi cấy lắc Hình 3.13. Hoạt tính kháng khuẩn của chủng Lactobacillus PP đối với B. subtilis trong điều kiện nuôi cấy tĩnh và lắc Nhận xét: Qua kết quả ở bảng 3.16 và biểu đồ 3.7; 3.8 chúng tôi nhận thấy, cả 2 chủng VK trên đều có khả năng ST phát triển trong điều kiện tĩnh và lắc. Khả năng ST của chủng Lactobacillus PA2 cao hơn chủng Lactobacillus PP, thể hiện qua mật độ tế bào cũng như hoạt tính kháng khuẩn. Cụ thể, mật độ tế bào trong điều kiện nuôi cấy tĩnh (ODR610R = 2,527 với chủng Lactobacillus PA2 và ODR610R = 2,470 với chủng Lactobacillus PP), đường kính vòng kháng khuẩn (D – d = 3,6 cm với chủng Lactobacillus PA2, D – d = 3,56 cm với chủng Lactobacillus PP). Bên cạnh đó, chúng tôi nhận thấy pH của MT sau nuôi cấy biến đổi tỷ lệ nghịch với sự ST của 2 chủng này, độ pH này cấy giảm khi khả năng ST tăng. Điều này, chứng tỏ lượng acid lactic sản phẩm chính của quá trình lên men đồng hình tạo ra, tỷ lệ thuận với sự tăng trưởng. Mặt khác, cả 2 chủng đều sinh ST tốt trong điều kiện nuôi cấy tĩnh hơn nuôi cấy lắc, điều này phù hợp với kiểu hô hấp của chúng là vi hiếu khí. Do vậy, chúng có thể ST tốt trong đường tiêu hóa người. Đây cũng là một đặc điểm ưu thế khi sử dụng 2 chủng này làm probiotic cho người. Kết quả nghiên cứu của chúng tôi phù hợp với kết quả nghiên cứu của Lê Thị Hồng Tuyết (2004). Như vậy, để thu sinh khối hiệu quả đối với cả hai chủng này nên thu ở điều kiện nuôi cấy tĩnh. 3.5.5. Nguồn cacbon Mục đích của thí nghiệm này là nhằm xác định nguồn cacbon thích hợp nhất, rẻ tiền nhất cho sự tăng sinh khối tế bào của chủng Lactobacillus PA2 và Lactobacillus PP. Chúng tôi nuôi cấy 2 chủng trên MT với nguồn cacbon thay đổi là glucose, saccharose, maltose, galactose, lactose, manitol ở các điều kiện tối ưu đã được khảo sát. Thu nhận mẫu, kiểm tra khả năng ST và sinh các chất kháng khuẩn của 2 chủng này. Kết quả được thể hiện qua bảng 3.17 và biểu diễn trên đồ thị 3.9 và 3.10. Bảng 3.17. Kết quả khảo sát ảnh hưởng nguồn cacbon đến sự ST, hoạt tính kháng khuẩn của chủng Lactobacillus PA2 và chủng Lactobacillus PP Nguồn cacbon Mật độ tế bào, (ODR610nmR) Hoạt tính đối kháng, (D - d, cm) pH sau Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP Lactose 2,312 2,312 3,17 3,15 4,60 4,60 Glucose 2,397 2,396 3,40 3,38 4,63 4,63 Saccharose 2,401 2,382 3,40 3,39 4,45 4,45 Galactose 2,391 2,155 3,37 3,34 4,47 4,47 Maltose 2,309 2,309 3,30 3,31 4,66 4,66 Manitol 0,316 0,346 0,00 0,00 6,25 6,25 Nhận xét: Qua kết quả khảo sát chúng tôi nhận thấy, cả 2 chủng đều có khả năng sử dụng được nhiều nguồn cacbon khác nhau. Tuy nhiên, với nguồn cacbon là manitol chúng đều tăng trưởng rất thấp (ODR610R ≤ 0,346), không có hoạt tính kháng khuẩn (D – d = 0,0 cm). Điều này chứng tỏ, chúng không sử dụng được đường manitol. Trong số các nguồn cacbon (lactose, glucose, saccharose, maltose, galactose) được khảo sát. Nhìn chung, tốc độ tăng trưởng này của cả hai chủng khi sử dụng các nguồn cacbon này, không có sự khác biệt lớn (mật độ tế bào cũng như hoạt tính kháng khuẩn của chúng chênh lệch không đáng kể). Qua đó cho thấy, chúng có thể sử dụng tốt nhiều nguồn cacbon khác nhau. Nhờ vậy, chúng có thể ST và tạo chất kháng khuẩn cao khi tồn tại trong đường ruột của người. Tại đây, chúng có thể sử dụng các nguồn cacbon khác nhau để ST và ức chế sự ST và gây bệnh của một số VK đường ruột. Biểu đồ 3.9. Ảnh hưởng của nguồn cacbon lên sự ST và hoạt tính kháng khuẩn của chủng Lactobacillus PA2 Biểu đồ 3.10. Ảnh hưởng của nguồn cacbon lên sự ST và hoạt tính kháng khuẩn của chủng Lactobacillus PP Lactose Glucose Maltose Saccharose Galactose Manitol Hình 3.14. Hoạt tính đối kháng của Lactobacillus PA2 đối với B. subtilis khi nuôi cấy trên MT với các nguồn cacbon khác nhau. Lactose Glucose Maltose Saccharose Galactose Manitol Hình 3.15. Hoạt tính đối kháng của Lactobacillus PP đối với B. subtilis khi nuôi cấy trên MT với các nguồn cacbon khác nhau. Đặc biệt, với khả năng sử dụng nguồn cacbon là lactose có ý nghĩa lớn trong việc việc ứng dụng làm probiotic cho những bệnh nhân không dung nạp được lactose trong sữa. Hai chủng VK này khi sử dụng làm probiotic, sẽ thủy phân lactose trong sữa. Giúp các bệnh nhân này khắc phục chứng không dung nạp lactose trong sữa. Từ đó, có thể sử dụng được sữa nhằm bổ sung canxi và các dưỡng chất cần thiết cho cơ thể. Trong 6 nguồn cacbon được khảo sát, nguồn cacbon là glucose và saccharose cho khả năng ST cũng như hoạt tính kháng khuẩn cao nhất. Do vậy, có thể sử dụng glucose hoặc saccharose làm nguồn cung cấp cacbon để thu sinh khối tế bào hiệu quả nhất. 3.5.6. Nồng độ glucose Trong môi trường MRS, glucose đóng vai trò như nguồn cung cấp cacbon cho quá trình trao đổi vật chất và năng lượng của VSV. Với mục đích xác định nồng độ glucose thích hợp cho sự tăng trưởng cũng như khả năng kháng khuẩn. Chúng tôi tiến hành nuôi cấy hai chủng Lactobacillus PA2 và Lactobacillus PP trên môi trường MRS lỏng có bổ sung 0%; 1%; 2%; 3%; 4% và 5% glucose, với các điều kiện như đã được khảo sát trước. Thu nhận mẫu, kiểm tra các kết quả. Kết quả được thể hiện qua bảng 3.18 và biểu diễn trên đồ thị 3.11; 3.12. Bảng 3.18. Ảnh hưởng nồng độ glucose lên sự ST, hoạt tính kháng khuẩn của chủng Lactobacillus PA2 và Lactobacillus PP Nồng độ glucose (%) Mật độ tế bào, (ODR610nmR) Hoạt tính đối kháng, (D- d, cm) pH sau Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP 0 0,397 0,339 0,00 0,00 6,45 6,46 1 2,242 2,241 3,27 3,30 4,46 4,45 2 2,502 2,515 3,93 3,86 3,98 3,99 3 2,571 2,564 3,98 3,88 3,71 3,73 4 2,592 2,560 3,95 3,89 3,66 3,66 5 2,579 2,562 3,94 3,89 3,64 3,64 Đồ thi 3.11. Ảnh hưởng nồng độ glucose lên sự ST và hoạt tính kháng khuẩn của chủng Lactobacillus PA2 Đồ thị 3.12. Ảnh hưởng nồng độ glucose đến sự ST và hoạt tính Kháng khuẩn của chủng Lactobacillus PP 0% glucose 1% glucose 2% glucose 3% glucose 4% glucose 5% glucose Hình 3.16. Hoạt tính đối kháng của chủng Lactobacillus PA2 đối với B. subtilis khi được nuôi trên MT với các nồng độ glucose khác nhau Nhận xét: Qua kết quả ở bảng 3.18 cho thấy, cả hai chủng đều phát triển rất yếu khi ta không bổ sung nguồn glucose vào MT dinh dưỡng, mật độ tế bào rất thấp (ODR610R = 0,397 với chủng Lactobacillus PA2 và ODR610 R= 0,339 với chủng Lactobacillus PP), không có hoạt tính kháng khuẩn (D – d = 0,0 cm). Có thể nói, đây là một dưỡng chất cần thiết cho sự phát triển của chúng. Khi bổ sung glucose trong khoảng ở từ 1% - 2% thì sự ST và hoạt tính kháng khuẩn của chúng tăng lên rõ rệt. Tuy nhiên, từ nồng độ 2% - 5% thì sự phát triển cũng như hoạt tính kháng khuẩn tương đối ổn định. Như vậy, để thu sinh khối các chủng VK trên đạt hiệu quả ta có thể bổ sung vào môi trường MRS lỏng 2% đường glucose. 3.5.7. Nồng độ cao nấm men Một đặc điểm quan trọng của các LAB là nhu cầu dinh dưỡng phức tạp. Không một đại diện nào thuộc nhóm này có thể phát triển trên MT muối khoáng thuần khiết chứa glucose và NHR4RP+P. Đa số trong chúng cần hàng loạt các vitamin như tiamin, biotin, lactoflavin, acid folic, acid nicotinic. Do đó, người ta thường nuôi cấy LAB trên MT phức tạp chứa một lượng lớn cao nấm men, dịch cà chua và thậm chí là máu. Trong nấm men có chứa một lượng lớn tiamin (BR1R), riboflavin (BR2R), ecgoxterin (tiền vitamin D) và một lượng lớn protein. Với mục đích xác định nồng độ cao nấm men thích hợp cho sự tăng trưởng cũng như hoạt tính kháng khuẩn. Chúng tôi tiến hành nuôi cấy hai chủng Lactobacillus PA2 và Lactobacillus PP trên môi trường MRS lỏng có bổ sung 0%; 1%; 2%; 3%; 4% và 5% cao nấm men, ở nhiệt độ 37P0PC, pH 6,5. Kết quả được thể hiện qua bảng 3.19 và biểu diễn trên đồ thị 3.13; 3.14. Bảng 3.19. Ảnh hưởng nồng độ cao nấm men lên sự ST, hoạt tính kháng khuẩn của chủng Lactobacillus PA2 và Lactobacillus PP Nồng độ cao nấm men (%) Mật độ tế bào, (ODR610nmR) Hoạt tính đối kháng, (D-d, cm) pH sau Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP Lactobacillus PA2 Lactobacillus PP 0 2,358 2,333 3,49 3,17 3,91 3,91 1 2,469 2,448 3,66 3,46 3,89 3,88 2 2,466 2,445 3,63 3,45 4,04 4,01 3 2,463 2,442 3,62 3,42 4,14 4,14 4 2,463 2,442 3,62 3,42 4,25 4,25 5 2,464 2,443 3,62 3,42 4,33 4,33 Đồ thi 3.13. Ảnh hưởng nồng độ cao nấm men lên sự ST và hoạt tính kháng khuẩn của chủng Lactobacillus PA2 Đồ thi 3.14. Ảnh hưởng nồng độ cao nấm men đến sự ST và hoạt tính kháng khuẩn của Lactobacillus PP Nhận xét: Qua kết quả khảo sát chúng tôi nhận thấy rằng, khi thay đổi nồng độ cao nấm men từ 0% đến 5% thì ở nồng độ 1% cao nấm men sự ST và hoạt tính kháng khuẩn trên cả hai chủng tăng lên đáng kể, mật độ tế bào gần đạt cực đại (ODR610R = 2,469 với chủng Lactobacillus PA2 và ODR610R = 2,448 với chủng Lactobacillus PP) và gần như không thay đổi ở các nồng độ tiếp theo. Tuy nhiên, đối với hoạt tính kháng khuẩn thì tăng đạt cực đại ở nồng độ 1% và có xu hướng giảm xuống ở các nồng độ sau nhưng không đáng kể. Việc giảm hoạt tính kháng khuẩn ở các nồng độ từ 2% đến 5% có thể tạm giải thích do lượng acid lactic sinh ra giảm xuống, thể hiện pH của MT sau nuôi cấy ở các nồng 2% đến 5% có chiều hướng tăng lên từ pH 3,89 (nồng độ 1%) lên đến 4,33 (nồng độ 5%). Do vậy, nồng độ cao nấm men tối ưu cho sự tăng sinh khối tế bào của cả hai chủng là 1%. Kết quả nghiên cứu này của chúng tôi, phù hợp với nghiên cứu của tác giả Lê Thị Hồng Tuyết (2004) khi nghiên cứu nồng độ cao nấm men ảnh hưởng lên sự ST và sinh chất kháng khuẩn của chủng L. acidophilus. Như vậy, để thu sinh khối tế bào của hai chủng VK này nên bổ sung vào MT nuôi cấy MRS lỏng 1% cao nấm men. Qua các kết quả nghiên cứu ảnh hưởng của các điều kiện MT lên khả năng tạo sinh khối tế bào của hai chủng Lactobacillus PA2 và Lactobacillus PP. Chúng tôi có thể xác định được các điều kiện tối ưu cho sự tạo thành sinh khối của hai chủng này như sau: - Môi trường MRS - pH ban đầu: 6,5 - Nhiệt độ nuôi cấy: 35P0PC – 37P0PC - Nuôi cấy tĩnh - Nguồn cacbon là glucose với nồng độ 2% - Nồng độ cao nấm men: 1% 3.6. Động thái quá trình tạo sinh khối tế bào của các chủng LAB trong điều kiện tối ưu Tiến hành nuôi cấy tĩnh hai chủng Lactobacillus PA2 và chủng Lactobacillus PP trên môi trường MRS lỏng với các điều kiện tối ưu như đã khảo sát. Xác định sự tăng trưởng, sự thay đổi pH và xác định hoạt tính kháng khuẩn. Kết quả được thể hiện qua bảng 3.20. và biểu diễn trên đồ thị 3.19; 3.20. Bảng 3.20. Kết quả khảo sát biến động mật độ tế bào, pH môi trường, hoạt tính kháng khuẩn theo thời gian của chủng Lactobacillus PA2 và Lactobacillus PP Thời gian (giờ) Lactobacillus PA2 Lactobacillus PP Mật độ tế bào, (ODR610R) pH sau Hoạt tính đối kháng, (D - d, cm) Mật độ tế bào, (ODR610R) pH sau Hoạt tính đối kháng, (D - d, cm) 0 0,025 6,50 0,00 0,032 6,50 0,00 6 0,025 6,50 0,00 0,033 6,50 0,00 12 0,503 6,34 0,00 0,364 6,15 0,00 18 2,114 3,98 2,49 1,676 4,78 1,87 24 2,448 3,94 3,27 2,224 4,23 3,12 30 2,582 3,90 3,62 2,346 3,94 3,38 36 2,657 3,78 3,99 2,428 3,90 3,63 42 2,656 3,78 4,00 2,515 3,87 3,88 48 2,656 3,78 3,99 2,515 3,87 3,88 54 2,638 3,79 3,64 2,515 3,87 3,88 60 2,558 3,84 3,45 2,488 3,89 3,73 66 2,438 3,85 3,35 2,434 3,90 3,46 72 2,388 3,89 3,31 2,364 3,94 3,31 78 2,372 3,89 3,30 2,311 3,94 3,30 84 2,350 3,94 3,22 2,305 3,96 3,20 90 2,337 3,94 3,19 2,294 3,98 3,17 96 2,334 3,95 3,11 2,277 3,98 3,11 Đồ thị 3.19. Động thái quá trình sinh trưởng và sinh tổng hợp chất kháng khuẩn của chủng Lactobacillus PA2 Đồ thị 3.20. Động thái quá trình sinh trưởng và sinh tổng hợp chất kháng khuẩn của chủng Lactobacillus PP Nhận xét: Khi nuôi cấy hai chủng Lactobacillus PA2 và Lactobacillus PP trong điều kiện tối ưu như đã khảo sát, chúng tôi nhận thấy:  Đối với chủng Lactobacillus PA2, tại thời điểm từ thời điểm 12 – 18 giờ sự ST cũng như hoạt tính kháng khuẩn tăng nhanh, đạt cực đại tại thời điểm 36 giờ và ổn định đến thời điểm 48 giờ. Sau 48 giờ, sự ST cũng như hoạt tính kháng khuẩn bắt đầu có xu hướng pH sau 7 6 5 4 3 2 1 0 7 6 5 4 3 2 1 0 giảm. Ngược lại với sự tăng lên của mật độ tế bào và hoạt tính kháng khuẩn thì pH của MT giảm dần từ thời điểm 12 – 48 giờ, sau đó có xu hướng tăng lên nhưng không đáng kể. Do vậy, thu sinh khối tế bào tốt nhất ở thời điểm từ 30 đến 36 giờ, đây chính là giai đoạn chuyển từ pha logarit sang pha phát triển ổn định. Tương tự, đối với chủng Lactobacillus PP, sự ST và hoạt tính kháng khuẩn bắt đầu tăng lên từ thời điểm 12 giờ, tăng nhanh đến thời điểm 36 giờ, đạt cực đại ở thời điểm 42 giờ và ổn định đến thời điểm 54 giờ. Bắt đầu có xu hướng giảm từ thời điểm sau 54 giờ. Sự thay đổi pH của MT tỷ lệ nghịch với sự ST và hoạt tính đối kháng. Do vậy, thu sinh khối tế bào ở thời điểm từ 36 đến 42 giờ. Bảng 3.21. Tổng hợp các điều kiện tối ưu để thu sinh khối của hai chủng Lactobacillus PA2 và Lactobacillus PP. Điều kiện MT tối ưu Lactobacillus PA2 Lactobacillus PP Môi trường MRS MRS Thời gian thu sinh khối 30 – 36 giờ 36 – 42 giờ pH ban đầu 6,5 6,5 Nhiệt độ (P0PC) 35P0PC – 37P0PC 35P0PC – 37P0PC Nguồn cacbon glucose Glucose Nồng độ glucose (%) 1 - 2% 1 - 2% Nồng độ cao nấm men 1% 1% 3.7. Khả năng sống sót của các chủng vi khuẩn lactic sau đông khô Mục đích đông khô các chủng VSV là phương pháp bảo quản giống lâu dài và làm nguồn nguyên liệu để tạo chế phẩm probiotic. Chúng tôi tiến hành khảo sát khả năng sống sót các chủng Lactobacillus PA2 và Lactobacillus PP sau quá trình đông khô, tại các thời điểm 0; 15; 30; 45; 60; 75; 90 ngày bằng phương pháp đếm khuẩn lạc trên môi trường thạch (như ở mục 2.2.23). Kết quả được trình bày trong bảng 3.22. Bảng 3.22. Sự biến động số lượng tế bào của hai chủng vi khuẩn lactic theo thời gian bảo quản bằng đông khô Thời gian (ngày) Số lượng (CFU/g) 0 15 % 30 % 45 % Lactobacillus PA2 4,57 x10P9 4,38x10P9 95,84 4,29x10P9 93,87 4,12 x10P9 90,15 Lactobacillus PP 4,39 x10P9 4,12 x10P9 93,84 4,03x10P9 91,80 3,99x10P9 90,88 Thời gian (ngày) Số lượng (CFU/g) 60 % 75 % 90 % Lactobacillus PA2 4,11x10P9 90,00 3,65x10P9 79,87 3,45x10P9 75,49 Lactobacillus PP 3,97x10P9 90,50 3,44x10P9 78,36 3,26x10P9 74,26 Nhận xét: Từ kết quả ở bảng 3.22 chúng tôi nhận thấy, tỷ lệ sống sót của hai chủng sau đông khô là: tại thời điểm 15 ngày (≥ 93%), 60 ngày (≥ 90%) và sau 90 ngày (≥ 74%) Khả năng sống sót sau đông khô là một tiêu chuẩn rất quan trọng đối với một VSV sử dụng làm probiotic. Nhiều VSV probiotic chỉ phát huy vai trò probiotic khi chúng ở dạng còn sống. Lúc đó, chúng mới có khả năng ST gia tăng số kượng tế bào cũng như sản sinh các chất kháng khuẩn ức chế VSV gây bệnh, cũng như sản sinh các vitamin, enzyme, Do vậy, đặc tính sống sót cao sau đông khô có ý nghĩa hết sức quan trọng trong quá trình sử dụng để sản xuất các chế phẩm probiotic cũng như bảo quản chúng trong thời gian dài. Qua kết quả trên chúng tôi nhận thấy rằng, khả năng sống sót của 2 chủng này sau quá trình đông khô là cao so với kết quả nghiên cứu của tác giả Trần Thị Mỹ Trang (2006), khi nghiên cứu khả năng sống sót của chủng L. acidophilus sau 90 ngày đông khô là 20,17%. 3.8. Định danh đến loài bằng phương pháp sinh học phân tử Để khẳng định lại hai chủng trên thuộc loài L. acidophilus như trên nhãn các chế phẩm, chúng tôi gửi hai chủng PA2 và PP đến phòng xét nghiệm Công ty Nam Khoa – Thành phố Hồ Chí Minh, để định danh tiếp đến loài. Kết quả định danh đến loài bằng phương pháp giải trình tự gen 16S rRNA và tra cứu trên BLAST SEARCH. Với mỗi chủng chúng tôi đã tiến hành định danh lặp lại hai lần, với hai lần phân lập độc lập nhau (kết quả đính kèm ở phần phụ lục).  Chủng Lactobacillus PA2, kết quả giải trình tự gen 16S: CTGGCTCAGGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCA GAACCAGCAGATTTACTTCGGTAATGACGCTGGGGACGCGAGCGGCGGATGGGT GAGTAACACGTGGGGAACCTGCCCCATAGTCTGAGATACCACTTGGAAACAGGTG CTAATACCGGATAATAAAGCAGATCGCATGATCAGCTTATAAAAGGCGGCGTAAG CTGTCGCTATGGGATGGCCCCGCGGTGCATTAGCTAGTTGGTAAGGTAACGGCTT ACCAAGGCAATGATGCATAGCCGAGTTGAGAGACTGAACGGCCACATTGGGACT GAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGG AGCCAAGTCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAA GCTCTGTTGTTGGTGAAGAAGGATAGAGGTAGTAACTGGCCTTTATTTGAGCGTA ATCAACCAGAAAGTCACGGCTAACTACGTG. Kết luận: Chủng Lactobacillus PA2 là Lactobacillus suntoryeus với độ tương đồng 100%  Chủng Lactobacillus PP, kết quả giải trình tự gen 16S: TTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGC GAGCAGAACCAGCAGATTTACTTCGGTAATGAGCCTGGGGACGCGAGCGGCGGA TGGGTGAGTAACACGTGGGGAACCTGCCCCATAGTCTAGGATACCACTTGGAAAC AGGTGCTAATACCGGATAATAAAGCAGATCGCATGATCAGCTTATAAAAGGCGGC GTAAGCTGTCGCTATGGGATGGCCCCGCGGTGCATTAGCTAGTTGGTAAGGTAAC GGCTTACCAAGGCAATGATGCATAGCCGAGTTGAGAGACTGAACGGCCACATTGG GACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCAACA ATGGACGCAAGTCTGATGGACGAACGCCGCGTGAGTGAAGAGGGTTTTCGGATC GTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGTAGTAACTGGCCTTTATTTGA CGGTAATCAACCAGAAAGTCACGGCTAACTACGTGCCAGCAGCCGCGGTA Kết luận: Chủng Lactobacillus PP là Lactobacillus helveticus với độ tương đổng 99%, là Lactobacillus acidophilus với độ tương đồng 97% Như vậy, chủng Lactobacillus PA2: Lactobacillus suntoryeus. Chủng Lactobacillus PP: Lactobacillus helveticus Với mỗi chủng, chúng tôi đã tiến hành phân lập độc lập nhiều lần trong các chế phẩm chỉ chứa thành phần là L. acidophilus và định danh lặp lại hai lần. Kết quả của hai lần định danh trên mỗi chủng đều giống nhau. Thực tế, các chế phẩm này đã sử dụng một chủng VK khác thuộc chi Lactobacillus mang những đặc điểm tương tự và thay thế cho loài Lactobacillus acidophilus nên thành phần VSV trên nhãn thuốc là không đúng. Kết quả này chính là một sự cảnh tỉnh đối với việc sử dụng các chế phẩm probiotic trên thị trường thuốc hiện nay. Tác dụng và hiệu quả lâm sàng của các chế phẩm probiotic phụ thuộc gần như hoàn toàn vào đặc tính sinh lý – sinh hóa của VSV được sử dụng. Chỉ những loài nào đã được nghiên cứu lâm sàng đầy đủ mới bảo đảm an toàn và lợi ích sử dụng được chứng minh một cách khoa học. Vì vậy, việc công bố sai danh pháp của VSV trong chế phẩm probiotic là một điều không thể chấp nhận được. Để bảo đảm quyền lợi cho người tiêu dùng, cần phải có một tiêu chuẩn kiểm tra các sản phẩm chức năng mà trong đó chỉ tiêu định danh phải được quan tâm đúng mức, xây dựng đủ cơ sở khoa học cho công tác kiểm nghiệm. KẾT LUẬN VÀ KIẾN NGHỊ Kết luận Từ những thực nghiệm trên chúng tôi đã thu được kết luận sau: 1 - Từ 16 loại chế phẩm probiotic phổ biến trên thị trường thuốc ở Thành phố Hồ Chí Minh, chúng tôi đã phân lập đươc 31 chủng VK sinh acid và chọn được 2 chủng Lactobacillus PA2 và Lactobacillus PP có đặc điểm sinh học: thuộc chi Lactobacillus, tế bào hình que, GP+ P, vi hiếu khí, lên men lactic đồng hình, catalase âm tính, không tạo hoạt tính protease, bacteriocin âm tính, sản sinh acid lactic cao (1,46 -1,47 g/l). 2 – Có hoạt tính đối kháng mạnh, phổ kháng khuẩn rộng với các VSV kiểm định (gây bệnh đường ruột). Đặc biệt, có khả năng đối kháng được một số VK gây bệnh đường ruột kháng thuốc như S. aureus kháng methicillin, E. coli kháng ampicillin. 3 - Có khả năng sống sót cao trong các điều kiện bất lợi ở đường ruột của người:  Khả năng đề kháng tốt với các chất KS (điều trị bệnh đường ruột) như ciprothokacin, neomycin, kanamycin, clindamycin.  Khả năng chịu đựng pH thấp của cả hai chủng là cao: ở pH 1,5, tỷ lệ sống sót lớn hơn 55% tại thời điểm 120 phút.  Khả năng chịu acid mật của 2 chủng khá cao: - Ở nồng độ 0,5 – 1,0 % tỷ lệ sống sót cao: tại thời điểm1 giờ (≥ 95%), tại thời điểm 5 giờ (≤ 39%), tại thời điểm 10 giờ (≤ 35%). - Ở nồng độ acid mật 1,5 – 2% tỷ lệ sống sót thấp: tại thời điểm 5 giờ và 10 giờ (≤ 25%). 4 - Đã xác định được các điều kiện của MT nuôi cấy thích hợp cho sự tạo sinh khối, sinh chất kháng khuẩn của 2 chủng Lactobacillus PA2 và Lactobacillus PP là: - Môi trường MRS - pH ban đầu: 6,5 - Nhiệt độ nuôi cấy: 35P0PC – 37P0PC - Nuôi cấy tĩnh - Nguồn cacbon là glucose - Nồng độ đường glucose: 2% - Nồng độ cao nấm men: 1% - Thời gian tối ưu thu sinh khối 30 – 36 giờ (chủng Lactobacillus PA2); 36 – 42 giờ (chủng Lactobacillus PP) 5 - Đã tiến hành thu sinh khối, đông khô và kiểm tra độ sống sót của 2 chủng này theo thời gian 90 ngày với tỷ lệ sống sót cao (lớn hơn 73% trên cả 2 chủng). 6 - Kết quả nghiên cứu các đặc điểm hình thái, sinh lý, sinh hóa của 2 chủng PA2 và PP, kết hợp kết quả định danh đến loài của Công ty TNHH Dịch vụ và Thương mại Nam Khoa – Thành phố Hồ Chí Minh. Dựa vào khóa phân loại của Bergey’s (1986) và Okada (1992) có thể kết luận: chủng Lactobacillus PA2 là Lactobacillus suntoryeus; chủng Lactobacillus PP là Lactobacillus helveticus. Qua các kết quả nghiên cứu trên chúng tôi nhận thấy rằng, 2 chủng này có mang đặc điểm sinh học phù hợp với vai trò là một probiotic. Do vậy, có thể sử dụng chúng để tạo chế phẩm probiotic cho nguời. Tuy nhiên, thành phần VSV trên nhãn thuốc được ghi không đúng hoàn toàn sự thật. Kiến nghị Xác định bản chất của các yếu tố đối kháng của LAB với các vi khuẩn kiểm định. TÀI LIỆU THAM KHẢO TÀI LIỆU TIẾNG VIỆT 1. Kiều Hữu Ảnh (1999), Giáo trình Vi sinh vật học Công nghiệp, Nxb Khoa học và Kỹ thuật, Hà Nội, tr. 100 – 108. 2. Lý Kim Bảng, Lê Thanh Bình, Tạ Kim Chỉnh (1998), Ứng dụng vi khuẩn lactic trong bảo quản thức ăn xanh cho trâu bò, Tạp chí Khoa học Kỹ thuật Nông nghiệp, tập 10, tr. 455- 457. 3. Nguyễn Thị Chính, Trương Thị Hòa (2005), Vi sinh vật y học, Nxb Đại học Quốc gia Hà Nội. 4. Nguyễn Lân Dũng, Nguyễn Đình Quyến, Phạm Văn Ty (1997), Vi sinh vật học, Nxb Giáo dục, tr. 224-230. 5. Nguyễn Lân Dũng, Đoàn Xuân Mượu, Yên Phùng Tiến, Đặng Đức Thạch, Phạm Văn Ty, Một số phương pháp nghiên cứu vi sinh vật học, tập 1, Nxb Khoa học và Kỹ thuật Hà Nội (1972), tr.86 – 178. 6. Nguyễn Thành Đạt, Nguyễn Duy Thảo (1996), Vi sinh vật học, Nxb Giáo dục, tr. 133- 138. 7. Đào Trọng Đạt, Phan Thanh Phượng, Lê Ngọc Mỹ (1995), Bệnh đường tiêu hóa ở lợn, Nxb Nông nghiệp Hà Nội. 8. Trần Thanh Lan Hương, Phạm Thị Mai (2005), Hóa sinh y học, Nxb Y khoa. 9. Phạm Thị Minh Tâm (2008), Khảo sát định danh một số sản phẩm probiotic có Lactobacillus acidophilus bằng kit API 50CHL, Tạp chí Kiểm nghiệm thuốc, (20). 10. Nguyễn Hữu Phúc (1998), các phương pháp lên men thực phẩm truyền thống ở Việt Nam và các nước trong vùng. Nxb Nông nghiệp. 11. Hồ Văn Thảo (2006), Phân lập, định danh và tuyển chọn các chủng enterococcus có tiềm năng probiotic từ phân trẻ sơ sinh, Luận văn Thạc sĩ Sinh học, Đại học Khoa học Tự nhiên Tp. HCM, tr. 3-16. 12. Trần Linh Thước, Đặng Thị Phương Thảo, Đỗ Anh Tuấn (2004), Giáo trình thực tập Bioinformatic, Khoa Sinh học, Trường Đại học Khoa học Tự nhiên, Tp. Hồ Chí Minh, Lưu hành nội bộ. 13. Lê Ngọc Tú, La Văn Chú, Phạm Trân Châu, Nguyễn Lân Dũng (1982), Enzyme vi sinh vật. Nxb Khoa học và Kỹ thuật. 14. Nguyễn Văn Thanh, Nguyễn Vũ Tường Vy, Trần Thu Hoa (2007), Khảo sát khả năng chịu đựng acid, muối mật và KS của một số vi sinh vật là nguyên liệu sản xuất probiotic đường uống, Tạp chí dược học (378). 15. Trần Thị Mỹ Trang (2006), Nghiên cứu sử dụng vi khuẩn lactic để sản xuất chế phẩm probiotic phòng và trị bệnh đường ruột cho heo, Luận văn Thạc sỹ.Sinh học Đại học Sư phạm Tp. HCM. 16. Trần Thanh Thủy (1998), Hướng dẫn thực hành Vi sinh vật học. Nxb Giáo dục. 17. Phạm Hùng Vân (2007), Bacilulus clausii và vai trò probiotics trong điều chị tiêu chảy, Hội thảo chuyên đề. Hội nhi khoa Tp. HCM. TÀI LIỆU NƯỚC NGOÀI 18. Bielecki, S., Krystynowics, A., Turkiewicz, M., Kalinowska, H., “Bacteria cellulose’’, Technical Universsity of Lodz, Stefanowskiego, Poland, pp. 37-46. 19. Borriello S.P., (1984), “Bacteria and gastrointestinal secretion and motility”. Scand J Gastroenterol, vol 19, pp. 114-121. 20. Chuard C., and Reller L.B., (1998), “Bile – Esculin test for presiumptive identication of enterococci and streptococci: effect of bile concentration, inoculation technique, and incubation time”. J. Clin. Microbial, vol 36, pp. 1135 – 1136. 21 . Cai, Y., Kumai, S., Ogawa, M., Benno, Y. & Nakase, T. (1999), “Characterization and identifycation of Pediococcus species from forage crops and their applcation for silage preparation”, Appl Environ Microbiol 65, pp. 2901-2906. 22. Colum Dunne, Liam OP,PMahony, Lisa Murphy, Gerardine Thornton, Darrin Morrissey, Sile OP’PHalloran, Maria Feeney, Sarah Flynn, Fergus Shanahan, and J Kevin Collins (2001), “In vitro selection criteria for probiotic bacteria of human origin: correlation with in vivo findings” American Society for Clinical Nutrition, pp. 386-392. 23. Carbonelle, F Denneis, A. Marmonier, G Pion, R Vargues (1987), Bacteriologie medicale techniques usuelles, SIMEP SA Paris, France . 24. Cabo M.L Murado , Gonzalez M.P and Patstoriza L (1999), “A method for bacteoricin quantification”, Journal of Applied Microbiology, vol 87, pp. 907-914. 25. Gusils C., Bujazha M. and Gonzalez S., (2002), “Preliminary studies to desing a probiotic”, pp. 273 -279. 26.Goossens D.,Jonkers D.,Stobberingh E., Bogaard A., Russel M. and Stockburgger R., (2003), “Probiotic in gastroenterology: Indications and future perspectives”. Medical Microbiology, pp. 15-20. 27. Green Edward; Javed Muhammad and Grammell Renia (2003), “Lactic acid production”, World Intellual Property Organization, International Publication Number WO 03/008601, pp. 20-23. 28. Frank J. C and Nino M (2002), “The Lactic Acid Bacteria”. Microbiology, vol 28, pp. 281-370. 29. FAO/WHO Working Group (2002), “Guideline for the evaluation of probiotic in food”. Food and Agriculture Organizatin of the United Nations. 30. Heyman M., Menard S., (2002), “Probiotic microorganisms: how they affect intestinal pathphysiology”. Cell. Mol. Life Sci, vol 59, pp. 1-12. 31. Klein G., (2003), “Taxonomy, ecology and antibiotic resistance of enterococci from food and the gastro – intestinal tract”. International Journal of Food Microbiology, vol 88, pp. 123-131. 32. Kos B., Suskovic J., Vukovic S., Simpraga M., Frece J. and Matosic S., (2003), “Adhesion and aggregation ability of probiotic strain Lactobacillus M92”. Journal of Applied Microbiology, vol 94, pp. 981-987. 33. Karimi O. and Pena A.S. (2003), “Probiotic: isolated bacteria strain or mixture of different strain?”. Drug of Today, vol 39, pp. 565-597. 34. Kakinuma Y., (1998), “Inorganic cation transpost and energy transduction in Enterococcus hirae and other streptococci”. Microbiology and Molecular Biology, vol 62, pp. 1021 -1045. 35. Kos B., Suskovic J.,Vukovic S., Simpraga M., Frece J. and Matosic S., (2003), “Adhesion and aggregation ability of probiotic strains Lactobacillus acidophilus M92”. Journal of Applied Microbiology, vol 94, pp. 981-987. 36. Lane, D.J(1991), “16S/23S rRNA sequencing”, Nucleic acid techniques in bacterial systematic, pp. 115-175. 37. Luc De Vuyst, FreP,P driP,Pc Leroy (2007), “Bacteriocins From lactic acid bacteria: production, and food applications”, J Mol Microbial Biotechnol, pp. 194-199. 38. Luc De Vuyst, Fre’dri’c Leroy (2007), “Bacteriocins from lactic acid bacteria: production, purification, and food applications”, J Mol Microbiol Biotechnol, pp. 194-199. 39. Laukova A, Strompfova V. and Ouwehand A. (, 2004), “Adhesion properties of Enterococci to intestinal mucus of different hosts”. Veterinary Reseach Communication, vol 28, pp. 647-655. 40. Liong Min Tze (2006), “In-vivo and in-vitro cholesterol removal by Lactobacilli and Bifidobacteria”, A thesis submitted for the degree of Doctor of Philosophy, School of Molecu. 41. Marcinakova M., Simonova M., Laukova A., (2004), “Probiotic properties of Enterococcus faecium EF9296 strain isolated from silsge”. Bull Vet Inst Pulawy, vol 73, pp. 513-519. 42. Moore M. R. F., Saratinopoulos P., Tsakalidou E., De Vuyst L., (2006), “The role and application of enterococci in food and heath” International journal of food microbiology, vol 106, pp.1-24. 43. M. T. Liong and N. P. Shah (2005), “Acid and bile tolerance and cholesterol removal ability of Lactobacillus strains”, American Dairy Science Association, pp. 55-56. 44. Mishra V.,Prasad D.N.,(2005), “Application of invitro methods for selection of Lactobacillus casei strains as potential probiotics”. International journal of Food Microbiology, vol 103, pp.109-115. 45. Naidu A.S, Bidlack W.R, and Clemens R.A., (1999), “Probiotic spectra of lactic acid bacteria (LAB)”. Critical Review in Food Science and Nutrition, pp. 13-126. 46. Paula C, Teixeira M (1999). “Lactobacillus: Lactobacillus acidophilus” Encyclopedia of food Microbiology”. Academic Press, San Diego, pp. 112 -116. 47. Raio A., Peluso R., Nesme X.and Zoina A. (2004), “Chromosome and plasmid diversity of Agrobacterium strains isolated from Ficus benjamina tumor”, European Journal of Plant Pathology, vol 110, pp. 163-174. 48. Seppo Salminen (1997), “Lactic acid bacteria”, Univerof turku, Finland. 49. Song J.,Lee S –C, Kang J. –W.,Beak H-J, Suh J –W. (2004), “Phylogenetic analysis of Streptomyces spp. Isolated from potato scab lesions in Korea on basis of 16S rDNA gen and 16S-23S rDNA internally transceibed spacer seuqnces”, International Journal of Systematic and Evolutionary Microbiology, vol.54, pp. 203-209. 50. Stackebrandt E.Frederiksen W.,Grarrity G.M., Grimont P.A.D.,Kampfer P.,Maiden M.C.J.,Nesme X.,Rossello-Mora R.,Swings J, TruperH.,G.,Vauterin L.,Ward A. C.,Whitman W.B. (2002), “Report of the adhoc committee the re-evalution of the species definition in bacteriology”, International Journal of Systematic and Evolutionnary Microbiology, vol 52, pp. 1043-1047. 51. Saarela M.,Mogensen G., Fonde R.,(2000), “Probiotic bacteria: safety functional and technological properties”. Journal of Biotechnology, vol 84, pp 197-215. 52. Song J., Lee S.-C, Kang J.-W., Beak H.-J, Suh J.-W. (2004), “Phylogenetic analysis of Streptomyces spp. Isolated from potato scab lesion in Korea on basis of 16S rDNA gen and 16S -23S rDNA internally transceibed spacer seuqnces”, International Journal of Systermatic and Evolutionnary Microbiology, vol.54, pp. 203-209. 53. S. Oh, S. H. Kim, and R. W. Worobo (2000), “Characterization and purification of a bacteriocin produced by a potential probiotic culture, Lactobacillus acidophilus 30SC”, J Dairy Sci, pp.2747-2752. 54. Stackebrandt E.Frederiksen W.,Grarrity G.M., Grimont P.A.D.,Kampfer P.,Maiden M.C.J.,Nesme X.,Rossello-Mora R.,Swings J, TruperH.,G.,Vauterin L.,Ward A. C.,Whitman W.B. (2002), “Report of the adhoc committee the re-evalution of the species definition in bacteriology”, International Journal of Systematic and Evolutionnary Microbiology, vol 52, pp. 1043-1047. 55. Ouwehand A.C., Salminen S.,Isolauri E.,(2002), “Probiotics: an overview of beneficial effects”. Antonie van Leeuwenhoek, vol 82, pp 279 -289. 56. Young Ju Kim, Ji Hee Kang, Ji Sunlee & Myung Suklee (2001), “Study on the bacteriocin produced by Lactobacillus sản phẩm GM 7311”. Department of Microbiology college of nature Science Pukyong National University. 57. Yuan Kun Lee, Koji Nomoto, Seppo Salminen, Sherwood L. Gorbach (1999), “Handbook of probiotis”, John Wiley & Sons. 58.Yeung P.S.M ., M. E. Sanders, C.L. Kitts, R. Cano and P.S.Tong. “Species- Species- Specific indentification of Commercial Probiotic”. Strains. J. Dairy Sci. pp. 1039 – 1051. 59. Wood B.J.B and Holzapfel W.H (1995), “the genera of lactic acid bacteria”, Blackie Ademic and Professional, London, pp. 19-48. TÀI LIỆU INTERNET 60. 0Thttp:// www.enterococcus.ouhssc.edu0T 61. http:// www.fao.org/es/ESN/Probio.htm 62. http:// www.mesanders.com (probiotic basics) 63. 0Thttp:// en.wikipedia.org/wiki/Probiotic.html0T 64. http:// apresslp.gvpi.net/zpfmicro/lpext.dll/fmicro/a890-Ink 65. http:// www.baomoi.com 66.http:// vietbao.vn/Suc-khoe 67. http:// tintuc.timnhanh.com/xa-hoi/20100802/35AA93FB 68. 69. http:// apresslp.gvpi.net/zpfmicro/lpext.dll/fmicro/a890-Ink 70. http:// www.gut.bmjjournals.com PHỤ LỤC Giá trị tương quan giữa ODR610 Rvới số lượng tế bào của chủng Lactobacillus PA2 Stt Mật độ tế bào (ODR610nmR) Số lượng tế bào 1 0,1 3541600 2 0,2 6737500 3 0,3 9250000 4 0,4 15075000 5 0,5 18625000 6 0,6 24700000 7 0,7 28250000 Đồ thị. Đường tương quan tuyến tính giữa ODR610 Rvới số lượng tế bào của chủng Lactobacillus PA2 Bảng: Tương quan giữa thời gian và mật độ tế bào của hai chủng Lactobacillus PA2 và Lactobacillus PP Stt Thời gian (giờ) ODR610 Lactobacillus PP Lactobacillus PA2 1 0 0,032 0,025 2 3 0,032 0,025 3 6 0,033 0,032 4 9 0,063 0,038 5 12 0,364 0,503 6 15 1,050 1,415 7 18 1,676 2,114 8 21 1,980 2,334 9 24 2,224 2,448 10 27 2,290 2,515 11 30 2,346 2,582 12 33 2,378 2,612 13 36 2,428 2,657 14 39 2,484 2,657 15 42 2,515 2,656 16 45 2,515 2,656 17 48 2,515 2,656 18 51 2,516 2,648 19 54 2,515 2,638 20 57 2,515 2,604 21 60 2,488 2,558 22 63 2,467 2,515 23 66 2,434 2,438 24 69 2,401 2,412 25 72 2,364 2,388 26 75 2,343 2,380 27 78 2,311 2,372 28 81 2,305 2,336 29 84 2,305 2,352 30 87 2,299 2,344 31 90 2,294 2,337 32 93 2,288 2,334 33 96 2,277 2,230 Đồ thị. Đường cong sinh trưởng của chủng Lactobacillus PA2 Đồ thị. Đường cong sinh trưởng của chủng Lactobacillus PP

Các file đính kèm theo tài liệu này:

  • pdfnghien_cuu_dac_diem_va_vai_tro_cua_lactobacillus_acidophilus_trong_che_pham_probiotic_8771.pdf
Luận văn liên quan