Xây dưng quy trình định danh vi khuẩn gây bệnh loét trên cây bưởi bằng phương pháp sinh học phân tử

TÓM TẮT Xây dưng quy trình định danh vi khuẩn gây bệnh loét trên cây bưởi bằng phương pháp sinh học phân tử Đề tài được thực hiện trên đối tượng là vi khuẩn Xanthomonas spp. Đây là vi khẩn có khả năng gây bệnh trên nhiều cây trồng khác nhau, ảnh hưởng rất lớn đến năng suất của cây trồng. Chúng tôi sử dụng các kỹ thuật nông học, phương pháp sinh học phân tử nhằm định danh dòng Xanthomonas sp gây bệnh loét trên cây bưởi mục tiêu hiểu rõ bản chất sinh học của dòng gây bệnh, để dễ dàng cho việc đưa ra các biện pháp phòng trừ bệnh do vi khuẩn này gây ra. Đề tài được thực hiện tại phòng thực tập Bệnh cây khoa Nông Học và Trung tâm Phân Tích Thí Nghiệm trường Đại học Nông Lâm, Tp. Hồ Chí Minh, từ 06/02/06 đến 06/08/06. Nội dung nghiên cứu: 1. Phân lập, nuôi cấy, xác định gram, quan sát hình thái trên môi trường PGA, YDC. 2. Chủng bệnh nhân tạo để kiểm tra lại triệu chứng gây bệnh của dòng vi khuẩn phân lập được. 3. Thực hiện sắc ký bản mỏng dựa vào sắc tố đặc trưng để nhận Xanthomonas sp 4. Tiến hành nhân sinh khối, ly trích DNA tổng số. 5. Thực hiện phản ứng PCR trên 16s-23s rDNA ITS với cặp primer Xan1330 và Xan332. 6. Thực hiện phản ứng PCR trên vùng hrpW gen với cặp mồi chuyên biệt XACR và XACF cho phép xác định nhanh Xanthomonas axonopodis pv. citri. Kết quả đạt được: 1. Phân lập được 4 dòng vi khuẩn, tất cả là gram âm, trên môi trường YDC phân thành 2 nhóm vàng sữa và vàng chanh 2. Tất cả 4 dòng phân lập được đều tạo vết thương sau khi chủng bệnh nhân tạo, triệu chứng bệnh có khác nhau. 3. Kết quả sắc ký có 1 dòng (XBDL1) có sắc tố phát sáng rõ sau khi chụp UV. 4. Thực hiện thành công phản ứng PCR trên 16s-23s rDNA ITS với cặp primer Xan1330 và Xan332 cho sản phẩm 1,1 kb. 5. Không thực hiện được phản ứng PCR trên vùng hrpW gen với cặp mồi chuyên biệt XACR và XACF. MỤC LỤC TRANG Trang bìa Trang tựa Lời cảm ơn .iii Tóm tắt .iv Mục lục v Danh sách các hình viii Danh sách các bảng .ix Danh sách các chữ viết tắt .xi Phần 1. GIỚI THIỆU 1 1.1. Đặt vấn đề 1 1.2. Mục đích . 1 1.3. Yêu cầu . 2 1.4. Giới hạn của đề tài . 2 Phần 2. TỔNG QUAN .3 2.1. Sơ lược về nhóm cây có múi trên thế giới và trong nước .3 2.1.1. Nguồn gốc và phân loại cây bưởi 3 2.1.2. Giá trị cây ăn quả có múi ở thế giới và trong nước 3 2.1.3. Tình hình sản xuất cam quýt ở Việt Nam .4 2.1.4. Tình hình sản xuất cam quýt trên thế giới 4 2.2. Bệnh loét cam Xanthomonas citri (Hasse-Dowson) .5 2.2.1. Triệu chứng bệnh .5 2.2.2. Đặc điểm gây bệnh của chủng vi sinh vật gây bệnh (X. a. pv. citri) . 7 2.3. Sơ lược vùng rDNA-ITS 8 2.3.1. Giới thiệu vùng rDNA .8 2.3.2. Vùng rDNA-ITS trên Xanthomonas ssp. .9 2.4. Sơ lược về hrpW gen .9 2.5. Những cứu về bệnh loét cam quýt trên Thế Giới và Việt Nam .11 2.5.1. Trên Thế Giới .11 2.5.2. Tại Việt Nam .12 2.6. Quy trình định danh Xanthomona sp 12 2.6.1. Quy trình định danh Xanthomonas sp. theo phương pháp nuôi cấy, thực hiện phản ứng sinh hóa .12 2.6.2 Quy trình định danh theo phương pháp phân tử 13 2.7 Phương pháp PCR 13 Phần 3. VẬT LIỆU VÀ PHưƠNG PHÁP .16 3.1. Thời gian và địa điểm nghiên cứu .16 3.2. Nội dung nghiên cứu .16 3.3 Vật liệu nghiên cứu .16 3.4. Phương pháp tiến hành 17 3.4.1 Phân lập, nuôi cấy trên 2 môi trường PGA và YDC, xác định Gram âm hay Gram dương các dòng vi khuẩn gây bệnh loét trên cây bưởi 17 3.4.2. Chủng bệnh nhân tạo 18 3.4.3. Thực hiện sắc ký bản mỏng định danh vi khuẩn 18 3.4.4. Phương pháp ly trích DNA tổng số của vi khuẩn 20 3.4.5. Khuếch đại vùng 16s-23s rDNA ITS và vùng hrpW gen 21 Khuếch đại vùng 16s-23s rDNA ITS dòng vi khuẩn phân lập với cặp mồi Xan1330 và Xan332 . 22 Khuếch đại đoạn hrpW gen dòng vi khuẩn phân lập với cặp mồi XACF và XACR 23 3.5.6. Điện di kiểm tra sản phẩm ly trích và sản phẩm PCR 23 Phần 4. KẾT QUẢ VÀ THẢO LUẬN .25 4.1. Phân lập, xác định gram vi khuẩn gây bệnh loét ở cây bưởi da láng và bưởi đường cam . 25 4.2 Kết quả nuôi cấy vi khuẩn gây bệnh loét trên môi trường PGA và YDC 25 4.2. Chủng bệnh bệnh nhân tạo . 26 4.3. Sắc ký định danh vi khuẩn gây bệnh 28 4.4 Ly trích DNA tổng số 28 4.5. Thực hiện PCR với cặp mồi Xan1330 và Xan 332 trên vùng ITS 29 4.6 Thực hiện PCR với cặp mồi XACR và XACF trên hrpW gen 29 Phần 5. KẾT LUẬN VÀ ĐỀ NGHỊ .32 5.1. Kết luận 32 5.2. Đề nghị .32 Phần 6.TÀI LIỆU THAM KHẢO 33 Phần 7. PHỤ LỤC .35

pdf51 trang | Chia sẻ: lvcdongnoi | Ngày: 25/01/2013 | Lượt xem: 3285 | Lượt tải: 4download
Bạn đang xem nội dung tài liệu Xây dưng quy trình định danh vi khuẩn gây bệnh loét trên cây bưởi bằng phương pháp sinh học phân tử, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
i BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC  TRẦN THỊ MINH TÚ XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƢỞI BẰNG PHƢƠNG PHÁP SINH HỌC PHÂN TỬ LUẬN VĂN KỸ SƢ CHUYÊN NGÀNH CÔNG NGHỆ SINH HỌC Thành phố Hồ Chí Minh Tháng 9/2006 ii BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MÔN CÔNG NGHỆ SINH HỌC  XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƢỞI BẰNG PHƢƠNG PHÁP SINH HỌC PHÂN TỬ LUẬN VĂN KỸ SƢ CHUYÊN NGÀNH CÔNG NGHỆ SINH HỌC Giáo viên hƣớng dẫn Sinh viên thực hiện TS. LÊ ĐÌNH ĐÔN TRẦN THỊ MINH TÚ KHÓA: 2002 - 2006 Thành phố Hồ Chí Minh Tháng 9/2006 iii MINISTRY OF EDUCATION AND TRAINING NONG LAM UNIVERSITY, HCMC FACULTY OF BIOTECHNOLOGY  AMPLIFICATION MOLECULAR ENGINEERING TO IDENTY CITRUS CANKER BACTERIA GRADUATION THESIS MAJOR: BIOTECHNOLOGY Professor Student Dr. LE DINH DON TRAN THI MINH TU TERM: 2002 - 2006 HCMC, 09/2006 iii LỜI CẢM ƠN Xin chân thành cảm ơn: - Ban Giám Hiệu trƣờng Đại học Nông Lâm Tp. Hồ Chí Minh đã tạo mọi điều kiện cho tôi trong suốt thời gian học tập tại trƣờng. - Các thầy cô trong Bộ môn Công nghệ sinh học cùng các thầy cô trực tiếp giảng dạy luôn tận tình hƣớng dẫn, giảng dạy, giúp đỡ và động viên tôi trong suốt bốn năm qua. - TS. Lê Đình Đôn đã tận tình hƣớng dẫn và động viên tôi trong thời gian thực hiện đề tài tốt nghiệp. - TS. Bùi Minh Trí và anh Nguyễn Văn Lẫm và các anh chị phụ trách phòng Hóa Sinh thuộc Trung tâm Phân Tích Thí Nghiệm Đại học Nông Lâm Tp. HCM đã tận tình giúp đỡ tôi trong thời gian làm đề tài. - Toàn thể lớp CNSH 28 đã hỗ trợ, giúp đỡ và động viên tôi trong suốt thời gian làm đề tài. Thành kính ghi ơn ông bà, cha mẹ đã nuôi nấng, dạy bảo con đƣợc nhƣ ngày hôm nay, cùng những ngƣời thân trong gia đình luôn tạo mọi điều kiện và động viên con trong suốt quá trình học tập tại trƣờng. Chân thành cảm ơn. Tp. HCM, tháng 08 năm 2006 Sinh viên Trần Thị Minh Tú iv TÓM TẮT TRẦN THỊ MINH TÚ, Đại học Nông Lâm Tp. Hồ Chí Minh. Tháng 8/2006. “XÂY DỰNG QUY TRÌNH ĐỊNH DANH VI KHUẨN GÂY BỆNH LOÉT TRÊN CÂY BƢỞI BẰNG PHƢƠNG PHÁP SINH HỌC PHÂN TỬ”. Giáo viên hƣớng dẫn: TS. LÊ ĐÌNH ĐÔN Đề tài đƣợc thực hiện trên đối tƣợng là vi khuẩn Xanthomonas spp. Đây là vi khẩn có khả năng gây bệnh trên nhiều cây trồng khác nhau, ảnh hƣởng rất lớn đến năng suất của cây trồng. Chúng tôi sử dụng các kỹ thuật nông học, phƣơng pháp sinh học phân tử nhằm định danh dòng Xanthomonas sp gây bệnh loét trên cây bƣởi mục tiêu hiểu rõ bản chất sinh học của dòng gây bệnh, để dễ dàng cho việc đƣa ra các biện pháp phòng trừ bệnh do vi khuẩn này gây ra. Đề tài đƣợc thực hiện tại phòng thực tập Bệnh cây khoa Nông Học và Trung tâm Phân Tích Thí Nghiệm trƣờng Đại học Nông Lâm, Tp. Hồ Chí Minh, từ 06/02/06 đến 06/08/06. Nội dung nghiên cứu: 1. Phân lập, nuôi cấy, xác định gram, quan sát hình thái trên môi trƣờng PGA, YDC. 2. Chủng bệnh nhân tạo để kiểm tra lại triệu chứng gây bệnh của dòng vi khuẩn phân lập đƣợc. 3. Thực hiện sắc ký bản mỏng dựa vào sắc tố đặc trƣng để nhận Xanthomonas sp. . 4. Tiến hành nhân sinh khối, ly trích DNA tổng số. 5. Thực hiện phản ứng PCR trên 16s-23s rDNA ITS với cặp primer Xan1330 và Xan332. 6. Thực hiện phản ứng PCR trên vùng hrpW gen với cặp mồi chuyên biệt XACR và XACF cho phép xác định nhanh Xanthomonas axonopodis pv. citri. v Kết quả đạt đƣợc: 1. Phân lập đƣợc 4 dòng vi khuẩn, tất cả là gram âm, trên môi trƣờng YDC phân thành 2 nhóm vàng sữa và vàng chanh.. 2. Tất cả 4 dòng phân lập đƣợc đều tạo vết thƣơng sau khi chủng bệnh nhân tạo, triệu chứng bệnh có khác nhau. 3. Kết quả sắc ký có 1 dòng (XBDL1) có sắc tố phát sáng rõ sau khi chụp UV. 4. Thực hiện thành công phản ứng PCR trên 16s-23s rDNA ITS với cặp primer Xan1330 và Xan332 cho sản phẩm 1,1 kb. 5. Không thực hiện đƣợc phản ứng PCR trên vùng hrpW gen với cặp mồi chuyên biệt XACR và XACF. vi MỤC LỤC TRANG Trang bìa Trang tựa Lời cảm ơn ............................................................................................................. iii Tóm tắt ................................................................................................................... iv Mục lục .................................................................................................................. v Danh sách các hình ................................................................................................ viii Danh sách các bảng ............................................................................................... ix Danh sách các chữ viết tắt ..................................................................................... xi Phần 1. GIỚI THIỆU .......................................................................................... 1 1.1. Đặt vấn đề ...................................................................................................... 1 1.2. Mục đích ......................................................................................................... 1 1.3. Yêu cầu ........................................................................................................... 2 1.4. Giới hạn của đề tài ......................................................................................... 2 Phần 2. TỔNG QUAN ......................................................................................... 3 2.1. Sơ lƣợc về nhóm cây có múi trên thế giới và trong nƣớc ............................. 3 2.1.1. Nguồn gốc và phân loại cây bƣởi ................................................................ 3 2.1.2. Giá trị cây ăn quả có múi ở thế giới và trong nƣớc .................................... 3 2.1.3. Tình hình sản xuất cam quýt ở Việt Nam ................................................... 4 2.1.4. Tình hình sản xuất cam quýt trên thế giới .................................................. 4 2.2. Bệnh loét cam Xanthomonas citri (Hasse-Dowson) ..................................... 5 2.2.1. Triệu chứng bệnh ....................................................................................... 5 2.2.2. Đặc điểm gây bệnh của chủng vi sinh vật gây bệnh (X. a. pv. citri) ........... 7 2.3. Sơ lƣợc vùng rDNA-ITS ................................................................................ 8 vii 2.3.1. Giới thiệu vùng rDNA ................................................................................. 8 2.3.2. Vùng rDNA-ITS trên Xanthomonas ssp. ................................................... 9 2.4. Sơ lƣợc về hrpW gen ..................................................................................... 9 2.5. Những cứu về bệnh loét cam quýt trên Thế Giới và Việt Nam ................... 11 2.5.1. Trên Thế Giới ............................................................................................. 11 2.5.2. Tại Việt Nam ............................................................................................. 12 2.6. Quy trình định danh Xanthomona sp. . .......................................................... 12 2.6.1. Quy trình định danh Xanthomonas sp. theo phƣơng pháp nuôi cấy, thực hiện phản ứng sinh hóa ................................................................. 12 2.6.2 Quy trình định danh theo phƣơng pháp phân tử .......................................... 13 2.7 Phƣơng pháp PCR .......................................................................................... 13 Phần 3. VẬT LIỆU VÀ PHƢƠNG PHÁP ....................................................... 16 3.1. Thời gian và địa điểm nghiên cứu ................................................................. 16 3.2. Nội dung nghiên cứu ..................................................................................... 16 3.3 Vật liệu nghiên cứu ......................................................................................... 16 3.4. Phƣơng pháp tiến hành .................................................................................. 17 3.4.1 Phân lập, nuôi cấy trên 2 môi trƣờng PGA và YDC, xác định Gram âm hay Gram dƣơng các dòng vi khuẩn gây bệnh loét trên cây bƣởi ........ 17 3.4.2. Chủng bệnh nhân tạo .................................................................................. 18 3.4.3. Thực hiện sắc ký bản mỏng định danh vi khuẩn ........................................ 18 3.4.4. Phƣơng pháp ly trích DNA tổng số của vi khuẩn ...................................... 20 3.4.5. Khuếch đại vùng 16s-23s rDNA ITS và vùng hrpW gen .......................... 21 Khuếch đại vùng 16s-23s rDNA ITS dòng vi khuẩn phân lập với cặp mồi Xan1330 và Xan332 ......................................................................... 22 Khuếch đại đoạn hrpW gen dòng vi khuẩn phân lập với cặp mồi XACF và XACR .............................................................................. 23 3.5.6. Điện di kiểm tra sản phẩm ly trích và sản phẩm PCR ................................ 23 viii Phần 4. KẾT QUẢ VÀ THẢO LUẬN ............................................................... 25 4.1. Phân lập, xác định gram vi khuẩn gây bệnh loét ở cây bƣởi da láng và bƣởi đƣờng cam ................................................................... 25 4.2 Kết quả nuôi cấy vi khuẩn gây bệnh loét trên môi trƣờng PGA và YDC ...... 25 4.2. Chủng bệnh bệnh nhân tạo ............................................................................. 26 4.3. Sắc ký định danh vi khuẩn gây bệnh ............................................................ 28 4.4 Ly trích DNA tổng số .................................................................................... 28 4.5. Thực hiện PCR với cặp mồi Xan1330 và Xan 332 trên vùng ITS ................ 29 4.6 Thực hiện PCR với cặp mồi XACR và XACF trên hrpW gen ...................... 29 Phần 5. KẾT LUẬN VÀ ĐỀ NGHỊ ................................................................... 32 5.1. Kết luận .......................................................................................................... 32 5.2. Đề nghị ......................................................................................................... 32 Phần 6.TÀI LIỆU THAM KHẢO ...................................................................... 33 Phần 7. PHỤ LỤC ............................................................................................... 35 ix DANH SÁCH CÁC HÌNH Hình Trang Hình 2.1. Triệu chứng bệnh loét trên lá bƣởi Da Láng .................................................. 6 Hình 2.2. Triệu chứng bệnh loét trên trái bƣởi Da Láng ............................................... 6 Hình 2.3. Triệu chứng bệnh loét trên cành bƣởi Da Láng ............................................. 7 Hình 2.4. Cấu trúc vùng 16s-23s rDNA ITS trên Xanthomonas ssp ........................... 10 Hình 2.5. Sơ đồ hình cây thể hiện mối tƣơng quan giữa các dòng Xanthomonas ssp. dựa trên vùng 16s-23s rDNA ITS ................................................................................ 10 Hình 3.1(a) Tấm sắc ký vừa nhỏ dung dịch sắc tố ..................................................... 19 Hình 3.1(b). Tấm sắc ký ngâm methanol trong bình hút ẩm ...................................... 19 Hình 4.1. Sự phát triển của các dòng vi khuẩn phân lập đƣợc trên môi trƣờng PGA nhiệt độ 28oC ................................................................................................................ 25 Hình 4.2. Sự phát triển của các dòng vi khuẩn phân lập đƣợc trên môi trƣờng YDC ở nhiệt độ 28oC ................................................................................................................ 26 Hình 4.3. Các triệu chứng bệnh sau khi chủng bốn dòng phân lập đƣợc trên lá non bƣởi Da Láng quan sát dƣới kính hiển vi độ phóng đai 4x10 lần ............................... 27 Hình 4.4. Kết quả sắc ký trƣớc ................................................................................... 28 Hình 4.5. DNA tổng số ly trích theo quy trình ............................................... 29 Hình 4.6. Kết quả diện di sản phẩm PCR đoạn 16s-23s rDNA ITS với cặp mồi Xan1330 và Xan332 ..................................................................................................... 29 Hình 4.7. Sơ đồ các bƣớc cơ bản định danh vi khuẩn gây bệnh loét trên cây bƣởi theo phƣơng pháp sinh học phân tử...................................................................................... 31 x DANH SÁCH CÁC BẢNG Bảng Trang Bảng 2.1. Môi trƣờng phân lập một số loài X. campestis ............................................. 14 Bảng 2.2. Đặc tính sinh hóa Xanthomonas sp. ............................................................. 14 Bảng 3.3.Thành phần dung dịch đệm TE...................................................................... 20 Bảng 3.2. Thành phần phản ứng PCR với cặp mồiXan1330 và Xan332 .................... 22 Bảng 3.3. Chu trình nhiệt phản ứng PCR với cặp mồi Xan1330 và Xan332 .............. 22 Bảng 3.4 Thành phần phản ứng PCR với cặp mồi XACF và XACR ........................... 23 Bảng 3.5. Chu trình nhiệt phản ứng với cặp mồi XACF và XACR ............................. 23 Bảng 4.2. Hình thái vi khuẩn đƣợc phân lập từ bƣởi Da Láng và bƣởi Đƣờng Cam ..................................................................................................... 25 Bảng 4.3. Khả năng nhiễm bệnh của 4 dòng XBDL1, XBDL2, XBDL3, XBĐC3 ........................................................................... 27 xi DANH SÁCH CÁC CHỮ VIẾT TẮT ITS : Internal Transcribed Spacer – vùng dịch mã trong nhân DNA : Deoxyribonucleotide Acid rDNA : ribosome DNA PCR : Polymerase chain reaction – phản ứng chuỗi Polymerase PGA : Potato Glucose Agar STT : Số thứ tự ng : nano gram µM : micro mol TE : Tris EDTA µg : micro gram µl : micro lit TAE : Tris Acetic EDTA bp : base pair dNTP : deoxyribonucleotide triphosphate ISGs : intraspecific groups SDS : sodium dodecyl sulfate EDTA : ethylenediamine – tetraacetic acid IGS : intergenic spacer 1 Phần 1. GIỚI THIỆU 1.1. Đặt vấn đề Nƣớc ta nằm trong vùng khí hậu nhiệt đới gió mùa rất thuận lợi cho nhiều loại cây nhiệt đới phát triển. Đặc biệt các loại cây ăn quả rất đa dạng và phong phú về chủng loại. Trong đó bƣởi (Citrus grandis L Rutaceae) là loại cây ăn quả thuộc nhóm cây có múi đƣợc trồng phổ biến và lâu đời tại các vùng đông Nam Bộ với các vùng trồng bƣởi lâu đời và nổi tiếng nhƣ Vĩnh Cửu (Đồng Nai), Tân Uyên (Bình Dƣơng). Cây bƣởi có tuổi thọ lâu hơn các loại cây có múi khác, thời gian bảo quản cũng lâu hơn. Bƣởi còn là loại quả giàu vitamin đƣợc thị trƣờng trong nƣớc cũng nhƣ ngoài nƣớc ƣa chuộng về hƣơng vị cũng nhƣ dinh dƣỡng nên ngƣời trồng bƣởi có thu nhập cao và ổn định hơn so với các loại cây nông nghiệp khác. Vì vậy, cây bƣởi đã góp phần cải thiện và nâng cao đời sống của ngƣời dân. Tuy nhiên cho đến nay diện tích trồng bƣởi không tăng. Mặt khác, giống bƣởi năng suất và phẩm chất rất tốt là cây Bƣởi Đƣờng Da Láng lại giảm rõ rệt. Nguyên nhân chính là do bị nhiễm bệnh nghiêm trọng do vi khuẩn Xanthomonas sp. gây nên. Vi khuẩn không ảnh hƣởng nhiều đến chất lƣợng quả nhƣng gây nên những vết sần sùi trên mặt trái làm mất vẻ thẩm mỹ nên rất khó tiêu thụ trên thị trƣờng. Ngoài ra, vi khuẩn còn gây bệnh trên cành, lá làm ảnh hƣởng đến sự sinh trƣởng và phát triển của cây. Không chỉ gây hại trên cây bƣởi mà vi khuẩn Xanthomonas sp. gây hại hầu hết các loại cây có múi từ mức độ nhẹ đến nặng. Để xác định rõ dòng vi khuẩn gây bệnh này chúng tôi thực hiện đề tài “Xây dựng quy trình định danh vi khuẩn gây bệnh loét trên cây bƣởi bằng phƣơng pháp sinh học phân tử”. Từ đó, chúng tôi có thể tìm ra phƣơng pháp phòng và trị bệnh đạt hiệu quả nhằm khôi phục lại giống bƣởi Đƣờng Da Láng mang lại hiệu quả kinh tế cao. 1.2. Mục đích - Xây dựng quy trình định danh vi khuẩn gây bệnh loét trên cây có muối (cây bƣởi). - Phân loại tính độc của chủng gây bệnh. 2 1.3. Yêu cầu - Thành thạo các thao tác phân lập, nuôi cấy, chủng bệnh nhân tạo trong phòng thí nghiệm. - Thực hiện đƣợc phƣơng pháp sắc ký bản mỏng định danh vi khuẩn. - Thành thạo phƣơng pháp ly trích DNA vi khuẩn. - Tính toán, thiết lập đƣợc phản ứng PCR, hạn chế tối đa tạp nhiễm. 1.4. Giới hạn của đề tài - Chỉ xác định đƣợc chủng vi khuẩn gây bệnh loét trên cây bƣởi Da Láng, bƣởi Đƣờng Cam là Xanthomonas sp. - Chƣa giải đƣợc trình tự sản phẩm PCR đoạn 16s-23s rDNA ITS, chƣa thực hiện đƣợc phản ứng PCR trên hrpW để định danh chính xác chủng vi khuẩn gây bệnh ở mức độ loài. 3 Phần 2. TỔNG QUAN 2.1. Sơ lƣợc về nhóm cây có múi trên thế giới và trong nƣớc 2.1.1. Nguồn gốc và phân loại cây bƣởi Cây có múi hiện đang trồng ở nhiều nƣớc trên thế giới đều có nguồn gốc từ các nƣớc vùng nhiệt đới và cận nhiệt đới Đông Nam Á. Đƣờng ranh giới của vùng xuất xứ cây ăn quả có múi nằm ở dãy chân núi Himalaya, phía đông Ấn Độ qua miền nam Trung Quốc, về phía nam đƣờng ranh giới vùng đi qua Australia (theo Taraka, 1971). Lịch sử trồng cây có múi ở nƣớc ta xuất hiện từ rất lâu đời cách đây 3000-4000 năm (Đƣờng Hồng Dật). Ngày nay, cây có múi đƣợc trồng trên khắp đất nƣớc ta từ Lào Cai đến Cà Mau, từ Quảng Ninh đến Lai Châu. Đặt biệt là bƣởi với nhiều giống đƣợc trồng ở nƣớc ta: bƣởi Da Láng, bƣởi Năm Roi, bƣởi Lông Cổ Cò, bƣởi Đƣờng Cam, bƣởi Da Xanh, bƣởi Lông Hồng.Các vùng trồng bƣởi nổi tiếng ở nƣớc ta nhƣ Đồng Nai và các tỉnh Đồng Bằng Sông Cửu Long. 2.1.2. Giá trị cây ăn quả có múi ở thế giới và trong nƣớc Cây ăn quả có múi nhƣ cam, quýt, bƣởi là một trong những loại quả cao cấp đƣợc nhiều ngƣời ƣa chuộng và đƣợc sản xuất ở nhiều nƣớc trên thế giới. Giá trị dinh dƣỡng cây ăn quả có múi rất cao. Trong thành phần thịt quả có chứa 6-12% đƣờng, chủ yếu là sacaroza. Hàm lƣợng vitamin C trong quả là 40-90% mg/100g tƣơi. Các loại axit hữu cơ chứa trong thịt quả là 0,4-1,2%, trong đó có nhiều axit có hoạt tính sinh học cao. Trong quả còn chứa các chất khoáng và dầu thơm. Tinh dầu đƣợc cất từ vỏ quả, lá, hoa đƣợc dùng trong công nghiệp thực phẩm. Đặc biệt là chanh yên, một tấn quả có thể đạt đƣợc 67 lít tinh dầu, tinh dầu ca quýt có giá trị khá cao trên thị trƣờng quốc tế. Ở nhiều nƣớc trên thế giới, từ những thời xa xƣa, ngƣời ta đã biết dùng các thuộc chi Citrus làm thuốc chữa bệnh. Ở thế kỷ thứ XVI, các thầy thuốc Trung Quốc, Ấn Độ đã dùng quả cam quýt để phòng ngừa bệnh dịch hạch, chữa trị bệnh phổi và bệnh chảy máu dƣới da. Ở nƣớc ta ngƣời dân đã dùng cây, lá, hoa, quả các loại cây ăn có múi để phòng và chữa bệnh từ thời xa xƣa. Lê Quý Đôn vết trong sách “ Vân đài loại ngữ” “Quýt 4 vàng là thƣợng phẩm, quýt đỏ, quýt vá, quýt cát là hạ phẩn, vỏ quýt có tính khoan trung hạ khí”, vỏ quýt có tên dƣợc liệu là “ trần bì” đƣợc sử dụng nhiều trong một số bài thuốc y học cổ truyền. Giá trị kinh tế, cây ăn quả có múi là cây lâu năm chóng cho thu hoạch, cây cam quýt có thể sống và chóng cho thu hoạch quả trong vòng 25-30 năm vẫn cho năng suất cao, đạt từ 100-250 kg quả/1cây trong một vụ.(Đƣờng Hồng Dật, 2000). 2.1.3. Tình hình sản xuất cam quýt ở Việt Nam Theo thống kê của ngành nông nghiệp thì đến năm 1993 diện tích trồng cam quýt ở nƣớc ta là 27.640 ha, tăng hơn năm 1989 năm là trên 10.000 ha (năm 1989- 17.205ha). Những năm gần đây diện tích trồng cam quýt ở một số nơi, nhất là ở một số tỉnh ĐBSCL tăng nhiều, trong khi một số tỉnh miền trung nhƣ Nghệ An, Hà Tỉnh, Quảng Bình, diện tích trồng cam quýt bị giảm xuống, năm 1999 cả nƣớc có vào khoảng trên dƣới 30.000 ha. Sản lƣợng cam quýt ở nƣớc ta năm 1993 đƣợc thống kê là 163.778 tấn, tăng khoảng 63.000 tấn so với năm 1989 (100.998 tấn). Năm 1999 ƣớc tính sản lƣợng cây có múi trong cả nƣớc là 300.000 tấn. Điều kiện đất đai và khí hậu nƣớc ta phù hợp cho phát triển cây ăn quả có múi. Tuy nhiên, quá trình tăng chậm và quá trình phát triển cây ăn quả có múi diễn biến thất thƣờng ở từng vùng sản xuất. Ở một số vùng trồng cam nổi tiếng trƣớc đây nhƣ vùng cam Bố Hạ (Bắc Giang), vùng cam Xã Đoài (Nghệ An), không những diện tích không tăng lên mà còn giảm xuống. (theo Đƣờng Hồng Dật, 2000). Năm 1995, diện tích trồng cây ăn quả trong cả nƣớc là 346.400 ha trong đó ĐBSCL 175.000 ha (50,7%), trung du miền núi Bắc Bộ 47.600 ha (13,7%), ĐBSH 33.800 ha (9,8%), miền Đông Nam Bộ 32.700 ha (9,5%), khu IV cũ 27.400 (7,9%), duyên hải miền Trung 20.600 ha (6,9%), Tây Nguyên 8.600 ha (2,5%). Theo Tổng cục thống kê năm 1996, vùng ĐBSCL đứng đầu về sản lƣợng cũng đứng hàng đầu chiếm tỷ trọng 49, 05%. (Trần Thế Tục, 1998). 2.1.4. Tình hình sản xuất cam quýt trên thế giới Trong những năm nửa sau thế kỷ XX, sản xuất cam quýt trên thế giới tăng nhanh. Theo tài liệu của Tổ chức lƣơng thực và nông nghiệp của Liên hợp quốc (FAO) 5 trong vòng 20 năm (từ năm 1975 đến năm 1995), sản lƣợng cam quýt trên thế giới tăng từ 22 triệu tấn lên đến 48 triệu tấn, tăng cao nhất là cam, quýt đỏ rồi đến chanh yên, bƣởi chùm và chanh. Trong vòng 15 năm tính từ năm 1970 đến năm 1984, sản lƣợng cam tăng bình quân là 51%, quýt 7,5%, chanh 4,7%, bƣởi chùm là 4,3%/ năm. Tổng sản lƣợng cam quýt trên thế giới trong những thập niên 90 của thế kỷ XX bình quân hàng năm là 60-70 triệu tấn với tổng diện tích là 2,5 triệu ha, tập trung ở các nƣớc có khí hậu á nhiệt đới và một phần nhiệt đới ở các vĩ độ cao hơn 20-22oC bắc và nam bán cầu. Hiện nay có 75 nƣớc trồng cam quýt trên thế giới đƣợc chia thành 4 khu vực : Châu Mỹ, các nƣớc Địa Trung Hải, các nƣớc Châu Phi và các nƣớc Châu Á. Những nƣớc trồng nhiều cam quýt nhất là Mỹ 9,6 triệu tấn /năm, Braxin 7,2 triệu tấn/ năm, Tây Ban Nha 1,7 triệu tấn / năm. Nhật Bản cung cấp10% sản lƣợng cam quýt trên thế giới với 2,7 triệu tấn vào những năm 20 của thế kỷ XX, trong đó chủ yếu là quýt Unshiu, loại quýt này chiếm 49,2% tổng sản lƣợng quả cam quýt của Nhật. (Đƣờng Hồng Dật, 2000). Thống kê năm 1967 của FAO cho biết tổng sản lƣợng về trái có múi là 28.902.000 tấn, trong đó cam và quýt chiếm 23.434.000 tấn tức 81% và bƣởi (cộng với bƣởi chùm ) chỉ có 2.286.000 tấn tức 7,9% chƣa bằng 1/10 cam, quýt. Dẫn chứng là Mỹ chỉ sản xuất bƣởi chùm (Citrus paradis ), không sản xuất bƣởi (Citrus grandis) đã chiếm tới 1.161.000 tấn tức 70,7% tổng số bƣởi và bƣởi chùm. Trong khi cả châu Á trong đó có hai nƣớc lớn nhất là Ấn Độ và Philippin, trong cả bƣởi và bƣởi chùm chỉ sản xuất 59.000 tấn tức 2,6%. Hiện nay, sản lƣợng trái có múi cả thế giới đã vƣợt quá 50 triệu tấn, gần gấp đôi năm 1967, song tỷ lệ trên đây không thay đổi nhiều và phần của bƣởi còn thấp hơn nữa.(Vũ Công Hậu, 1996). 2.2. Bệnh loét cam Xanthomonas citri (Hasse-Dowson) 2.2.1. Triệu chứng bệnh Bệnh loét hại cam quýt ở tất cả các bộ phận của cây trên mặt đất, làm rụng lá, quả, cây cằn cọc chóng bị tàn. Ở vƣờn ƣơm, khi bị bệnh nặng cây con dễ chết. Quả bị bệnh có phẩm chất kém không thể xuất khẩu và cất trữ đƣợc. Nhiều nƣớc trồng cam, quýt trên thế giới đã cấm nhập những cây, mắt ghép, quả bị bệnh. Bệnh phá hoại ở 6 nhiều nƣớc và đã phát triển thành dịch ở khắp vùng châu Á nhiệt đới-Thái Bình Dƣơng. Bệnh còn thấy ở các nƣớc châu Mỹ, châu Phi. Ở nƣớc ta bệnh hầu nhƣ phá hại ở tất cả các vùng trồng cam quýt, gây thiệt hại đáng kể làm ảnh hƣởng tới nguồn hàng xuất khẩu và tiêu dùng trong nƣớc. Bệnh thƣờng bắt đầu xuất hiện ở lá non. Ban đầu vết bệnh là những chấm nhỏ có đƣờng kính dƣới 1mm màu trắng vàng thƣờng thấy ở mặt dƣới lá. Sau đó vết bệnh mở rộng hơn phá vỡ biểu bì mặt dƣới lá. Xung quanh vết bệnh có vầng tròn dạng giọt dầu màu nâu hoặc xanh tối. Sau 2-3 tuần vết bệnh phát triển thành loét hình tròn màu nâu xám. Khi vết loét già hóa gỗ rắn lại hình dạng vẫn còn hoặc không định hình. Trên cây bƣởi vết bệnh khoảng 8mm. Ở quả vết bệnh cũng tƣơng tự nhƣ ở lá.Vết bệnh rắn xù xì màu nâu ở giữa lõm, mép ngoài nổi gờ lên, ở giữa vết bệnh mô chết rạn nứt. Toàn thể chiều dày của vỏ quả có thể bị loét nhƣng không bao giờ vết loét ăn sâu vào ruột quả, bệnh nặng có thể làm cho quả biến dạng ít nhiều. Hình 2.1 Triệu chứng bệnh loét trên lá bƣởi Da Láng Hình 2.2 Triệu chứng bệnh loét trên trái bƣởi Da Láng 7 Ở cành vết bệnh cũng tƣơng tự nhƣ ở lá nhƣng sùi lên tƣơng đối rõ ràng, ở giữa vết bệnh không lõm xuống hoặc lõm xuống không rõ rệt. Vết bệnh còn xuất hiện ở gai cũng giống nhƣ ở cành cây. . 2.2.2. Đặc điểm gây bệnh của chủng vi sinh vật gây bệnh (X. a. pv. citri) Vi khuẩn có hình gậy ngắn, kích thƣớc khoảng 1,5-2 x 0,5-0,75µm, hai đầu tròn có một lông roi ở đầu, có thể nối liền thành chuỗi, có vỏ nhờn nhuộm gram âm, háo khí. Độ dài genome khoảng 5 Mbp. Sinh trƣởng dễ dàng trên môi trƣờng agar – glucose –peptone, khuẩn lạc hình tròn, sáng, bóng, màu vàng sáp. Đặc trƣng để phân biệt vi khuẩn Xanthomonas sp. với loại vi khuẩn màu vàng khác là nó có thể sinh trƣởng thành khuẩn lạc màu vàng sáp trên miếng lát cắt củ khoai tây. Phạm vi nhiệt độ phát triển là 5-35oC, thích hợp 20-30oC. Ở nhiệt độ 52oC trong10 phút vi khuẩn chết. Vi khuẩn phát triển và hoạt động trong phạm vi pH 6,1- 8,8, thích hợp ở pH 6,6. Vi khuẩn có khả năng chịu hạn ở nhiệt cao, trong điều kiện phòng thí nghiệm có thể tồn tại 130 ngày. Bệnh loét cam, bƣởi là bệnh hại có tính nhiệt đới, vi khuẩn gây bệnh phát triển thích hợp trong điều kiện nhiệt độ cao, ẩm ƣớt, sức chống hạn và lạnh cao. Vi khuẩn tồn tại trong vết lá, cành bệnh từ năm này qua năm khác. Theo Wolf (1916) vi khuẩn bệnh loét cam có thể tồn tại qua đông trong đất, nhƣng Pltier và Frederich lại cho rằng vi khuẩn không thể tồn tại qua đông ở trong đất hoặc trong lá rụng. Lee (1920) và Fulton (1925) cho rằng vi khuẩn bệnh loét cam không đấu tranh đƣợc với tập đoàn vi khuẩn khác nên dễ dàng chết trong đất. Loucks Hình 2.3 Triệu chứng bệnh loét trên cành bƣởi Da Láng 8 (1930) đã chứng minh rằng vi khuẩn ở trong đất không vô trùng chỉ sống đƣợc 6-13 ngày nhƣng trong đất vô trùng có thể tồn tại đƣợc 150 ngày. Theo Rao và Hingorant ở đất vô trùng, vi khuẩn sống đƣợc 52 ngày còn ở đất không vô trùng chỉ sống đƣợc 17 ngày. Cũng từ hai tác giả trên thời gian sống của vi khuẩn ở những lá cây chết rụng xuống đất khoảng 6 tháng. (Lê Lƣơng Tề và Vũ Triệu Mân, 1999). Vào mùa mƣa trời ẩm ƣớt vi khuẩn từ trong vết bệnh cũ hoạt động, truyền lan đi trong mƣa, gió hoặc côn trùng, chim. Vi khuẩn cũng có thể truyền dễ dàng qua quần áo, nông cụ. Vi khuẩn rơi trên quả, lá, cành sẽ xâm nhập qua vết thƣơng, khí khổng. Đặc điểm xâm nhiễm gây bệnh: bệnh phát sinh do 3 yếu tố cơ bản tác động lẫn nhau quyết định là “cây ký chủ- vi khuẩn gây bệnh-điều kiện ngoại cảnh môi trƣờng” (Lê Lƣơng Tề và Vũ Triệu Mân, 1999). Dựa triệu chứng bệnh và sự biến chủng của vi khuẩn có các loại bệnh loét sau: - Loại Asiatic (Canker A), do Xanthomonas axonopodis pv.citri, bắt nguồn từ châu Á, phân bố rộng, khả năng gây bệnh rất mạnh. - Loại B, do Xanthomonas axonopodis pv. aurantifolii , bắt nguồn từ Nam Mỹ, gây bệnh chủ yếu trên chanh nhỏ, cam chua, bƣởi. - Loại C, cũng do Xanthomonasdis axonopodis pv. aurantifolii nhƣng gây bệnh trên chanh nhỏ và cam chua. - Loại A* đƣợc phát hiện ở Oman, Saudi Arabia, Iran và Idian chỉ gây bệnh trên chanh. ( 2.3. Sơ lƣợc vùng rDNA-ITS 2.3.1. Giới thiệu vùng rDNA Những gen mã hóa rRNA đƣợc tìm thấy trong vùng rDNA. Sản phẩm của những gen này (rRNA) kết hợp với những phân tử protein hình thành những ribosom có chức năng tổng hợp protein. Gen rDNA 16S mã hóa một phân tử RNA hình thành tiểu đơn vị ribosom nhỏ của vi khuẩn điển hình (thành phần protein của tế bào). Trình tự của gen này thích hợp là một mô hình phổ biến để nghiên cứu sự tiến hóa và phân loại vi khuẩn. Gene rDNA đƣợc tìm thấy ở hầu hết các dạng sống (ngoại trừ virus và 9 prion). Các thành phần của trình tự rDNA từ những sinh vật có quan hệ với nhau đƣợc đánh dấu giống nhau. Điều này có nghĩa, trình tự của những sinh vật thân cận đã đƣợc sắp xếp chính xác, làm cho những khác biệt dễ dàng để đánh giá. Điều đó cũng có nghĩa là chỉ một vài nhóm primer PCR là cần thiết để khuếch đại gene rDNA từ bất cứ loài vi khuẩn nào. Trình tự của rDNA 16S đã đƣợc xác định cho nhiều loài. Sự thật, không có bất kỳ gen nào khác đặc trƣng cho nhiều loài nhƣ vậy. Chiều dài và trình tự của những vùng ITS của rDNA đƣợc cho rằng là vùng tiến hóa nhanh nhất và vì vậy có thể rất biến đổi. Những universal primer đƣợc thiết kế từ những vùng bảo tồn nằm hai đầu vùng ITS và vùng ITS có kích thƣớc nhỏ (600 – 700 bp) dễ dàng đƣợc khuếch đại bởi vì số bản sao lớn (lên tới 30000 bản trong mỗi tế bào (Dubouzet and Shinoda, 1999) của vùng lặp lại trên rDNA. Điều này làm cho vùng ITS trở thành một đề tài đƣợc quan tâm cho việc nghiên cứu về sự tiến hóa và phát sinh loài (Baldwin và ctv., 1995; Hershkovitz và ctv., 1996, 1999) cũng nhƣ các nghiên cứu về địa lý sinh vật (biogeographic) (Baldwin, 1993; Suh và ctv., 1993; Hsiao và ctv., 1994; Dubouzet và Shinoda, 1999). (Nguyễn Thị Tiến Sỹ, 2005). 2.3.2. Vùng rDNA-ITS trên Xanthomonas ssp. Phân tích mối quan hệ loài dựa trên vùng 16s-23s rDNA bằng cách thiết kế cặp primer Xan1330 và Xan332 dựa trên vùng gen 16s-23s rDNA ở Xanthomonas sp. Sản phẩm PCR thu đƣợc là đoạn có kích thƣớc 1,1 kb và đƣợc xác định là Xanthomonas sp. (Edmilson R Gonealves và Yoko. B. Rosato, 2002). (Hình 2.3, Hình 2.4) 2.4. Sơ lƣợc về hrpW gen Sự tƣơng tác giữa ký sinh với ký chủ phụ thuộc vào hệ thống protein . Đặc biệt đối với tƣơng tác vi khuẩn gram âm gây bệnh thực vật với cây ký chủ. Loại protein này đƣợc mã hóa bởi hrp gen. Trên Xanthomonas axonopodis pv.citri ngƣời ta xác định các loại hrp gen: hrpG, hpaA, hpaB, hrcV, hrpB1, hrpD6, hrpB2, hrcU, hrcW, hrpB4, hrcN. Trên X. a. pv.citri các hrp gen này nằm thành cụm trừ hrpW. (Marcos C. Alergria và ctv, 2004). Dựa vào đặc tính của hrp gen là đặc trƣng cho từng loài gây bệnh nên ngƣời ta thiết kế primer chuyên biệt cho phản ứng PCR phát hiện nhanh, 10 chính xác loài gây bệnh. Phƣơng pháp phát hiện nhanh bằng primer chuyên biệt này nhanh, chính xác hơn các phƣơng pháp nuôi cấy. Hình 2.5 Sơ đồ hình cây thể hiện mối tƣơng quan giữa các dòng Xanthomonas sp. dựa trên vùng 16s-23s rDNA ITS (Edmilson R Gonealves và ctv, 2002). Hình 2.4. Cấu trúc vùng 16s-23s rDNA ITS của Xanthomonas sp. Trình tự primer Xan1330 và Xan332 đƣợc thiết kế trên vùng 16s-23s (Edmilson R Gonealves và ctv, 2002). Xan 1330 5’GTTCCCGGGCCTTGTACACAC 3’ Xan 322 5’ GGTTCTTTTCACCTTTCCCTC 3’ 11 Ngƣời ta dựa vào trình tự hrpW gen của X. a. pv. citri (Genbank Accession No. AE008923) thiết kế cặp primer XACR, XACF chuyên biệt phát hiện nhanh chính nó. Sản phẩm PCR thu đƣợc là đoạn có kích thƣớc 561 bp (Dong Suk Park và ctv, 2006) XACR 5’CGTCGCAATACGATTGGAAC 3’ XACF 5’CGGAGGCATTGTCGAAGGAA 3’ 2.5. Những cứu về bệnh loét cam quýt trên Thế Giới và Việt Nam 2.5.1. Trên Thế Giới Năm 2002, Edmilson R.Goncalves và ctv đã tiến hành phân tích mối quan hệ di truyền giữa 17 loài Xanthomonas sp. bằng thực hiên phản ứng PCR và đọc trình tự sản phẩm PCR.Phản ứng đƣợc thực hiện với cặp mồi Xan1330 và Xan332 đƣợc thiết kế trên đoạn 16s-23s rDNA ITS. Năm 2003, C. J. Vernière và ctv đã nghiên cứu sự phát triển và biểu hiện triệu chứng bệnh của X. a. pv. citri trên cây có múi. C. J. Vernière và cộng sự đã kết luận rằng để giảm bệnh loét nhà nông phải hạn chế tạo vết thƣơng cho cây, sự tăng trƣởng quá nhiều chồi non và sự tăng trƣởng của quần thể X. a. pv. citri. Hệ thống chắn gió là biện pháp hạn chế sự lan tràn bệnh hiệu quả nhất. Các tác nhân sinh học khác nhƣ ấu trùng của côn trùng chít hút cũng là phƣơng tiện truyền bệnh nguy hiểm. Khả năng nhiễm bệnh của ký chủ có liên quan đến giai đoạn phát triển của cây. Năm 2003, Jung-Gun- Kim và ctv, đã mô tả đặc tính của vùng gây bệnh hrp của X. a. pv. glycines Vùng này gồm vùng hrp gen, vùng hcr gen và vùng hca gen.Trong đó vùng hrp và hcr mã hóa cho loại protein đóng vai trò quan trọng trong quá trình xâm nhiễm của vi khuẩn X. a. pv. glycine. Đặc tính của vùng hrp gen này là chứa nhiều gen độc, thành phần G+C thấp. Năm 2006, Dong Suk Park và ctv, đã thực hiện thành công phƣơng pháp PCR với mồi chuyên biệt trên hrpW gen để phát hiện nhanh và chính xác X. a. pv.citri, là loài gây bệnh loét trên cây có múi tại châu Á. 2.5.2. Tại Việt Nam Năm 2002, Nguyễn Thị Thu Cúc -Phạm Thị Hoàng Oanh, trƣờng Đại Học Cần Thơ, có nghiên cứu về dịch hại trên cam, quít, chanh, bƣởi. Nghiên cứu này tập hợp 12 hầu hết các thông tin về dịch hại phổ biến tại Việt Nam. Trong nghiên cứu này, tổng cộng có trên 30 loài côn trùng và 15 loại bệnh phổ biến trên nhóm cam, quít, chanh, bƣởi đã đƣợc trình bày và mô tả qua các phần nhƣ đặc điểm hình thái, sinh học, sinh thái, sự gây hại, triệu chứng và các biện pháp đối phó. Năm 2005, Vi Thị Thanh Hƣờng, trƣờng Đại Học Nông Lâm Thành Phố Hồ Chí Minh đã nghiên cứu các tác nhân và biện pháp phòng trừ biện pháp phòng trừ bệnh loét trên bƣởi ở xã Tân Bình - huyện Vĩnh Cửu - tỉnh Đồng Nai. Tác giả đã phân lập đƣợc một số dòng vi khuẩn gây bệnh nhƣng chƣa định danh đƣợc. Đồng thời, tác giả cũng xác định một số loại thuốc hóa học phòng trừ bệnh loét. 2.6. Quy trình định danh Xanthomona sp. . 2.6.1. Quy trình định danh Xanthomonas sp. theo phƣơng pháp nuôi cấy, thực hiện phản ứng sinh hóa 1. Sử dụng môi trường chọn lọc để phân lập dòng gây bệnh (Bảng 2.1) 2. Xác định dựa vào sắc tố vàng Xanthomonadin. (Phƣơng pháp thực hiện sẽ nêu ở phần 3.4.3 phƣơng pháp và vật liệu) 3. Thực hiện thí nghiệm sinh hóa và quan sát hình thái (Bảng 2.2) a) Khả năng phát triển trong môi trƣờng YS ở 35oC trong 10-12 ngày. b) Kiểm tra sự tạo nhầy, màu sắc của khuẩn lạc trên môi trƣờng GYCA hoặc YDC trong 2-3 ngày. c) Kiểm tra khả năng phân hủy protein: là thử nghiệm khả năng phân hủy casein trong dịch sữa có chứa chất chỉ thị bromcresol purple đã khử trùng. Dịch sữa và khuẩn đƣợc ủ 27oC quan sát phản ứng phân hủy. d) Kiểm tra thủy phân asculin: phản ứng dƣơng tính khi dịch đổi màu nâu tối (môi trƣờngYS lỏng + ferric ammonium citrate 0,05% và asculin 0,1%, pH 6,8). e) Kiểm tra khả năng thủy phân gelatin. f) Kiểm tra khả năng tạo urease. g) Kiểm tra tạo axit từ carbohydrates. 13 4. Kiểm tra tính gây bệnh Khẳng định độc tính dòng phân lập đƣợc bằng cách chủng nhân tạo. Ký chủ đƣợc chủng hoàn toàn là cây sạch bệnh. Tạo vết thƣơng trên cây ký chủ. Sau đó nhỏ dòng vi khuẩn đã kiểm tra các bƣớc trên lên vết thƣơng. Đặt cây ký chủ đã chủng vào điều kiện tối ƣu cho bệnh phát triển. Thông thƣờng thì ở nhiệt độ 27oC-30oC, trong vòng 7 ngày sau khi chủng thì thấy triệu chứng bệnh. 2.6.2 Quy trình định danh theo phƣơng pháp phân tử Dựa trên quy trình định danh bằng phƣơng pháp nuôi cấy và kiểm tra sinh hóa nhƣng bổ sung thêm một số phƣơng pháp sinh học phân tử để định danh chính xác ở mức loài. Quy trình gồm các bƣớc sau: 1. Phân lập và kiểm tra hình thái, sinh hoá trên các môi trƣờng khác nhau nhƣ NA, YGA, YDC, KB. 2. Tiến hành kiểm tra dòng phân lập đƣợc bằng phản ứng ELISA để kiểm tra và phân loại dựa trên độc tính gây bệnh. 3. Kiểm tra sự oxy hóa nguồn cacbon (khả năng tạo axit từ đƣờng cacbon). 4. Kiểm tra khả năng gây bệnh của dòng phân lập bằng phƣơng pháp chủng nhân tạo. 5. Thực hiên phản ứng PCR với cặp primer đƣợc thiết kế trên vùng 16s-23s rDNA ITS. 6. Tiến hành cắt bằng enzyme giới hạn nghiên cứu sự đa dạng di truyền. 7. Đọc trình tự sản phẩm PCR trên vùng 16s-23s sẽ định danh đƣợc dòng vi khuẩn gây bệnh ở mức loài. (M. H. R Khoodoo và ctv, 2005). 14 Bảng 2.1. Môi trƣờng sử dụng phân lập một số loài X. campestris Bảng 2.2. Đặc tính sinh hóa của Xanthomonas sp. Loài Môi trƣờng campestris carotae translucens phaseoli vesicatoria fragaria SX, SM, NSCAA* XCS* XTS MXP Tween, XCS, XTS SX, SM Phản ứng kiểm tra X. cam _pestris X.raga_ riae X.albili _neans X.axono _podis X. ampelina Tạo nhầy trên GYCA/YDC + + _ _ _ Sinh trƣởng ở 35oC + _ + + _ Thủy phân asculin + _ + + _ Phân hủy gelatin V + v _ _ Phân hủy protein + _ _ _ _ Khả năng tạo Urease _ _ _ _ + Tạo axit từ: Arabinose Glucose Mannose + + + _ + + _ + + _ + _ + _ _ Ghi chú: * thƣờng sử dụng phân lập từ hạt 15 2.7 Phƣơng pháp PCR Phƣơng pháp PCR ( Polymerase Chain Reaction) là một công cụ khá mới trong sinh học phân học phân tử, do Karl Mullis và những cộng sự phát minh năm 1985 và đã liên tục hoàn thiện và phát triển trong thời gian gần đây. Kỹ thuật PCR cho phép khuếch đại một đoạn DNA mong muốn lên nhiều lần để phục vụ cho nhiều mục đích khác nhau. Nguyên tắc cơ bản của phƣơng pháp PCR chủ yếu dựa vào khả năng tự nhân đôi, biến tính và hồi tính của DNA. *Nguyên tắc của phƣơng pháp PCR Dựa trên khả năng biến tính và hồi tính của DNA cùng với sự phát hiện ra enzyme Taq- polymerase (1 loại DNA polymerase chịu nhiệt), ngƣời ta thiết lập đƣợc hàng loạt các phản ứng nhân đôi DNA in vitro trong một thời gian ngắn. Khi ta làm biến tính (đun nóng) để đoạn DNA tách ra thành 2 mạch đơn và cung cấp 2 mồi chuyên biệt gồm mồi xuôi và mồi ngƣợc bắt cặp bổ sung với 2 đầu đoạn DNA cần nhân lên thì Taq-polymerase sẽ tổng hợp nên 2 sợi DNA mới. Nhƣ vậy nếu phản ứng nhân đôi DNA đƣợc lập lại liên tục nhiều lần thì ta sẽ thu đƣợc một lƣợng khuếch đại rất lớn DNA cần nghiên cứu. Phản ứng PCR gồm nhiều chu kỳ, mỗi chu kỳ có 3 giai đoạn: - Giai đoạn 1: là giai đoạn biến tính (denaturation), nhiệt độ đƣợc nâng lên 93- 100oC. Ở nhiệt độ này tất cả các mạch xoắn kép của DNA đều đƣợc tách ra. - Giai đoạn 2: là giai đoạn bắt cặp (hybridization), nhiệt độ của phản ứng đƣợc hạ xuống thấp hơn nhiệt độ nóng chảy-Tm của các mồi (là nhiệt độ mà tại đó 2 mạch của sợi đôi DNA tách ra hoàn toàn) cho phép các mồi bắt cặp với DNA khuôn mẫu. Mức nhiệt độ dao động khoảng 40- 70 oC, tuỳ thuộc vào Tm của các mồi mà thời gian từ 30 -60 giây. - Giai đoạn 3: là giai đoạn kéo dài (extension), nhiệt độ đƣợc nhân lên 68-72 oC. Ở nhiệt độ này Taq-polymerase hoạt động tốt nhất để kéo dài các mạch DNA. Đoạn DNA nằm giữa 2 mồi đƣợc tổng hợp. Cứ sau 1 chu kỳ gồm 3 giai đoạn trên, từ 1 DNA khuôn mẫu sẽ tạo ra 2 DNA mới. Và sau mỗi lần lập lại sẽ làm tăng gấp đôi lƣợng DNA mẫu của lần trƣớc (theo cấp số nhân). Tổng số DNA đƣợc khuếch đại sau phản ứng PCR đƣợc tính theo công thức: Tổng số DNA khuếch đại = m x 2n Với m là số bản sao ban đầu của DNA mẫu, n là số chu kỳ. 16 PH ẦN 3. VẬT LIỆU VÀ PHƢƠNG PHÁP 3.1. Thời gian và địa điểm nghiên cứu Thời gian: Đề tài đƣợc tiến hành từ 06/02/06 đến 06/08/06 Địa điểm: Tại Trung Tâm Phân Tích Hóa Sinh và Bộ Môn Bảo Vệ Thực Vật- Trƣờng Đại Học Nông Lâm T.P Hồ Chí Minh. 3.2. Nội dung nghiên cứu 1. Phân lập, nuôi cấy, xác định dòng vi khuẩn gây bệnh là gram âm hay gram dƣơng, quan sát hình thái trên môi trƣờng PGA, YDC. 2. Chủng bệnh nhân tạo xác định dòng vi khuẩn phân lập đƣợc là dòng vi khuẩn có khả năng gây bệnh trên ký chủ là cây bƣởi. Dựa trên kết quả chủng bệnh khẳng định đặc tính gây bệnh của dòng vi khuẩn phân lập. 3. Thực hiện sắc ký bản mỏng để định danh Xanthomonas.sp (dựa vào sắc tố vàng Xanthomodin đặc trƣng). 4. Nhân sinh khối, ly trích DNA tổng số các dòng vi khuẩn phân lập đƣợc. 5. Dùng phản ứng PCR trên 16s-23s rDNA ITS với cặp primer Xan1330 và Xan332 để kiểm tra phƣơng pháp định danh đã thực hiện. Đồng thời tiến tới giải trình tự sản phẩm PCR định danh ở mức độ loài. 6. Thực hiện phản ứng PCR trên vùng hrpW gen với cặp mồi chuyên biệt XACR và XACF cho phép xác định nhanh Xanthomonas axonopodis pv. citri. 3.3 Vật liệu nghiên cứu Tiến hành thu thập mẫu bệnh cây bƣởi Da Láng, bƣởi Đƣờng Cam tại huyện Vĩnh Cửu, tỉnh Đồng Nai. Mẫu bệnh đƣợc thu thập tại vƣờn, trữ trong thùng mát, mang về phòng, tiến hành phân lập. 3.4. Phƣơng pháp tiến hành 3.4.1 Phân lập, nuôi cấy trên 2 môi trƣờng PGA và YDC, xác định Gram âm hay Gram dƣơng các dòng vi khuẩn gây bệnh loét trên cây bƣởi  Dụng cụ và thiết bị  Hóa chất và vật liệu - Autoclave - Đƣờng glucose - Bếp điện - CaCO3 17 - Tủ cấy vô trùng - Yeast extract - Đĩa peitri - Khoai tây - Becher 100ml - Agar - Cồn 96%, và cồn 70% - Que cấy - Đèn cồn  Phân lập vi khuẩn gây bệnh, nuôi cấy trên 2 môi trƣờng PGA và YDC, xác định Gram âm hay Gram dƣơng 1. Thu thập mẫu bệnh, lá, trái bị bệnh. 2. Cắt nhỏ thành mẫu hay đoạn ngắn. 3. Khử trùng bề mặt bằng cách nhúng mô bệnh trong nƣớc cất vô trùng 1 phút, tiếp tục rửa bằng cồn 70% trong 15- 30 giây, sau đó rửa sạch trong nƣớc cất vô trùng. 4. Để khô mẫu sau đó cấy lên môi trƣờng PGA. 5. Nuôi cấy thuần khiết dòng vi khuẩn: từ đĩa petri phân lập vi khuẩn, chọn một khuẩn lạc, dùng que cấy khử trùng trên ngọn lửa đèn cồn cấy truyền vi khuẩn sang đĩa petri mới. Đặt đĩa Petri đã cấy truyền ở nhiệt độ thích hợp (28 oC) từ 1-3 ngày cho đến khi các khuẩn lạc mới mọc ra. Từ đó cấy truyền lại lần thứ 2 khi các khuẩn lạc đều đồng nhất về hình dạng, kích thƣớc, độ nhờn, cuối cùng khuẩn lạc đồng nhất nói trên đƣợc trữ trong LB tăng sinh (Lê Lƣơng Tề và Vũ Triệu Mẫn 1999 và có chỉnh sửa, 1999). 6. Cấy các khuẩn lạc đã đồng dạng này cấy tiếp tục lên môi trƣờng YDC quan sát hình thái màu sắc đậm trƣng. 7. Xác định Gram âm hay Gram dƣơng: Nhỏ một giọt dung dịch KOH3% ra miếng lam. Sau đó, dùng que tăm lấy một vi khuẩn cần xác định khuấy đều trong giọt dung dịch. Kéo que tăm lên thấy dung dịch kéo sợi thì đó là Gram âm, còn không kéo sợi đó là Gram dƣơng. 18 - Cách đặt tên cho các dòng vi khuẩn phân lập được Dựa trên cây ký chủ thu thập mẫu lá và trái. Ví dụ: dòng vi khuẩn XBDL1 đƣợc hiểu là dòng Xanthomonas sp., BDL là tên ký chủ bƣởi Da Láng, số 1 là dòng vi khuẩn trên lá, số 2 là dòng trên cành, số 3 là dòng vi khuẩn trên trái. 3.4.2. Chủng bệnh nhân tạo Chủng bệnh nhân tạo trong phòng: hái lá, quả bƣởi không bị nhiễm bệnh, rữa thật sạch dƣới vòi nƣớc chảy. Khi lá, quả bƣởi ráo nƣớc ta tiến hành chủng bệnh. Dùng kim nhọn gây vết thƣơng dƣới lá, sau đó dùng pipet hút dịch khuẩn (khuẩn lạc đặc trƣng pha với nƣớc cất vô trùng) nhỏ lên vết thƣơng. Giữ lá trong hộp nhựa đủ độ ẩm. 3.4.3. Thực hiện sắc ký bản mỏng định danh vi khuẩn  Dụng cụ và thiết bị  Hóa chất và vật liệu - Bình hút ẩm - Methanol 100% - Epffendorf 1,5 ml - Nutrient - Micropipette 1000µl - Agar - Bếp điện - Tấm sắc ký - Máy ly tâm  Phƣơng pháp sắc ký bản mỏng Nhiều vi khuẩn có sắc tố vàng thƣờng đƣợc phân lập từ cây hoặc đất. Xanthomonas cũng có sắc tố vàng. Do đó, việc dựa vào màu khuẩn lạc trên môi trƣờng để xác định đó là Xanthomonas thì khó. Tuy nhiên, ngƣời ta vẫn có thể xác định đƣợc Xanthomonas dựa vào phƣơng pháp sắc ký bản mỏng. Các bƣớc tiến hành: 1. Cấy khuẩn lạc trên môi trƣờng nutrient agar (môi trƣờng không có cacbonhydrate vì sẽ tạo chất nhầy cản trở quá trình sắc ký). 19 (b) 2. Sau 48 giờ phát triển ở nhiệt độ phòng, cạo sinh khối vi khuẩn cho vào ống típ, thêm 3ml methanol sao cho độ đục của vi khuẩn trong methanol khoảng 10 10 CFU/ml. 3. Đặt ống típ vào nƣớc đang sôi, cho đến khi màu vàng xuất hiện. 4. Ly tâm 1000 vòng/15 phút loại mảnh vỡ tế bào. 5. Thu dịch nổi, đồng thời làm bay hơi methanol trong dung dịch trong nƣớc ấm 50-60 oC cho đến khi mật độ quang học của dịch chiết sắc tố khoảng 0.4 ở 443nm. 6. Nhỏ dịch chiết sắc tố này lên tấm bản mỏng đo sắc tố. Mỗi dòng vi khuẩn là một giếng. mỗi giếng là 25µl (hình 3.1). 7. Đặt tấm sắc ký bản mỏng đã nhỏ sắc tố vào dung dịch methanol. Để cho methanol thẩm thấu lên tấm sắc ký này (hình 3.2). 8. Phát thảo vệt sắc tố màu vàng hiện lên tấm sắc ký. Vệt sắc tố màu vàng có Rf khoảng 0.45 chứng tỏ đó là Xanthomonas. Hình 3.1 (a) Tấm sắc ký vừa nhỏ Xanthomodin dung dịch sắc tố, (b) Tấm sắc ký ngâm methanol trong bình hút ẩm. 3.4.4. Phƣơng pháp ly trích DNA tổng số của vi khuẩn  Hóa chất và vật liệu - Hỗn hợp phenol: chloroform: isoamyl alcohol (25:24:1) - Hỗn hợp chloroform: izoamyl alcohol (24:1) - Isopropanol Vệt sắc tố sau khi nhỏ lên tấm sắc ký (a) 20 - Ethanol 100 % và 70 % - Dung dịch đệm ly trích DNA Tris (trisma bazơ): chất đệm, giữ ổn định pH tránh tổn hại DNA EDTA (Ethylenediamine tetraacetate) : tạo phức Mg++, gây bất hoạt enzyme phân hủy DNA trong quá trình tách chiết SDS: (sodium dodecy sulphate) 20 % : phá vỡ và tẩy sạch màng tế bào, màng nhân để phóng thích DNA Dung dịch CTAB (Cetultrimethylammonium bromide): dùng để kết tủa polysaccharide và tạp chất khác - 10g CTAB (Cetultrimethylammonium bromide) - 100ml NaCl 0,5 M Dung dịch đệm TE (Tris-EDTA) pH 8 Bảng 3.1. Thành phần dung dịch đệm TE Thành phần Nồng độ stock Nồng độ Thể tích Tris (pH 8.0) 1 M 10 mM 0,5ml EDTA 0,5 M 0,5 mM 0,1ml Nƣớc cất 49,4ml Tổng cộng 50,0ml  Các dụng cụ và thiết bị đƣợc sử dụng để ly trích DNA - Epffendorf 1,5 ml - Micropipette các loại - Đầu típ các loại - Bồn ủ nhiệt - Máy vortex - Máy ly tâm lạnh - Giấy thấm - Tủ 4oC và - 20oC  Quy trình ly trích DNA tổng số 1. Thu sinh khối vi khuẩn bằng cách ly tâm 10 000 vòng/ 5 phút/ 4oC. Rửa sinh khối vi khuẩn đƣợc với 1ml nƣớc cất 2 lần vô trùng, đánh tan bằng vortex. 21 2. Hòa tan sinh khối vi khuẩn thu đƣợc trong 567µl dung dịch TE, đánh tan bằng vortex, thêm 30µl dung dịch SDS10%, đánh tan bằng vortex. Sau đó ủ ở 37 oC khoảng 1-2 h. 3. Cho thêm vào 100µl dung dịch NaCl5M hòa tan thật kỹ bằng vortex. 3. Thêm 80µl dung dịch CTAB/NaCl, pha trộn (đánh tan bằng vortex), ủ 65oC trong 10 phút. 4. Chiết xuất dung dịch DNA với phenol/ chloroform/ isoamyl alcohol (25:24:1).Hòa hỗn đều bằng cách lắc tay, ly tâm 14 000 vòng/ 10 phút/ 4oC. 5. Thu hết dung dịch bên trên cho vào ống ly tâm mới. 6. Thêm 780µl dung dịch hỗn hợp chloroform / isoamyl alcohol (24:1).Hòa lẫn đều bằng lắc tay, ly tâm 12 000 vòng/10 phút/4 oC. 7. Thu lấy dịch bên trên cho vào ống ly tâm mới. Kết tủa DNA với isopropanol, ủ -20 oC/ 30 phút. Sau đó ly tâm 12 000 vòng/ 10 phút/4 oC. Lấy kết tủa sau ly tâm. 8. Rửa kết tủa bằng ethanol 70% ở -20 oC, ly tâm 13 000 vòng/10 phút/4 oC. Đổ cồn ra hết, làm khô bằng cách cho cồn bay hơi. 9. Hòa tan kết tủa trong 40µl dung dịch TE, đem giữ mẫu ở tủ mát 4 oC trong suốt thời gian thử nghiệm. (Sambrook và ctv, 2001 đã có cải tiến) 3.4.5. Khuếch đại vùng 16s-23s rDNA ITS và vùng hrpW gen  Các hóa chất đƣợc sử dụng để thực hiện phản ứng PCR - Dung dịch đệm PCR 10X (Bio-rad) - MgCl2 50 mM (Bio-rad) - dNTP 10 mM (gồm dATP, dTTP, dGTP, dCTP) (Bio-rad) - Taq DNA polymerase 5 UI/µl (Bio-rad) - Primer: Xan1330 và Xan332, XACR và XACF Các dụng cụ và thiết bị đƣợc sử dụng thực hiện phản ứng PCR - Hộp đá khô -20oC - Eppendorf 0,2ml 22 - Micropipette 10µl, 100µl và các loại đầu típ tƣơng ứng - Máy luân nhiệt - Tủ vô trùng Khuếch đại vùng 16s-23s rDNA ITS dòng vi khuẩn phân lập với cặp mồi Xan1330 và Xan332 (M.H.R Khoodoo và ctv, 2005) Xan 1330 5’GTTCCCGGGCCTTGTACACAC 3’ Xan 322 5’ GGTTCTTTTCACCTTTCCCTC 3’ Bảng 3.2. Hỗn hợp thực hiện phản ứng PCR. Bảng 3.3 Chu trình nhiệt phản ứng PCR.cc Khuếch đại đoạn hrpW gen dòng vi khuẩn phân lập với cặp mồi XACF và XACR Sử dụng bặp mồi XACR, XACF khuếch đại vùng hrpW gen trên Xanthomonas axonopodis pv.citri có kích thƣớc 561bp. Đây là trình tự mồi chuyên biệt để xác định Thành phần Nồng độ ban đầu Nồng độ sau phản ứng Thể tích (µl) PCR buffer 10X 1X 2,5 dNTPs 25mM 0,2mM 0,2 MgCl2 25 mM 0,75mM 0,75 Primer 20pmol/µl 1,25pmol/µl 1 Taq polymera se 5unit/1µl 2unit/1µl 0,4 DNA <=100ng <=50ng 1 H2O 18,05 Tổng cộng 25 Các bƣớc phản ứng Nhiệt độ Thời gian Giai đoạn khởi động Chạy chu kỳ (25 chu kỳ) Tách DNA khuôn Ủ và bắt cặp Kéo dài Giai đoạn kết thúc 94 o C 94 o C 58 o C 72 o C 72 o C 3 phút 1phút 45 giây 1 phút 7phút 23 chính xác 4 dòng phân lập đƣợc là Xanthomonas axonopodis pv.citri . (theo Dong Suk Park và ctv, 2005). XACF 5’ CGTCGCAATACGATTGGAAC 3’ XACR 5’CGGAGGCATTGTCGAAGGAA 3’ Bảng 3.4. Hỗn hợp thực hiện phản ứng PCR. Bảng 3.4. Chu trình nhiệt phản ứng PCR 3.5.6. Điện di kiểm tra sản phẩm ly trích và sản phẩm PCR  Dụng cụ và thiết bị  Hóa chất - Cân kĩ thuật 4 số, ống đong - Agarose - Lò viba - TAE 0,5X - Khay đổ gel - Loading dye 6X - Bồn và máy điện di - Ethidium bromide - Máy chụp hình gel (Gel doc) Thành phần Nồng độ ban đầu Nồng độ sau phản ứng Thể tích (µl) PCR buffer 10X 1X 2,5 dNTPs 25mM 0,2mM 0,2 MgCl2 25 mM 1,5mM 1,5 Primer 100pM 10pM 0,25 Taq polymera se 5unit/1µl 2unit/1µl 0,4 DNA <=100ng <=50ng 1 H2O 19,25 Tổng cộng 25 Các bƣớc phản ứng Nhiệt độ Thời gian Giai đoạn khởi động Chạy chu kỳ (25 chu kỳ) Tách DNA khuôn Ủ và bắt cặp Kéo dài Giai đoạn kết thúc 94 o C 94 o C 60 o C 72 o C 72 o C 5 phút 15giây 30giây 30giây 7phút 24 Bảng 3.6. Thành phần dung dịch TAE 50X Thành phần Thể tích 1 lít Tris base 2M 242 g Glacial acetic acid 57,1 ml EDTA 0,5 M, pH 8.0 100 ml  Quy trình thực hiện 1. Chuẩn bị gel agarose để điện di DNA - Chuẩn bị dung dịch TAE 1X, cho dung dịch TAE 1X vào hộp điện di. - Pha dung dịch agarose 0,8 %, gồm agarose và dung dịch TAE 1X. - Đun sôi dung dịch agarose trên lò viba đến khi agarose tan hoàn toàn. Nếu quá trình đun mất nhiều

Các file đính kèm theo tài liệu này:

  • pdfTRAN THI MINH TU - 02126117.pdf