Tạo dòng và biểu hiện gene mã hóa interferon alpha 2b của người trên hệ thống pichia pastoris

Trang nhan đề Lời cảm ơn Mục lục Danh mục các ký hiệu và chữ viết tắt Danh mục các bảng Danh mục các hình vẽ Mở đầu Chương_1: Tổng quan tài liệu Chương_2: Vật liệu và phương pháp Chương_3: Kết quả và biện luận Chương_4: Kết luận và kiến nghị Tài liệu tham khảo MụC LụC TRANG MụC LụC . i DANH MụC CÁC KÝ HIEU VÀ CH VIÊT TAT iii DANH MụC CÁC BNG iv DANH MụC CÁC HÌNH VE . v Mở đÂU 1 Chương I TổNG QUAN TÀI LIỆU . 2 I.1. INTERFERON 2 I.1.1. Các dạng Interferon . 2 I.1.2. Cơ chê hoạt động của Interferon 4 I.1.3. Các ứng dụng của Interferon . 6 I.1.4. Tình hình nghiên cứu Interferon hiện nay 8 I.2. HỆ THỐNG BIỂU HIỆN PICHIA PASTORIS 8 I.2.1. Các hệ thống biểu hien Interferon alpha 2b . 8 I.2.2. Ưu nhược điểm của hệ thống biểu hiện Pichia pastoris . 10 Chương II VậT LIệUVÀ PHƯƠNG PHÁP . 12 II.1. VậT LIệU 12 II.1.1. Dụng cụ và thiết bị 12 II.1.2. Hóa chât và môi trường . 13 II.1.3. Nguyên vật liệu . 15 II.2. PHƯƠNG PHÁP . 20 II.2.1. Tách chiêt DNA người tong sô bang Chelex 20 II.2.2. Phương pháp PCR (dùng đe khuêch đi đon gene mc tiêu và kiem tra khuan lc mang gene mc tiêu) 20 II.2.3. Phương pháp tinh sạch DNA từ gel agarose . 21 II.2.4. Phương pháp đien biên np cho E. coli 21 II.2.5. Phương pháp củat DNA bang enzyme củat gii hn 22 II.2.6. Phương pháp nôi DNA bang enzyme T4 ligase 22 II.2.7. Phương pháp tách chiêt plasmid t tê bào E. coli . 23 II.2.8. Phương pháp đien biên np cho Pichia pastoris . 23 II.2.9. Phương pháp lai khuan lc . 24 II.2.10. Phương pháp lên men Pichia pastoris 24 II.2.11. Phương pháp Bradford dùng đe đo hàm lưng protein . 25 II.2.12. Phương pháp đien di SDS-PAGE 25 II.2.13. Phương pháp Western blot . 27 Chương III KÊT QUẢ VÀ BIỆN LUẬN . 28 III.1. TẠO DÒNG ESCHERICHIA COLI MANG GENE Mà HÓA CHO INTERFERON ALPHA 2B CỦA NGƯỜI 28 III.1.1. Tổng hợp gene mã hóa cho Interferon alpha 2b của người . 28 III.1.2. Tạo dòng Escherichia coli DH5α mang vector nhân dòng gene mã hóa Interferon alpha 2b của người 30 III.2. TẠO DÒNG PICHIA PASTORIS BIểU HIệN INTERFERON ALPHA 2B CủA NGƯỜI . 34 III.2.1. Tạo dòng Escherichia coli DH5α mang vector biểu hiện Interferon alpha 2b của người 34 III.2.2. To dòng Pichia pastoris có khả" năng biểu hiện Interferon alpha 2b của người 37 III.3. BIểU HIệN INTERFERON ALPHA 2B CủA NGƯỜI . 38 Chương IV KÊT LUAN VÀ KIÊN NGH . 43 IV.1. Kêt luan 43 IV.2. Kiên ngh 43 TÀI LIEU THAM KHO

pdf17 trang | Chia sẻ: lvcdongnoi | Ngày: 20/08/2013 | Lượt xem: 2570 | Lượt tải: 8download
Bạn đang xem nội dung tài liệu Tạo dòng và biểu hiện gene mã hóa interferon alpha 2b của người trên hệ thống pichia pastoris, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Chương II VẬT LIỆU VÀ PHƯƠNG PHÁP Trang 12 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP II.1. VẬT LIỆU II.1.1. Dụng cụ và thiết bị • Dụng cụ Bộ pipetman 10, 20, 200, 1000 µl và ñầu tip tương ứng Các ống eppendorf 0.2ml và 1.5ml ðĩa petri nhựa, que cấy móc, que cấy trải, ñèn cồn, bình tia Bình tam giác 250ml, 500ml, 1 lít và 2 lít, cốc thủy tinh, ống falcon 50 ml • Thiết bị Bộ ñiện di ñứng (Biorad) Bộ ñiện di ngang (Biorad) Bộ nguồn Power A Basic (Biorad) Bồn ủ nhiệt WP7 L1 (Memmert) Cân BJ610C (Precisa) Cân phân tích XT 220A (Precisa) Máy chuyển màng khô (Biorad) Máy ñiện biến nạp ECM399 (BTX) Máy ño pH 213 (Hanna) Máy ñọc gel (Biorad) Máy ly tâm 5415R (Eppendorf) Máy ly tâm 5810 R (Eppendorf) Máy PCR PTC 0200 (Biorad) Máy quang phổ Biomate3 (Thermo EC) Máy ủ lắc NB-205V (N- Biotek) Tủ ấm (Memmert) Tủ cấy vô trùng AVC 4A1 (ESCO) Tủ ñông -20oC (Sanyo) Tủ ñông -80oC (Sanyo) Trang 13 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP II.1.2. Hóa chất và môi trường Các hóa chất sử dụng trong ñề tài ñược cung cấp bởi các hãng Biorad, Merck, New England Biolab, Stratagen, Qiagen, Fermentas, Abcam.  Các loại enzyme sử dụng Enzyme cắt giới hạn: EcoRI, NotI, SalI (New England Biolab) Enzyme nối: T4 ligase (New England Biolab)  Các loại kit sử dụng Kit nhân dòng ñầu bằng (CloneJET PCR cloning kit - Fermentas) Kit tách chiết DNA từ E. coli (Qiagen) Kit tinh sạch DNA từ gel agarose (Qiagen)  Thành phần hóa chất dùng trong phương pháp PCR Taq polymerase và dung dịch ñệm 10X ñi kèm (Genscript), Pfu DNA polymerase turbo, dung dịch ñệm 10X ñi kèm (Stratagen), dNTP (Fermentas)  Thành phần hóa chất dùng trong phương pháp ñiện biến nạp cho E.coli và Pichia pastoris + Dung dịch glycerol 10% + Dung dịch Ampicillin (50 mg/ml) + Dung dịch sorbitol 1M  Thành phần hóa chất dùng trong phương pháp ñiện di SDS-PAGE + Dung dịch ñơn phân 30% Acrylamide 60g Bisacrylamid 1.6g Nước cất vừa ñủ 200ml Bảo quản ở 0-4oC + Dung dịch ñệm gel phân tách: 1.5M Tris HCl, 0.4% SDS, pH 8.8 + Dung dịch ñệm gel gom: 0.5M Tris HCl, 0.4% SDS, pH 6.8 + Dung dịch nạp mẫu 2X: 0.125m Tris HCl, 4%SDS, 20% Glycerol, 0.2M DDT, 0.02% bromophenol blue, pH 6.8 + Dung dịch ñiện di 5 X: 0.125M Tris HCl, 0.96M Glycine, 0.5% SDS, pH 8.3 Trang 14 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP + Dung dịch nhuộm Coomassive (0.025% coomassie brilliant blue R, 40% methanol, 7% acetic acid) + Dung dịch giải nhuộm I: 40% methanol, 7%acetic acid + Dung dịch giải nhuộm II: 5% methanol, 7%acetic acid  Thành phần hóa chất dùng trong phương pháp lai Western blot và lai khuẩn lạc + Dung dịch chuyển màng Tris base 3.03g Glycine 14.41g SDS 1g Thêm nước cất 700ml ðiều chỉnh pH 8.2-8.4 Methanol 200ml Thêm nước cất ñủ 1 lít + Tris buffer saline (TBS) Tris base 12.11g Nước cất 900ml Chỉnh pH 7.5 bằng HCl ñậm ñặc NaCl 9g Thêm nước ñủ 1 lít + Tween TBS (0.1% Tween) Tween 20 100 µl TBS 100ml + Dung dịch ñệm Alkaline phosphatase Tris base 12.11g NaCl 5.8g MgCl2 0.476g Nước cất 900ml Chỉnh pH9.5 bằng HCl 1N Trang 15 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP Thêm nước ñủ 1 lít + Dung dịch BCIP Dimethyl formamide 1ml BCIP 50mg + Dung dịch NBT Dimethyl formamide 70% 10ml NBT 500mg + Dung dịch hiện màu 10ml dung dịch ñệm Alkaline phosphatase + 66µl dung dịch NBT + 33µl dung dịch BCIP  Thành phần các loại môi trường + Thành phần môi trường LB: 0.5% cao nấm men, 1% trypton, 1% NaCl + Thành phần môi trường LB rắn: 0.5% cao nấm men, 1% trypton, 1% NaCl, 1.5% agar + Thành phần môi trường YPD: 1% cao nấm men, 2% pastone, 2% glucose + Thành phần môi trường MM: 1.34% yeast nitrogen base, 4x10-5 biotin, 1% glycerol, 1.5% agar + Thành phần môi trường BMGY: 1% cao nấm men, 2% pastone, 1.34% yeast nitrogen base, 4x10-5 biotin, 1% glycerol, pH 6.0 + Thành phần môi trường BMMY: 1% cao nấm men, 2% pastone, 1.34% yeast nitrogen base, 4x10-5 biotin, 1% methanol, pH 6.0 II.1.3. Nguyên vật liệu  Chủng vi sinh vật + Chủng E.coli DH5α [F–, ø80dlacZ∆M15, ∆(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17(rK–, mK+), phoA, supE44, λ–, thi-1, gyrA96, relA1] ñược dùng dòng hóa các gene và tạo plasmid tái tổ hợp Trang 16 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP + Chủng Pichia pastoris GS115 his4: mang gene mã hóa cho histidinol dehydrogenase bị ñột biến nên không có khả năng tự tổng hợp histidine; có promoter AOX1, dùng ñể biểu hiện protein mục tiêu  Plasmid + Plasmid pJET1.2 (Fermentas): vector tạo dòng dạng thẳng, có khả năng tiếp nhận ñoạn DNA ñầu bằng ñược tổng hợp từ Pfu DNA polymerase, có trình tự gene mã hóa cho β-lactamase dùng ñể chọn lọc tế bào tái tổ hợp trên môi trường có Amp. Bên cạnh ñó, plasmid có gene eco47IR gây ñộc cho tế bào mang vùng trình tự nhận biết của các enzyme cắt giới hạn trong khung ñọc. Vì vậy, gene này bị bất hoạt khi có ñoạn DNA chèn vào vùng enzyme cắt giới hạn, dẫn ñến chỉ có khuẩn lạc mang plasmid có mang ñoạn chèn mới có thể tăng sinh trên môi trường nuôi cấy. Nhờ ñặc tính này, không cần bước sàng lọc xanh trắng. Hình 2.1. Cấu trúc vector nhân dòng pJET1.2 + Plasmid pPIC9K (Invitrogen): vector biểu hiện dùng cho Pichia pastoris GS115, có các ñặc ñiểm sau : Trang 17 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP  có trình tự tiết nhân tố α hỗ trợ việc tiết protein mục tiêu ra ngoài môi trường nuôi cấy  có mang gene mã hóa cho histidinol dehydrogenase giúp tế bào Pichia pastoris GS115 có khả năng tự tổng hợp histidine  có trình tự promoter AOX1 tương ñồng với trình tự của AOX1 trong bộ gene của Pichia giúp chuyển trình tự gene mục tiêu vào bộ gene của tế bào  có trình tự gene kháng Ampicillin dùng ñể sàng lọc tế bào E.coli tái tổ hợp  có gene kháng Kanamycin giúp Pichia kháng lại Geneticin dùng ñể chọn lọc tế bào Pichia tái tổ hợp ñồng thời xác ñịnh tương ñối số bản sao của gene ñược chèn vào bộ gene của tế bào dựa vào nồng ñộ Geneticin tế bào có khả năng kháng ñược (4mg/ml tương ứng 7-12 copy).  Trình tự cắt duy nhất của NotI, BglII, SacI và SalI dùng ñể làm thẳng vector trước khi chuyển vào tế bào Pichia và tạo dạng tái tổ hợp Mut+ (sử dụng methanol mạnh nên tăng sinh tốt trên môi trường có methanol) hoặc MutS (sử dụng methanol ít nên tăng sinh chậm trên môi trường có methanol). Hình 2.2. Cấu trúc vector biểu hiện pPIC9K  Mồi (tổng hợp bởi công ty IDT) + Mồi IFN-F: GG GAATTC TGT GAT CTG CCT CAA ACC CAC AG Trang 18 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP + Mồi IFN-R2: AA GCGGCCGC TCA TTC CTT ACT TCT TAAAC + Mồi pJET-F: CGACTCACTATAGGGAGAGCGGC + Mồi pJET-R: AAGAACATCGATTTTCCATGGCAG  Kháng thể + Kháng thể sơ cấp: Kháng thể ñơn dòng kháng hIFN-α2b (AbIFN(9D3) của Abcam) nồng ñộ sử dụng 1.25 x 10-4 mg/ml + Kháng thể thứ cấp: Kháng thể ña dòng từ thỏ kháng kháng thể chuột cộng hợp với alkaline phosphatase (Ab6729-1 của Abcam)  Thang + Thang phân tử lượng DNA: thang phân tử lượng DNA 100bp (Biorad), thang phân tử lượng DNA 1kb (Fermentas) (1) (2) Hình 2.3. Thang phân tử lượng DNA. (1) thang phân tử lượng DNA 100bp; (2) thang phân tử lượng DNA 1kb Trang 19 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP + Thang phân tử lượng protein thường (Biorad) Bảng 2.1: Kích thước từng thành phần của thang phân tử lượng protein thường Protein Trọng lượng phân tử (kDa) Phosphorylase β Serum albumin Ovalbumin Carbonic anhydrase Trypsin inhibitor Lysozyme 97.4 66.2 45.0 31.0 21.5 14.4 + Thang protein nhuộm màu (New England Biolab) Bảng 2.2: Kích thước từng thành phần của thang phân tử lượng protein nhuộm màu Protein Trọng lượng phân tử (kDa) MBP-β-galactosidase MBP-truncated - β-galactosidase MBP-CBD Aldolase Triosephosphate isomerase Trypsin inhibitor Lysozyme Aprotinin 175 80 58 46 30 23 17 7 Trang 20 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP (A) (B) Hình 2.4. Thang phân tử lượng protein. A: thang protein thường; B: thang protein nhuộm màu II.2. PHƯƠNG PHÁP II.2.1. Tách chiết DNA người tổng số bằng Chelex - Súc miệng 10 giây bằng 10 ml dung dịch NaCl 0.9% - Ly tâm dịch trên trong 10 phút tốc ñộ 2000 rpm, loại bỏ dịch nổi - Cho 500 µl dung dịch Chelex 10% vào, vortex cho tan - ðun sôi trong 10 phút, chuyển ngay vào ñá lạnh, ủ 2 phút - Ly tâm 13000 rpm trong 2 phút - Thu dịch nổi, ñây là dịch DNA dùng cho phản ứng PCR bước sau II.2.2. Phương pháp PCR (dùng ñể khuếch ñại ñoạn gene mục tiêu và kiểm tra khuẩn lạc mang gene mục tiêu) - Hỗn hợp phản ứng PCR Dung dịch ñệm Pfu (10X) 5µl dNTP (25 mM) 0.4µl Mồi xuôi IFN (10 uM) 1µl Mồi ngược IFN (10 uM) 1µl Trang 21 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP Pfu turbo (2.5U/µl) 1µl Nước 31.6µl - Chương trình nhiệt 95oC 2 phút 95oC 30 giây 48oC 30 giây 72oC 1 phút 95oC 30 giây 58oC 30 giây 72oC 1 phút 72oC 10 phút - ðiện di trên gel agarose 2%, 60V, 60 phút II.2.3. Phương pháp tinh sạch DNA từ gel agarose Theo hướng dẫn của kít tinh sạch DNA từ gel agarose của Qiagen II.2.4. Phương pháp ñiện biến nạp cho E. coli - Chuẩn bị tế bào khả nạp Cấy 1 khuẩn lạc E.coli DH5α vào 5 ml LB, ủ qua ñêm ở 37oC, lắc với tốc ñộ 250 rpm Chuyển 2.5 ml dịch nuôi cấy qua ñêm vào 250 ml LB trong bình tam giác 500 ml, ủ ở 37oC, lắc ở tốc ñộ 250 rpm ñến khi OD ñạt 0.5 Chia dịch nuôi cấy vào các ống falcon 50ml, ly tâm 4000 rpm trong 20 phút ở 4oC Bỏ dịch nổi, rửa tế bào bằng 250 ml nước vô trùng ñã làm lạnh trên ñá Ly tâm 4000 rpm trong 20 phút ở 4oC Bỏ dịch nổi, rửa tế bào bằng 250 ml nước vô trùng ñã làm lạnh trên ñá Ly tâm 4000 rpm trong 20 phút ở 4oC Bỏ dịch nổi, rửa tế bào bằng 20 ml glycerol 10% ñã làm lạnh trên ñá Ly tâm 4000 rpm trong 10 phút ở 4oC 10 chu kỳ 20 chu kỳ Trang 22 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP Bỏ dịch nổi, huyền phù cặn với glycerol 10% ñã lam lạnh trên ñá (thể tích tương ứng với lượng cặn tế bào) Chia lượng tế bào ra các ống 200µl, 80µl mỗi ống Trữ ở -80oC - ðiện biến nạp Cho 1µl hỗn hợp plasmid và vector pJET1.2 vào 80 µl tế bào khả nạp, lắc nhẹ Ủ trên ñá 5 phút Chuyển dịch vào cuvette ñiện biến nạp Shock ñiện (2.5 kV trong 5 ms) Cho liền 1ml dung dịch LB vào, chuyển dịch tế bào vào 1 ống 1.5ml mới Ủ 37oC trong 1 giờ, không lắc Trải 100 µl dịch tế bào lên môi trường thạch LB có Amp (100µg/ml) II.2.5. Phương pháp cắt DNA bằng enzyme cắt giới hạn - Hỗn hợp phản ứng Dung dịch ñệm cho NotI (10X) 1 µl NotI (10U/µl) 0.1 µl EcoRI (10U/µl) 0.1 µl Nước 6.8 µl Plasmid 2 µl - Ủ ở 37oC trong 3 giờ - ðiện di kiểm tra kết quả trên gel agarose 2%, 60V, 60 phút. II.2.6. Phương pháp nối DNA bằng enzyme T4 ligase - Hỗn hợp phản ứng Dung dịch ñệm cho T4 ligase (10X) 1µl Nước 4.5µl Sản phẩm cắt từ vector tạo dòng 2µl Plasmid 2µl Trang 23 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP T4 ligase (400U/µl) 0.5µl - Ủ ở 37oC trong 3 giờ - ðiện di kiểm tra kết quả trên gel agarose 2%, 60V, 60 phút II.2.7. Phương pháp tách chiết plasmid từ tế bào E. coli Theo hướng dẫn của kít tách chiết plasmid từ tế bào E. coli của Qiagen II.2.8. Phương pháp ñiện biến nạp cho Pichia pastoris - Chuẩn bị tế bào khả nạp Cấy 1 khuẩn lạc Pichia pastoris trên môi trường YPD cho vào 5ml YPD, ủ qua ñêm ở 30oC, lắc với tốc ñộ 250rpm Chuyển 5 mldịch nuôi cấy qua ñêm vào 250ml YPD trong bình tam giác 500 ml, ủ ở 30oC, lắc ở tốc ñộ 250 rpm ñến khi OD600 ñạt 1.3-1.5 Chia dịch nuôi cấy vào các ống falcon 50ml, ly tâm 4000rpm trong 5 phút ở 4oC Bỏ dịch nổi, huyền phù tế bào bằng 250 ml nước vô trùng ñã làm lạnh trên ñá Ly tâm 4000rpm trong 5 phút ở 4oC Bỏ dịch nổi, rửa tế bào bằng 250 ml nước vô trùng ñã làm lạnh trên ñá Ly tâm 4000rpm trong 5 phút ở 4oC Bỏ dịch nổi, rửa tế bào bằng 20 ml sorbitol 1M ñã làm lạnh trên ñá Ly tâm 4000rpm trong 5 phút ở 4oC Bỏ dịch nổi, huyền phù cặn với sorbitol 1M ñã làm lạnh trên ñá (thể tích tương ứng với lượng cặn tế bào) Chia lượng tế bào ra các ống 200µl, 80µl mỗi ống Trữ ở -80oC - ðiện biến nạp Cho 1µl hỗn hợp plasmid và vector pPIC9K vào 80µl tế bào khả nạp, lắc nhẹ Ủ trên ñá 5 phút Chuyển dịch vào cuvette ñiện biến nạp Shock ñiện (2.5 kV trong 5ms) Trang 24 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP Cho liền 1ml dung dịch sorbitol 1M vào, chuyển dịch tế bào vào 1 ống 1.5ml mới Trải 200 µl dịch tế bào lên môi trường thạch YPD có G418 (1-4mg/ml) II.2.9. Phương pháp lai khuẩn lạc - Chủng thu nhận ñược trên môi trường thạch YPD có G418 (4mg/ml) ñược cấy chuyển vào môi trường thạch MM, ủ 28oC, 16 giờ - Áp màng lai Hybond-C (Amersham) lên bề mặt thạch, ủ 5giờ ở nhiệt ñộ phòng - Khóa màng bằng dịch sữa gầy 5% pha trong TTBS (0.1% Tween) trong 1giờ, ở nhiệt ñộ phòng - Rửa màng bằng TTBS (0.1% Tween) 3lần, mỗi lần 5 phút - Ủ màng với dung dịch kháng thể sơ cấp 1giờ, ở nhiệt ñộ phòng - Rửa màng bằng TTBS (0.1% Tween) 3lần, mỗi lần 5 phút - Ủ màng với dung dịch kháng thể thứ cấp 1 giờ, ở nhiệt ñộ phòng - Rửa màng bằng TTBS (0.1% Tween) 3 lần, mỗi lần 5 phút - Tráng màng với dung dịch ñệm Alkaline Phosphatase - Ủ màng với dung dịch hiện màu II.2.10. Phương pháp lên men Pichia pastoris • Một khuẩn lạc Pichia pastoris trên môi trường thạch YPD có G418 (4mg/ml) ñược cấy vào 50 ml môi trường BMGY, ủ 20 giờ, lắc 250rpm ở 28oC - Ly tâm dịch nuôi cấy BMGY với tốc ñộ 4000rpm, 15 phút, thu tế bào - Hòa tế bào vào 500ml BMMY, ủ ở 20oC, tốc ñộ lắc 250rpm, lấy 3ml mẫu làm mẫu lúc 0 giờ - Sau mỗi thời ñiểm 24, 48, 72, 96 và 104 giờ thêm 5ml Methanol 100% vào dịch nuôi cấy và lấy 3ml dịch môi trường ñể phân tích Trang 25 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP hàm lượng protein bằng phương pháp Bradford, SDS-PAGE và Western blot. II.2.11. Phương pháp Bradford dùng ñể ño hàm lượng protein - Dựng ñường chuẩn Pha loãng phẩm nhuộm Biorad ra 5 lần Chuẩn bị dịch protein chuẩn BSA nồng ñộ 1mg/ml Chuẩn bị mẫu với các nồng ñộ 0, 5, 10, 15, 20, 25 mg/ml sau: BSA 1mg/ml (µl) Nước (µl) Phẩm nhuộm Biorad pha loãng 5 lần (µl) 0 25 975 5 20 975 10 15 975 15 10 975 20 5 975 25 0 975 Ủ ở nhiệt ñộ phòng 5 phút và ño ở bước sóng 595nm - Chuẩn bị mẫu 20µl dịch lên men tại các thời ñiểm thu nhận ñược hòa vào 980µl phẩm nhuộm Biorad ñã pha loãng 5 lần. Ủ ở nhiệt ñộ phòng trong 5 phút ðo ở bước sóng 595nm II.2.12. Phương pháp ñiện di SDS-PAGE - Pha gel Gel phân tách (15 %) Dung dịch ñơn phân 30% 5ml Dung dịch ñệm gel phân tách (pH 8.8) 2.5ml Trang 26 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP Nước khử ion 2.5ml APS 10% 0.05ml TEMED 0.01ml Trộn ñều các thành phần, ñổ khuôn Thêm 200µl isopropanol ñể tránh bọt khí và làm phẳng bề mặt. ðợi gel ñông Loại bỏ isopropanol, rửa lại gel bằng nước khử ion cho sạch isopropanol. ðể khô Gel gom (3.9 %) Dung dịch ñơn phân 30% 0.65ml Dung dịch ñệm gel gom (pH 6.8) 1.25ml Nước khử ion 3.05ml APS 10% 0.025ml TEMED 0.005ml Trộn ñều các thành phần, ñổ khuôn Gắn lược, ñợi gel ñông - Chuẩn bị mẫu Dịch nuôi cấy tại các thời ñiểm 0, 24, 48, 72, 96 và 104 giờ sau cảm ứng ñược ly tâm ở 13000rpm trong 3 phút, thu dịch nổi 20µl dịch nổi ở các thời ñiểm hòa với 20µl dung dịch nạp mẫu 2X ðun mẫu ở 95oC, trong 10 phút - Chạy gel Nạp 20µl mỗi mẫu vào giếng Chạy gel ở cường ñộ dòng ñiện là 20mA, ñến khi vạch dung dịch nạp mẫu cách ñáy gel 1cm - Nhuộm gel Gel ñược lấy ra khỏi khuôn, loại bỏ phần gel gom Nhuộm với dung dịch Coomassie brilliant blue trong 1 giờ Giải nhuộm với dung dịch giải nhuộm I và dung dịch giải nhuộm II ñến khi thấy vạch. Trang 27 Luận văn Thạc sĩ VẬT LIỆU VÀ PHƯƠNG PHÁP II.2.13. Phương pháp Western blot - Gel sau khi ñiện di ñược loại bỏ gel gom và ngâm trong dung dịch chuyển màng - ðể gel vào máy chuyển màng theo thứ tự 3 lớp giấy thấm, màng Hybon-C, gel và 2 lớp giấy thấm - Chuyển màng ở cường ñộ dòng ñiện là 200mA trong 45 phút - Khóa màng bằng dịch sữa gầy 5% pha trong TTBS (0.1% Tween) trong 1 giờ, ở nhiệt ñộ phòng - Rửa màng bằng TTBS (0.1% Tween) 3 lần, mỗi lần 5 phút - Ủ màng với dung dịch kháng thể sơ cấp 1 giờ, ở nhiệt ñộ phòng - Rửa màng bằng TTBS (0.1% Tween) 3 lần, mỗi lần 5 phút - Ủ màng với dung dịch kháng thể thứ cấp 1 giờ, ở nhiệt ñộ phòng - Rửa màng bằng TTBS (0.1% Tween) 3 lần, mỗi lần 5 phút - Tráng màng với dung dịch ñệm Alkaline Phosphatase - Ủ màng với dung dịch hiện màu

Các file đính kèm theo tài liệu này:

  • pdf9.pdf
  • pdf1.pdf
  • pdf10.pdf
  • pdf11.pdf
  • pdf12.pdf
  • pdf2.pdf
  • pdf3.pdf
  • pdf4.pdf
  • pdf5.pdf
  • pdf6.pdf
  • pdf7.pdf
  • pdf8.pdf
Luận văn liên quan