Isolation, point mutation of p5cs gene conferring drought tolerance and transformion into soybean varieties of vietnam

1.1. Soybean varieties collected are varied in phenotype, size and the number of seeds. Analysis of biochemical characteristics of local soybean varieties showed the strong correlation between the quality and the drougth tolerance. The correlation between the content of proline and the drought tolerance was proved in these studied soybean varieties. 1.2. The sequences of P5CS isolated in two soybean varieties DT84 and SL5 were 2148 nuleotide encoded for 715 amino acids. 1.3. The gene P5CS was mutated at the amino acid 125 in soybean varieties SL5. Asparated was replaced by alanine in protein sequence. 1.4. Promoter rd29A was succesfully isolated from Arabidopsis thaliana. Promoter rd29A was 1298bp in length and carried typical motifs including MYB, DRE, AMYBOX.

pdf21 trang | Chia sẻ: aquilety | Lượt xem: 2278 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Isolation, point mutation of p5cs gene conferring drought tolerance and transformion into soybean varieties of vietnam, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
MINISTRY OF EDUCATION AND TRAINING THAI NGUYEN UNIVERSITY NGUYEN THI THUY HUONG ISOLATION, POINT MUTATION OF P5CS GENE CONFERRING DROUGHT TOLERANCE AND TRANSFORMION INTO SOYBEAN VARIETIES OF VIETNAM Major: Genetics Code: 62.42.70.01 PHD THESIS ABSTRACT THÁI NGUYÊN - 2011 PUBLICATIONS 1. Nguyen Thi Thuy Huong , Chu Hoang Mau, Ha Tan Thu, Dinh Thi Kim Phuong, Tran Thi Truong (2006), “Collection, classification, and qualitative assessment of some local soybean cultivars in Sonla province, Science & Technology Journal of Agriculture & Rural development, 11 (1): 28-32. 2. Chu Hoang Mau, Nguyen Thi Thuy Huong (2006), “Amino acid content and drought tolerance of some local soybean variables in Sonla province ”, Science & Technology Journal of Agriculture & Rural development, 20 (2): 22-26. 3. Nguyen Thi Thuy Huong, Chu Hoang Mau, Le Van Son, Nguyen Huu Cuong, Le Tran Binh, Chu Hoang Ha (2008), "Evaluation of drought tolerant ability and cloning of P5CS gene of some soybean cultivars (Glycine max L.Merrili)", Journal of Biotechnology, 6(4): 459-466. 4. Nguyen Thi Thuy Huong, Tran Thi Ngoc Diep, Nguyen Thu Hien, Chu Hoang Mau, Le Van Son, Chu Hoang Ha (2009) "The development of in vitro regeneration system from cotyledonary node for transformation in soybean (Glycine max L.Merrili) ", Journal of Science and Technolog, Thai Nguyen University 52(4): 82-88. 5. Nguyen Thi Thuy Huong, Chu Hoang Mau, Le Van Son, Nguyen Huu Cuong, Le Tran Binh, Chu Hoang Ha (2009), "Mutagenesis of the P5CS cDNA to obtain an enzyme insensitive to proline feedback inhibition". Bio-Hanoi 2009: 191 - 193. 6. Nguyen Thi Thuy Huong, Chu Hoang Mau, Le Van Son, Nguyen Huu Cuong, Chu Hoang Ha (2010), "Cloning and activity evaluation of desiccation-inducible promoter, RD29A from Arabidopsis thaliana ", Journal of Biotechnology 8(4): 1805-1810 7. Nguyen Thi Thuy Huong, Chu Hoang Mau, Le Van Son, Nguyen Huu Cuong, Chu Hoang Ha (2010), "Removal of feedback inhibition of P5CS results in increase proline accumulation and protection from drought stress on tobacco transgenic. Bio-Hanoi 2010. Journal of Biotechnology, 8 (3A): 539-544. 8. Chu Hoang Mau, Nguyen thi Thuy Huong, Nguyen Tuan Anh, Chu Hoang Lan, Le van Son, Chu Hoang Ha ( 2010) Characteristic of the gene encoding pyrroline – 5 – carboxylate synthase (P5CS) in Vietnamese sobean cultivar (Glycine max L.Merrill) 2010 International Conference on Biology, Environment and Chemistry (ICBEC 2010) IEEE: 319-323 1 INTRODUCTION 1. Preface Soybean (Glycin max L Merrill) is one of the most important crops not only in Vietnam but also in other contries in the world. The soybean of Vietnam and other world-leading producting coutries in the world is seriously affected by drought annually. Soybean has low resistance to drought as well-documented so far in many genotypes. In Vietnam, scienctists have succeeded in creating new varieties with improved tolerace to drought through traditional breeding and these varieties are widely cultivated in many areas. However, the traditional breeding itself possesses disadvantages such as laboriousness, time spending, requiring enough hybrids and unstability. The developments of modern biotechnology can overcome these disadvantages of conventional methods. On of the well-known technology is plant transformation mediated by Agrobacterium tumefaciens successfully applied in varied plant crops by breeding scientist in the world. The research group of Dr. Tran Thi Cuc Hoa at the Cuu Long Delta Institute of Rice Research has recently reported a transformation system for soybean and the system is applied to produce novel soybean varieties with resistant to differenct pathogens. Despite this fact, the application of plant transformation for developing soybean with modified stress tolerance has not been used domestically. Based on above arguments we performe a work entitled “Isolation, point mutation of P5CS gene conferring drought tolerance and transformation into soybean varieties of Vietnam”. 2. Objectives 2.1. Comparing the DNA sequence of P5CS isolated from different soybean varieties and producing mutant P5CS without feedback inhibition by proline. 2.2. Designing transformation vector carrying mutant P5CS conferring drought tolerance in soybean. 2.3. Creating transgenic soybean containing the transformation vector carrying mutant P5CS. 3. Activities 3.1. Characterization of biochemical and physiological features of soybean varieties grown in the North of Vietnam. 3.2. Isolating and sequencing gene encoding for 1-pyroline-5 carboxylate synthetase (P5CS). 3.3 Site-directed mutagenization of P5CS in order to remove the feedback inhibition by proline. 2 3.4. Isolation of promoter rd29A – a responsive promoter under dehydration conditions – from Arabidopsis thaliana and characterization of promoter rd29A in transgenic tobacco. 3.5. Construction of vector carrying P5CS under the control of promoter rd29A and transformation of this construct into tobacco. 3.6. Characterization and analysis of drought tolerance transgenic tobacco lines under stress conditions in vitro. 3.7. Transformation of the construct carrying P5CS under the control of promoter rd29A into Vietnamese soybean and analysis of the present of P5CS in transgenic lines. 4. Significant results 4.1. Gene P5CS was successfully isolated and sequenced from two Vietnamese soybean varieties, DT84 and SL5, respectively, with 2148 nucleotides in length and encoded for a protein with 715 amino acids. 4.2. The feedback inhibition by proline of enzyme P5CS was successfully removed using site-directed mutagenesis at the 125th amino acid (Aspartate into Alanine). 4.3. Promoter rd29A was successfully isolated from Arabidopsis thaliana with 1298 nucleotide in length carrying typical element of a responsive-dehydration promoter such as MYB, DRE, AMYBOX. 4.4. The vectors carrying GUS and P5CSM under the control of promoter rd29A were constructed and transformed into tobacco. The transgenic tobacco lines containing construct rd29A::GUS showed significant enhancement in enzyme activity of GUS under stress conditions. Moreover, the transgenic tobacco lines containing construct rd29A::P5CSM represented significantly higher resistance to drought in comparison with the wildtype plants. The results confirmed a fact that this construct can be reasonably used for other crops and plant species in order to create new plant varieties with improved stress tolerance. 3 4.5. The transformation system into soybean was optimized and used to create transgenic soybean lines containing construct rd29A::P5CSM. These lines were positively analyzed by PCR and will be good materials for further researches on developing new soybean varieties with high resistance to drought. 5. Scientific and applied values 5.1. Scientifically, this is the first report in Vietnam on determining the tolerance of varied soybean varieties under artificial stress conditions, isolating and modifying the structure of P5CS by site directed mutagenesis by PCR. The results on analysis of P5CS confirm the fact that the difference in drought tolerance in soybean is determined by complicated mechanism, however P5CS is one of the most important factors conferring the drought tolerance in crop in general. 5.2. Practically, the results on analysis of transgenic soybean plants containing the mutant P5CS under the control of stress inducible promoter rd29 proved the practical values of the thesis. The drought tolerance in transgenic tobacco containing this structure show that this can be applied on other crops in order to improve one the most vital trait of crop, drought. The results on establishing the transformation system in soybean are the valued basis for further developing novel soybean varieties with high stress tolerance. 6. Structure of the thesis The thesis includes 113 pages, divided by parts as following: Introduction composes 3 pages; Chapter 1: Overview, 34 pages; Chapter 2: Materials and Methods, 15 pages; Chapter 3: Result and discussion, 46 pages; Outlooks, 2 pages; Publication: 1 page; References: 11 pages; The thesis included 29 tables, 43 figures and 118 references in English and Vietnam. Chapter 1. OVERVIEW The thesis cited and sumarized 64 publications, among these 10 were written in Vietnam, 51 were written in English, 3 websites about 5 basic subjects such as: (1) introduction of soybean (Glycine max (L.) Merill), economic and practical values; (2) 4 Physiological and biochemical basics of drought tolerance in soybean; (3) Proline and the improtant function of P5CS in the proline biosynthesis in plants; (4) Promoter and roles in controlling the expression of genes under drougth conditions; (5) Studies on improving the drought tolerance of soybean in the world. Proline is known as one of the compounds functioning in osmotic regulation mechanism of plant cell under stress conditions such as drought, salinity (Delauney and Verma, 1993). Beside that, proline plays vital roles in protecting cellular structures and macro molecules when the cell is under osmotic stresses; in protecting protein structure and improving the activity of varied enzymes; in digesting reactive oxygen residues and in inactivating singlet oxygen quencher (Szavados et al, 2009). In plants, the biotesynthesis of proline is controlled by two genes encoding for P5CS. These two genes are highly homologous in amino acid sequence but expressed differently under different conditions. Both genes are found to express in flower in order to provide proline for the flower development processes (Mattioli et al, 2009). The study on Arabidopsis showed the tight relationship between the expression of these two genes and the accumulation of proline when plants are exposed to salinity condition; and the feedback inhibition by poline on P5CS is also affected under the same conditions. The transgenic tobacco overexpressed a mutant P5CS which lost this inhibition showed that the accumulation of proline increase up to two folds in comparison to wildtype. Recently, a P5CS has been isolated from rice and when transformed back into rice revealed that transgenic plants showed higher tolerance to salinity and cold. Promoter rd29A is an inducible sequence under varied conditions such as drought, salt and cold. Studies found important motifs in rd29A sequence related to the operation such as ABRE and (DRE)/C repeat (CRT). These two motifs are thought to be important for rd29A in order to control the expression of genes under stress conditions of surrouding environment (Yamaguchi-Shinozaki và Shinozaki, 1993). Rd29A has been isolated from many plant species such as Arabidopsis, tobacco and rye (Sun và Chen, 2002). The transformation vectors bearing GUS under the control of rd29A have been transformed into potato and sugarcane. The activity of 5 GUS has been found in transgenic plants under different stress conditions in culture (Zhang et al., 2005) . In therory, there are different methods for improving the stress tolerance in plants, however the application of transformation technology is more preferable with breeding scientist. For Vietnam, there is no doubt about the high potential of application this technique in developing new crop varities with improve drought tolerance. Chapter 2. MATERIALS AND METHODS 2.1. Materials, chemicals and equipments Plant materials: 16 local and DT 84 soybean varieties ; 326 tobacco variety (Nicotiana tabacum), and Arabidopsis thaliana. Chemicals: pBT clone vector, pBI101 vector for contructing a transgenic vector, pTN 289 transgenic vector. Primers for amplifying the P5CS gene and the rd29A promoter were designed based on the nucleotide sequence of P5CS gene (Genebank code: AY492005) and the nucleotide sequence of the rd29A promoter (Genebank code: AB428730). The chemicals for tissue culture and bio-molecular experiments belonging to Merk, Bioneer, Fermentas were supported by Plant Cell Biotechnology Department. 2.2. Methods 2.2.1. Bio-physical and bio-chemical methods - The ability of drought tolerance was rapidly estimated following Binh L. T. et. al. 1998 - The dissolved protein concentration was determinated by Lowry’s method. Amount of lipids was determinted following Chau P. T. T. Amount and components of amino acids of seeds were determinted following Chi P. V. et al. (1997). - Prolin concentration was determinted following Bates et. al. (1973). - Data was analyzed following Tuat N. H. and Khoi N. K. (1996). 2.2.2. In vitro tissue culture methods 6 In vitro tissue culture methods on Arabidopsis and tobacco are following Topping ,1988. Soybean plants were generated by the multiple-shooting system using axillary cotyledon of matured seeds. The transgenic protocol using axillary cotyledon of matured seeds was improved from Olhoft’s method (2001). 2.2.3. Bio-molecular methods - Specific primers were designed based on nucleotide sequences on Genebank. - The total DNA was isolated from arabidopsic and tobacco leaves; - The total RNA was isolated from soybean using Trizol Regents kit (Invitrogen) - cDNA was synthesized by using Total RNA and RevertAidTMH Minus First Strand cDNA Synthesis Kit (Fermentas). - PCR reaction: P5CS gene was amplified by using specific primers. The PCR reaction consisted of 940C for 5 minutes, then 35 cycles of 94°C for 30 seconds, Tm (from 500C to 620C) for 45 seconds, and 72°C for 60 seconds, followed by a final extension of 72°C for 10 minutes. - OE - PCR reaction( Overlap Extension-PCR) OE-PCR reaction was carried out following: 94ºC for 5 minutes; then 4 cycles of 94ºC for 30 seconds, Tm (from 500C to 620C) for 45 seconds, 72ºC for 90 seconds; 72ºC for 10 minutes, followed by a final extension of 72°C for 10 minutes. Then, the products were placed immediately on ice and 1µl BamHI and 1µl SaclI. The OE-PCR reactions were continued following 94ºC for 5 minutes; then 30 cycles of 94ºC for 30 seconds, Tm (from 500C to 620C) for 45 seconds, 72ºC for 90 seconds; 72ºC for 10 minutes, followed by a final extension of 72°C for 10 minutes. - Cloning methods: recombined plasmids were isolated and purified following Sambrook et. al. (2001) and Plasmid Miniprep Kit (Qiagen). Cutting by restricted enzymes was done following Sambrook et. al. (2001) - Colony-PCR method. - Constructing vectors: rd29A :: GUS và rd29A :: P5CSM - Transgenic plant analysis methods: the present of inserted gene in transgenic plants was identified by bio-chemical methods. Transgenic tobacco plants were treated 7 drought artificially by using PEG following Jun et. al. (2001). The concentration of beta-glucuronidase (GUS) was determinated following Tefferson et. al. (1987) Chapter 3. RESULTS AND DISSCUSION 3.1. Results in collection and evaluation of local soybean varieties in Son La province 3.1.1. Characteristics of morphology and biochemistry Sixteen soybean varieties were detected in seven counties in 11 different districts of Son La province. Protein content of these varieties ranged between 29.72% -52.75% protein / dry weight and lipid content ranged from 9.9% - 18.65% in which DT84 varieties have the highest lipid content 18.65%, followed by SL3 (17.34%). 3.1.2. Analysis of drought tolerance ability of soybean varieties. Proline content of SL5 increased up to 377.44% (highest value) after 9 days of drought treatment. Whereas proline content of DT84 increased slightly at all three time points (101.06, 129.26 and 146.81%). This result is consistent with the other studies when they research on drought tolerace of different crops such as rice (Nguyen Huu Cuong et al; Due et al; Choudhary et al 2005), legumes (Curtis et al; Chen et al). 3.2. Cloning of P5CS and elimination of reverse inhibition by site-directed mutation 3.2.1. Cloning of P5CS 3.2.2. Results in amplification, cloning and sequencing of P5CS gene Total RNA was extracted and cDNA was synthesized from SL5 and DT84. Four nucleotide fragments of P5CS gene were amplified by PCR and checked by electrophoresis on 0.8% agarose gel. Figure 3.3 showed that the size of the gain band corresponding to the size of the theoretical calculations. In order to obtain full sequence of P5CS gene, these two PCR products were mixed and used as template for PCR using primers P5CSfor/P5CSrev. PCR products obtained approximately 2100 bp in size (Figure 3.4). 8 Figure 3.3. PCR amplification of two P5CS nucleotide fragments of DT84 and SL5 1, 3: DT84; 2, 4: SL5; M: 1 kb DNA ladder Figure 3.4. Combination of two P5CS nucleotide fragments by PCR 1, 3: DT84; 2, 4: SL5; M: 1 kb DNA ladder Sequencing results showed that the nucleotide sequences of both two samples (DT84 and SL5) contain 2148 nucleotides encoding 715 amino acids. In which two amino acid Asp125 and Phe128 in the deduced P5CS amino acid sequence cause inhibition of P5CS activity by increasing proline content in cells (Zhang et al 1995) 2 Figure 3.10. Identification of P5CS by PCR with P5CS M125for2/SacI-P5C primer pair (1) and P5CS for / P5CS rev primer pair (2); M : 1kb DNA ladder. Figure 3.11. Combination of two DNA fragments following OE-PCR method using BamHI-P5CS and Sacl-P5CS primer pair. A, B : 1+2, M: 1kb DNA ladder 2100bp M 2 1 1800bp 400bp 1000bp 1500bp M A B M 1 2 3 4 2100bp M 1 2 3 4 9 3.2.3. Results in elimination of reverse inhibition by site-directed mutation of P5CS Figure 3.10 showed that the size of obtaining DNA fragment was about 2100 bp, which corresponds to the original size of the P5CS gene (Fig. 3.11). However, in order to check whether the cloned P5CS contains the nucleotide exchange mutation (A T) at nucleotide position 374 of P5CS gene, the cloned P5CS was sequenced and showed in Fig. 3.13. 310 320 330 340 350 360 370 380 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| MSL5 AACAGCCTTATGGCTCTTTATGATGTTTTGTTTAGTCAGCTGGATGTGACATCTGCTCAGCTTCTTGTGACGGCCAATGA N S L M A L Y D V L F S Q L D V T S A Q L L V T A N D SL5 .........................................................................A...... N S L M A L Y D V L F S Q L D V T S A Q L L V T D N D Figure 3.13. Analysis of nucleotide sequence of the cloned P5CS and detection of nucleotide exchange mutation Nucleotide sequences of the cloned P5CS were aligned out by BioEdit 7 software. The alignment showed that the nucleotide A at position 374 was replaced by nucleotide C (A374→G), resulting in the change of one amino acid (Asp125→Ala) in the deduced amino acid sequence. 3.3. Cloning and testing the activity of rd29A promoter after drought treament 3.3.1. Cloning of rd29A promoter The primer pair rd29A -HindIII / rd29A -BamHI (Tab. 3.7) was designed according to the nucleotide sequences of rd29A in Gene Bank and used to amplify the complete sequence of rd29A promoter (1290 nucleotides) from A. thaliana genomic DNA. Electrophoresis of PCR product showed that there was a single band of 1.3 kb. 10 Figure 3.15. Identification of rd29A in pBT/rd29A by PCR and restriction digestion of pBT/ rd29A using BamHI/HindIII M) Marker; 1) PCR product; 2) pBT/ rd29A digested with BamHI/HindIII PCR products were ligated into pBT cloning vector and transformed into E. coli DH5(α). The obtaining colonies after transformation were screened by colony-PCR using specific primers and double enzyme digestion. Electrophoresis showed that the DNA band of 1.3 kb equivalent to the expected size (1.29 kb). The results proved PCR product was successfully ligated into pBT cloning vector (Fig 3.15). 3.3.2. Analysis of rd29A promoter nucleotide sequence After checking the presence of Rd29A promoter by PCR and restriction digestion, nucleotide sequence of rd29A was confirmed by sequencing using specific primers. The obtaining nucleotide sequences were alignted out with nucleotide sequence of rd29A deposited in Gene Bank. The aligntment result showed that rd29A promoter was succesfuly cloned and consisted of 1290 bp in length. In which, there are a few boxes that contain necessary sequences for regulated promoter activities such as TATA box; CCAAT box – GC rich region (GGGCCAATAG), cap signal and regions related to transcription (-10 và -35). In addition, regions related to drought 11 condition such as DRE, ABRE also were observed (Fig 3.16). This result is consistent with findings of earlier studies (Wu et al 2008; Shinozaki et al 2007). Furthermore, rd29A promoter isolated in this study also contains the cis elements of the MYB group, DRE, AMYBOX. These cis elements were specific for the regulated promoter which is activated under stress conditions such as drought, salinitanddehydration. gaatgagaaggatgtgccgtttgttataataaac -10 agccacacgacgtaaacgtaaaatgaccacatgatgggccaatagacatggaccga CCAAT box và vùng giàu GC ctactaataatagtaagttacattttaggatggaataaatatcaTACCGACATcag DRE-1 ttttgaaagaaaagggaaaaaaagaaaaaataaataaaagatatacTACCGACATg -35 DRE-2 agttccaaaaagcaaaaaaaaagatcaagccgacacagacacgcgtagagagcaaaatgactttgacgtcacaccacga aaacagacgcttcatACGTGTCcctttatctct ABRE ctcagtctctctataaacttagtgagaccctcctctgttttactcacaaatatgca Cap signal TATA box Aactagaaaacaatcatcaggaataaagggtttgattacttctattgga Figure 3.16. Nucleotide sequence of rd29A promoter 3.3.3. Contruction of plant transformation vector carrying rd29A In order to confirm the activity of rd29A promoter under drought condition, rd29A was inserted into pBI101 and drove the expression of gus gene. The insertion of rd29A promoter into pBI101 were check by PCR and restriction digestion using BamHI and SacI. Fig. 3.18 showed that the DNA band of 1.3 kb equivalent to the expected size. Then the binary vector pBI101/rd29A is transform into Agrobacterium tumefaciens (strain C58) for plant transformation. 12 Figure 3.18. Identification of rd29A by PCR and restriction digestion of pBI101/ rd29A M) Marker; 1-2) PCR products; 3-4) pBI101/ rd29A digested with BamHI/SacI 3.3.4. Production of transgenic tobacco containing transformation vector rd29A::GUS 1. Explants on induction medium GM after two days 2. Explant inoculated with bacteritum 3. Explants on cocultivation meidum after two days 4. Explants on medium GM supplemented 50mg/l Kanamycin and 400mg/l Cefotaxime 5. Shoots on medium GM supplemented 50mg/l Kanamycin and 400mg/l Cefotaxime 6. Transgenic plants on medium RM supplemented 50mg/l Kanamycin and 400mg/l Cefotaxime 7. Transgenic plants in greenhouse 8. Transgenic plants grown in soil 9. Transgenic plants grown in greenhouse Figure 3.19. Transformation of rd29A into tobacco 13 Analysis of activity of promoter rd29A in transgenic tobacco After transformation, 51 transgenic tobacco line were produced on regeneration medium containing kanamycin. Screening 22 lines by PCR using specific primer for rd29A - HindIII/ rd29A –BamHI showed that 21 of tested lines contained interseted gene rd29A. To analyse the activity of GUS, 3 of 21 positively PCR-sreened lines were choosen and used for drought stress by artificial condition using 10% PEG (polyethylene glycol). The results showed that under dehydration the activity of GUS in transgenic tobacco lines were clearly identified and strong incomparison to wildtype and untreated other transgenic lines (Figure 3.20). 0 100 200 300 400 500 600 700 800 DCT DCS 3T 3S 4T 4S 5T 5S Mẫu Lư ợ n g M U (pm o l/m in . m g) Figure 3.20. The expression of GUS in transgenic plants A: wildtype treated; B: Transgenic plants untreated; C: The transgenic plants treated after 24 hours. Figure 3.21. The activity of GUS in transgenic tobacco lines containing promoter rd29A under artificial drought conditions ĐC: wildtype; 3, 4, 5: The transgenic plants, T: before drought, S: after drought. The activity of GUS in transgenic tobacco lines were also analysed by the reaction conversed the subtrated MUG. GUS oxides the substrate MUG into MU, the stronger activity of GUS is, the more MU produces. MUS can be detected by spectrophotometer at 378 nm (Fior et al, 2009). The amount of MU produced in transgenic tobacco lines after stress was increased up to 13 folds (figure 3.21). The data in this thesis were in agreement with reported by Zhang (Zhang et al, 2005). 14 3.4. Analyse the improvenment in drought stress tolerance of transgenic tobacco containing rd29A:: P5CSM 3.4.1. Designing the transformation vector containing rd29A:: P5CSM The results showed here was the digestion of P5CSM and rd29A::GUS by two restriction enzymes BamHI and SacI. After ligation by T4 ligase and transformation into competent cells. A B Figure 3.23. Electrophoresis of colony-PCR and digestion products of vector pBT Results of digestion by restriction enzymes and colony-PCR (Figure 3.23 confirmed that 3 colonies containing the transformed vector. This meant that we successfully designed the transformation vector bearing rd29A:: P5CSM which were ligated in pBT. Results of transformation vector containing rd29A:: P5CSM into Agrobacterium tumefaciens Electrophoresis results were checked on gel agarose 0.8% and showed clearly that 4 of 9 colonies choosen revealed positive results by using PCR. The resutl showed an unique band with about 1300bp in length. This firmly showed that the transformation vector rd29A:: P5CSM was sucessfully transformed into Agrobacterium tumefaciens. Therefore we have produced the Agrobacterium tumefaciens containing pGV2260 bearing recombinant vector rd29A:: P5CSM. This is the good material for further transformation in plants in order to create new drought-tolerance varieties. M 1 2 3 - + A: Colony-PCR products using primer rd29A for / rd29A rev M: Ladder DNA 1kb; Giếng 1-3: Colonies (-) negative control, (+ ) positive control B: Digestion products by BamHI and SacI M: Ladder DNA 1kb; 1-3: Colonies 1.3kb 1 2 3 M 12kb 3,4kb 15 3.4.2. Production of transgenic tobacco carrying vector rd29A:: P5CSM The transformation vector pBI101 bearing promoter rd29A controlling the expression of P5CS was transformed into tobacco cultivar K326. Figure 3.25. Screening transgenic tobacco lines PCR using primers rd29A for /rd29Arev M: Ladder DNA 1kb; 1-9Transgenic lines; (-) Negative control; (+) Postive control Figure 3.25 showed that 30 of 33 putative transgenic tobacco lines were positive after screening by PCR. Only one DNA band with 1.4kb in length was revealed at each electrophoresis lane. This is the expected length of promoter rd29A. This meant that these transgenic tobacco lines carrying expected transformation vector rd29A:: P5CSM. 3.4.3. Analysis of the drought tolerance ability of transgenic tobacco lines The samples of transgenic tobacco linew and wildtype were collected before and after drought stress treatment 3, 5, 7 and 9 days. The samples were used to extract proline and checked for the proline content. The results were showed in table 3.7 and figure 3.25. After drought treatment, the content of proline in studied plants was strongly increased, especially in transgenic tobacco plants. After 9 days of stress treatment, the content of proline was increased up to 206.8% in the wildtype and from 259.5 to 451.8% in transgenic tobacco plants (highest in lines H33 and lowest in H11). M 1 2 3 4 5 6 7 8 9 - + 16 Figure 3.27. Transgenic tobacco plants after 20 days of drought treatment (A) and recover (B) WT: Wiltype, H11, H15, H26, H33: Transgenic plants 3.5. Results of production of transgenic soybean 3.5.1. Results on regeneration via multishoot of soybean variety DT84 3.5.1.1. Optimization of seed sterilization time By comparison two methods of seed sterilization (by chloride gas and by natrihypochloride) we found that chloride gas showed better results and the time required for the sterilization was 16 hours, sterilized seeds were good for further experiments. 3.5.1.2. Effect of BAP on the mutishoot regeneration from cotyledons The samples were wounded and removed the shoot apex, were placed on 8 media containing BAP with different concentration from 0mg/l to 2.5mg/l. Eventually we found that the medium supplemented by 2mg/l BAP was the most suitable for multishoot multiplication and was used for further experiment. 3.5.1.3. Effect of plant growth regulator GA3 on shoot elongation of multishoot Multishoots induced on medium SIM4 were transferred onto medium sumpplemented by GA3 with different concentration from 0.5, 1, 1.5mg/l. The addition of GA3 (0,5 mg/l) was the most suitable for shoot elongation and this is ingrement with other reports previously (Olhoft et al 2007), Olhoft et al 2001) 17 3.5.1.4. Effect of IBA on root production The concentration of IBA was studied and concluded that 0.1mg/l was the most suitable for rooting in vitro of soybean cultivar DT84. 3.5.1.5. Identification of potting mix for cultivating transgenic soybean in greenhouse Potting mixtures including trấu hun, 1 burnt hustle: 1 sand and commercial mixture were tested. The factors were taken into consideration were survival ratio and the number of plants. The results showed that the mixture 1 burnt hustle: 1 sand was the most suitable for cultivating in vitro plants under greenhouse conditions. 3.5.2. Results on transformation of GUS into soybean cultivar DT84 The transient expression of GUS was 67.5%. The number of survival samples on selection medium was 15.21% after two weeks. 3.5.3. Results of transformation of drought-tolearnce vector into soybean The experiments were repeated three times with 1262 explants used for transformation. 564 samples were shooted, 101 shoots were elongated and during the selection by antibiotics 28 were survived and rooted. These plants were grown in greenhouse. To check for the presence of transgene in plants, after one month of growing in greenhouse, leaves were harvested for DNA isolation and PCR screening. The results showed that 3 plants were positive by PCR screening. Figure 3.36. Screening transgenic plants by PCR M: Ladder DNA 1kb; (-): Negative control; WT: Wildtype; 1 -4: Transgenic plants; (+): Positive control M 1 2 3 4 5 WT - + 18 Line 11 Line 23 Line 17 Figure 3.37. Transgenic soybean CONCLUSION AND OUTLOOKS 1. Conclusion 1.1. Soybean varieties collected are varied in phenotype, size and the number of seeds. Analysis of biochemical characteristics of local soybean varieties showed the strong correlation between the quality and the drougth tolerance. The correlation between the content of proline and the drought tolerance was proved in these studied soybean varieties. 1.2. The sequences of P5CS isolated in two soybean varieties DT84 and SL5 were 2148 nuleotide encoded for 715 amino acids. 1.3. The gene P5CS was mutated at the amino acid 125 in soybean varieties SL5. Asparated was replaced by alanine in protein sequence. 1.4. Promoter rd29A was succesfully isolated from Arabidopsis thaliana. Promoter rd29A was 1298bp in length and carried typical motifs including MYB, DRE, AMYBOX. 1.5. The operation of rd29A was analysed in transgenic tobacco. Under dehydration, promoter rd29A controled the expression of GUS and GUS was strongly expressed in transgenic tobacco plants in comparison to wildtype and untreated transgenic plants. 1.6. In transgenic tobacco carrying transformation vector rd29A:: P5CSM , the increase in proline content was observed and these plants growed better and longer 19 under stress condtions compared to wildtype. The recover of transgenic plants after treatment was obvisously better than the wildtype plants. 1.7. The transformation and regeneration systems were optimized for soybean. Transgenic plants carrying vector rd29A:: P5CSM were produced in Vietnamese soybean cultivar DT84, these were positively screened by PCR using specific primers. 2. Outlooks 2.1. Further studies should be done for transgenic soybean lines in term of developing novel soybean varieties with improved drougth resistance. 2.2. Using transformation vector rd29A:: GUS và rd29A:: P5CSM should be tested in other crops .

Các file đính kèm theo tài liệu này:

  • pdftom_tat_english_ncs_ng_thi_thuy_huong_05_2011_1542.pdf
Luận văn liên quan