Luận án Nghiên cứu khả năng kháng rầy nâu và đặc điểm nông sinh học của một số giống lúa tại thừa thiên Huế

Như vậy, kết quả phân tích gen kháng rầy nâu cho thấy, giống IRRI 352 mang gen bph1, BG 367-2 có gen bph1, bph3, bph4 và bph10, Sài Đường Kiến An có gen bph1, bph3, bph4 và bph14, Lốc Nước có gen bph1, bph3, bph4 và bph14. Tuy nhiên, trình tự nucleotide của mẫu nghiên cứu không tương đồng hoàn toàn với với trình tự tương ứng trên cơ sở dữ liệu của GenBank. Gen bph 4 có tỷ lệ tương đồng 97%, gen bph 1 và 3 có tỷ lệ tương đồng 95% và gen bph 14 là 90%. Kết quả trên có thể giải thích như sau: đối với gen bph 14 chúng tôi thiết kế cặp mồi để khuếch đại đoạn DNA có kích thước khá lớn (1000-1500 bp), dẫn đến việc gắn nhầm hay bỏ sót của enzyme Taq DNA polymerase trong quá trình PCR [19]. Bên cạnh đó, sự khác nhau về giống lúa nghiên cứu với các nghiên cứu khác cũng có thể là lý do dẫn đến tỷ lệ tương đồng chưa cao. Một nguyên nhân nữa cũng đáng lưu ý đó là rầy nâu có khả năng gia tăng tính thích ứng đối với giống lúa kháng đơn gen và chuyển biến thành biotype mới [20]. Khả năng gây hại và độc tính của rầy nâu ở các vùng địa lý, khí hậu khác nhau cũng thay đổi, dẫn đến hiện tượng một số giống lúa có khả năng kháng rầy nâu ở vùng này nhưng có thể trở thành giống nhiễm ở vùng khác [12], [77, 87]. Do vậy, cùng gen kháng nhưng ở địa

pdf114 trang | Chia sẻ: phamthachthat | Lượt xem: 1496 | Lượt tải: 1download
Bạn đang xem trước 20 trang tài liệu Luận án Nghiên cứu khả năng kháng rầy nâu và đặc điểm nông sinh học của một số giống lúa tại thừa thiên Huế, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
, biến nạp vector vào E.coli DH5α, tách và tinh sạch plasmid tái tổ hợp. Kết quả chúng tôi thu được plasmid có mang các đoạn gen được tinh sạch. Trình tự nucleotide của các sản phẩm PCR đã overlaping với nhau. Nối các sản phẩm PCR chúng tôi thu được chiều dài đầy đủ của đoạn DNA (4714 bp) và đặt tên là gen bph14-25 (Hình 3.16). 79 Hình 3.16. Chiều dài gen bph14-25 + So sánh trình tự nucleotide của gen bph14-25 và bph14 Kết quả giải trình tự của mẫu nghiên cứu được so sánh với trình tự tương ứng trên cơ sở dữ liệu của GenBank ( accession number: FJ941067.1) [49], cho thấy chúng tương đồng nhau 90% (Phụ lục 2). Từ kết quả này ta có thể khẳng định giống lúa nghiên cứu có gen bph14. Như vậy, kết quả phân tích gen kháng rầy nâu cho thấy, giống IRRI 352 mang gen bph1, BG 367-2 có gen bph1, bph3, bph4 và bph10, Sài Đường Kiến An có gen bph1, bph3, bph4 và bph14, Lốc Nước có gen bph1, bph3, bph4 và bph14. Tuy nhiên, trình tự nucleotide của mẫu nghiên cứu không tương đồng hoàn toàn với với trình tự tương ứng trên cơ sở dữ liệu của GenBank. Gen bph 4 có tỷ lệ tương đồng 97%, gen bph 1 và 3 có tỷ lệ tương đồng 95% và gen bph 14 là 90%. Kết quả trên có thể giải thích như sau: đối với gen bph 14 chúng tôi thiết kế cặp mồi để khuếch đại đoạn DNA có kích thước khá lớn (1000-1500 bp), dẫn đến việc gắn nhầm hay bỏ sót của enzyme Taq DNA polymerase trong quá trình PCR [19]. Bên cạnh đó, sự khác nhau về giống lúa nghiên cứu với các nghiên cứu khác cũng có thể là lý do dẫn đến tỷ lệ tương đồng chưa cao. Một nguyên nhân nữa cũng đáng lưu ý đó là rầy nâu có khả năng gia tăng tính thích ứng đối với giống lúa kháng đơn gen và chuyển biến thành biotype mới [20]. Khả năng gây hại và độc tính của rầy nâu ở các vùng địa lý, khí hậu khác nhau cũng thay đổi, dẫn đến hiện tượng một số giống lúa có khả năng kháng rầy nâu ở vùng này nhưng có thể trở thành giống nhiễm ở vùng khác [12], [77, 87]. Do vậy, cùng gen kháng nhưng ở địa phương có điều kiện sinh thái khác có thể biến đổi tương ứng với bioype rầy nâu. KẾT LUẬN VÀ ĐỀ NGHỊ 1. Kết luận 1. Các giống lúa nghiên cứu có các đặc điểm hình thái-sinh lý khá phù hợp với nhiều vùng trồng lúa như: thời gian sinh trưởng-phát triển vụ Hè Thu (94-97 ngày), vụ Đông Xuân (126-137 ngày); tỷ lệ nảy mầm cao (>95%); chiều cao cây thuộc nhóm bán lùn (<110 cm); số bông/m2 nhiều, tỷ lệ hạt chắc cao dẫn đến năng suất thực thu thuộc loại khá (56,9-63,8 tạ/ha trong vụ Hè Thu và 55,3- 58,7 tạ/ha trong vụ Đông Xuân). Kết quả phân tích ANOVA-hai yếu tố cho thấy các chỉ tiêu sinh lý của cây lúa không chỉ chịu ảnh hưởng của yếu tố di truyền bph14-25 80 của từng giống mà còn phụ thuộc từng mùa vụ gieo trồng. Kết quả phân tích mối liên quan giữa năng suất và các chỉ tiêu sinh lý cho thấy các thông số như hàm lượng diệp lục a/b, diện tích lá đòng và số hạt/bông là gây ảnh hưởng đến 27% năng suất của lúa với P = 0.03. 2. Kết luận về chất lượng gạo: chất lượng hạt gạo của các giống lúa được quyết định bởi yếu tố di truyền của giống, không sai khác nhiều giữa hai mùa vụ, hàm lượng chất dinh dưỡng cao; trừ giống IRRI 352 là giống lúa nếp thì 3 giống BG 367-2, Sài Đường Kiến An và Lốc Nước có độ dẻo và mềm cơm thuộc nhóm trung bình, là nhóm chất lượng gạo cơm được ưa chuộng hiện nay. Trong đó giống Sài Đường Kiến An hình dạng hạt thon, dài mức trung bình, độ bạc bụng thấp. 3. Kết luận về phản ứng kháng rầy nâu: Kết quả đánh giá tính kháng rầy nâu trong nhà lưới và theo dõi mật độ rầy nâu ngoài đồng ruộng cho thấy các giống lúa BG 367-2, Sài Đường Kiến An và Lốc Nước đều có biểu hiện kháng tốt với quần thể rầy nâu Thừa Thiên Huế, giống Khang Dân nhiễm rầy nâu. Kết quả phân tích mối liên quan giữa năng suất và thời gian nhiễm rầy cho thấy thời điểm tính từ sau khi gieo 45 ngày, 66 ngày, 73 ngày, 80 ngày, 87 ngày, 108 ngày và 129 ngày ảnh hưởng đến 62% năng suất lúa ở mức ý nghĩa P = 0,0015. 4. Kết luận về gen kháng rầy nâu: giống IRRI 352 có mang gen bph1; giống BG 367-2 có gen bph1, bph3, bph4 và bph10 ; giống Sài Đường Kiến An có gen bph1, bph3, bph4 và bph14; giống Lốc Nước có mang gen bph1, bph3, bph4 và bph14. Như vậy, ba giống lúa BG 367-2, Sài Đường Kiến An và Lốc Nước đều là giống mang đa gen kháng rầy nâu, đây là những giống lúa thể hiện khả năng kháng rầy nâu bền vững. 2. Đề nghị - Trồng khảo nghiệm các giống lúa ở diện rộng trên một số vùng chuyên trồng lúa khác nhau thuộc địa bàn Thừa Thiên Huế, tiếp tục theo dõi tính ổn định về khả năng kháng rầy, năng suất và phẩm chất gạo, làm cơ sở khoa học cho việc sử dụng các giống lúa được tuyển chọn thay thế dần cho các giống địa phương đã bị thoái hóa. - Tiếp tục triển khai nghiên cứu các gen kháng và xây dựng hoàn chỉnh qui trình xác định các gen kháng rầy nâu khác trong bộ gen kháng rầy nâu ở các giống đã tuyển chọn từ đó đưa ra phương pháp kiểm tra nhanh sự có mặt của gen kháng ở các giống lúa trước khi đưa ra trồng ngoài thực địa. 81 NHỮNG CÔNG TRÌNH ĐÃ ĐƯỢC CÔNG BỐ CÓ LIÊN QUAN ĐẾN LUẬN ÁN 1. Hoàng Thị Kim Hồng, Phạm Thị Thanh Mai, Đặng Minh Đức, Trần Đăng Hòa (2010), “Nghiên cứu đặc điểm hình thái và sinh trưởng của một số giống lúa chuẩn mang gen kháng rầy nâu (Nilaparvata lugens S.) tại Thừa Thiên Huế”, Tạp chí Công nghệ Sinh học 8(3A): 611-618. 2. Phạm Thị Thanh Mai, Hoàng Thị Kim Hồng, Đoàn Thị Tám (2010), “Đặc điểm sinh trưởng và chất lượng gạo của một số giống lúa kháng rầy nâu trồng ở Thừa Thiên Huế”, Tạp chí Công nghệ Sinh học 8(3B): 1311-1318. 3. Hoàng Thị Kim Hồng, Nguyễn Đình Cường, Phạm Thị Thanh Mai, (2011), “Đánh giá phẩm chất gạo của một số giống lúa kháng rầy nâu trồng ở Thừa Thiên Huế”, Tạp chí Khoa học, Đại học Huế, 64: 33-43. 4. Pham Thi Thanh Mai and Hoang Thi Kim Hong (2012), “Bph14 gene determining brown-planthopper (Nilaparvata lugens Stal) resistance in rice varieties (Oryza sativa L.)”, Annal of Biological Research 3(3): 1424-1433. 5. Phạm Thị Thanh Mai, Hoàng Thị Kim Hồng, Nguyễn Thị Như Ý (2012), “Xác định sự hiện diện của gen kháng rầy nâu (Nilarpavata lugens Stal) ở một số giống lúa (Oryza sativa L.)”, Tạp chí Khoa học, Đại học Huế, 75A(6): 83-90. 6. Phạm Thị Thanh Mai, Hoàng Thị Kim Hồng, Võ Thị Mai Hương (2012), “Đặc điểm sinh lý, hóa sinh và phân tử của giống lúa Sài Đường Kiến An trồng ở Thừa Thiên Huế”, Tạp chí Công nghệ sinh học, 4A(10): 851-858. 7. Phạm Thị Thanh Mai, Hoàng Thị Kim Hồng, Nguyễn Đình Cường, Võ Thị Mai Hương (2012), “Nghiên cứu đặc điểm sinh trưởng, năng suất và khả năng kháng rầy nâu của một số giống lúa trồng tại Thừa Thiên Huế”, Tạp chí Khoa học, Đại học Huế, 75A(6): 91-100. 8. Pham Thi Thanh Mai, Hoang Thi Kim Hong (2016), “Identify of markers linked with brown-planthopper (Nilaparvata Lugens Stal) resistance genes bph1, bph2 in rice varieties (Oryza Sativa L.), Journal of Biotechnology, 14(1A): 291-297. TÀI LIỆU THAM KHẢO Tiếng Việt [1]Ban chỉ đạo phòng và chống rầy nâu bệnh vàng lùn lùn xoắn lá các tỉnh phía Nam (2011), Tình hình dịch rầy nâu, bệnh vàng lùn, lùn xoắn lá ở Nam Bộ, TP Hồ Chí Minh. [2]Bộ Nông nghiệp và Phát triển Nông thôn (2002), Tiêu chuẩn ngành quy phạm khảo nghiệm giá trị canh tác và sử dụng của giống lúa 10TCN-558-2002, Hà Nội. [3]Bộ Nông nghiệp và Phát triển Nông thôn (2009), Chiến lược phát triển nông nghiệp nông thôn giai đoạn 2011-2020, Hà Nội. 82 [4]Bộ Nông Nghiệp và Phát Triển Nông thôn (2011), "Quy chuẩn kỹ thuật quốc gia về khảo nghiệm giá trị canh tác và sử dụng của giống lúa ", QCVN 01-55 : 2011/BNNPTNT, [5]Bùi Bá Bổng, Nguyễn Văn Huỳnh, Nguyễn Hữu Huân, Hồ Văn Chiến, Ngô Vĩnh Viễn, Mai Thành Phụng, Phạm Văn Dư,Rogelio Cabunagan (2006), Sổ tay hướng dẫn phòng trừ rầy nâu truyền bệnh vàng lùn, lùn xoắn lá, Bộ Nông nghiệp và Phát triển Nông thôn, Hà Nội. [6]Nguyễn Minh Công, Hoàng Trọng Phán,Chu Thị Minh Phương (2005), "So sánh một số chỉ tiêu về sinh trưởng và phẩm chất gạo của giống lúa Tám Thơm đột biến và các dòng lúa đột biến triển vọng từ các giống lúa thuộc loại hình Japonica với con lai F1", TC Di truyền học và ứng dụng, 1, tr. 43-48. [7]Cục Trồng trọt-Bộ Nông nghiệp và phát triển nông thôn (2006), Giống và thời vụ sản xuất lúa đồng bằng sông Cửu Long, NXB Nông Nghiệp TP Hồ Chí Minh. [8]Lê Đức Diên, Cung Đình Lượng,Hà Duy Thứ (1968), Thực tập lớn Sinh lý thực vật, Trường Đại học Tổng hợp Hà Nội. [9]Lê Thị Dự, Nguyễn Thành Cân, Thái Thị Hạnh, Nguyễn Thị Hoa, Phạm Văn Sơn,Nguyễn Thị Tâm (2009), Kết quả chương trình khảo nghiệm giống lúa Đông Xuân 2008-2009 ở đồng bằng sông Cửu Long, Viện lúa đồng bằng sông Cửu Long. [10]Phạm Văn Dư,Lê Thanh Tùng (2011), Phát triển sản xuất lúa gạo vùng đồng bằng sông Cửu Long, Trung tâm Khuyến nông Quốc gia, Bộ Nông nghiệp và Phát triển Nông thôn. [11]Nguyễn Ngọc Đệ (2009), Giáo trình cây lúa, NXB Đại học Quốc Gia TP Hồ Chí Minh. [12]Nguyễn Văn Đĩnh,Trần Thị Liên (2006), "Phản ứng của các giống lúa mang gen chuẩn kháng đối với 3 quần thể rầy nâu (Nilarpavata lugens Stal) ở đồng bằng sông Hồng", TC Khoa học Kỹ thuật Nông nghiệp 4(4+5), tr. 17-21. 83 [13]Trần Đăng Hòa, Lê Văn Hai, Trương Thị Diệu Hạnh, Nguyễn Thị Thu Thủy,Trần Thị Lệ (2009), "Tính kháng rầy nâu (Nilaparvata lugens Stal) của các giống lúa địa phương ở các tỉnh miền Trung", TC Bảo vệ thực vật, tr. 34-38. [14]Nguyễn Đăng Hùng,Vũ Thị Thư (1993), Hóa sinh cây trồng nông nghiệp, NXB Nông Nghiệp Hà Nội. [15]Lưu Thị Ngọc Huyền, Vũ Đức Quang,Thiều Văn Đường (2003), "Định vị các gen kháng rầy nâu bph4 và bph6 trên nhiễm sắc thể lúa", TC Di truyền học và ứng dụng, số 2, [16]Nguyễn Thị Lan,Phạm Tiến Dũng (2006), Giáo trình phương pháp thí nghiệm, NXB Nông nghiệp Hà Nội. [17]Nguyễn Thị Lang (2005), Ứng dụng công nghệ sinh học trong chọn giống lúa chất lượng cao phục vụ cho tỉnh Tiền Giang 2003-2005, Viện lúa đồng bằng sông Cửu Long. [18]Nguyễn Thị Lang,Bùi Chí Bửu (2011), Phát triển giống lúa phẩm chất gạo tốt tiếp cận chiến lược mới, Trung tâm Khuyến nông Quốc gia, Bộ Nông nghiệp và Phát triển Nông thôn. [19]Nguyễn Hoàng Lộc, Lê Việt Dũng,Trần Quốc Dung (2007), Giáo trình Công nghệ DNA tái tổ hợp, NXB Đại học Quốc gia TP Hồ Chí Minh. [20]Nguyễn Văn Luật,Lương Minh Châu (2004), "Nghiên cứu quá trình biến đổi tính kháng rầy nâu của các giống lúa ở đồng bằng sông Cửu Long", Thông tin bảo vệ thực vật và phát triển nông thôn, 9, tr. 1180-1190. [21]Trần Văn Minh (2003), Giáo trình cây lương thực, NXB Nông Nghiệp Hà Nội. [22]Nguyễn Văn Mùi (2001), Thực hành hóa sinh học, NXB Đại học Quốc gia Hà Nội. [23]Nguyễn Thành Phước (2003), Đánh giá năng suất và phẩm chất của giống/dòng lúa Tép hành đột biến tại tỉnh Sóc Trăng, Luận văn Thạc sĩ Nông nghiệp, Trường Đại học Cần Thơ. [24]Phạm Văn Phượng, Hứa Minh Sang,Võ Công Thành (2011), "Nghiên cứu chọn tạo các giống lúa chất lượng cao cho vùng Đồng bằng sông Cửu Long ", TC Khoa học Đại học Cần Thơ, 19b, tr. 136-144. 84 [25]Sở Nông Nghiệp và Phát Triển Nông thôn Thừa Thiên Huế (2011), Thống kê tình hình sâu bệnh hại cây trồng 2009-2011, Thừa Thiên Huế. [26]Hoàng Minh Tấn, Nguyễn Quang Thạch,Võ Quang Sáng (2006), Giáo trình Sinh lý thực vật, Đại học Nông nghiệp I Hà Nội. [27]Nguyễn Văn Tú, Nguyễn Vũ Linh, Trương Trọng Ngôn,Trần Nhân Dũng (2011), "Thanh lọc các giống lúa mang gen kháng rầy nâu bằng dấu phân tử DNA", TC Khoa học Đại học Cần Thơ, 17a, tr. 272-281. [28]Lê Xuân Thái (2015), "Chọn giống lúa ngắn ngày, kháng rầy nâu cho Đồng bằng sông Cửu Long năm 2008-2013 ", TC Khoa học Đại học Cần Thơ, 36, tr. 49-56. [29]Võ Công Thành (2011), "Phục tráng giống nếp CK92 có chất lượng tốt ", TC Khoa học Đại học Cần Thơ, 9b, tr. 130-135 [30]Ủy ban nhân dân tỉnh Thừa Thiên Huế (2010), Điều tra cơ bản kinh tế-xã hội vùng đầm phá Thừa Thiên Huế, Thừa Thiên Huế. [31]Bùi Thị Kim Vi, Nguyễn Vũ Linh, Vũ Anh Pháp,Trần Nhân Dũng (2011), "Thanh lọc và phân tích di truyền các giống lúa kháng rầy nâu (Nilaparvata Lugens Stal.) ở thành phố Cần Thơ", TC Khoa học Đại học Cần Thơ 17a, tr. 263-271. [32]Viện lúa đồng bằng sông Cửu Long (2010), Báo cáo tổng kết hoạt động đơn vị năm 2009, Cần Thơ. 85 [33]Ahmed N., Maekawa M.,Tetlow I. J. (2008), "Effects of low temperature on grain filling, amylose content, and activity of starch biosynthesis enzymes in endosperm of basmati rice", Australian Journal of Agricultural Research, 59, pp. 599-604. [34]Akita S. (1989), "Improving yield potential in tropical rice.", Progress in irrigated Rice Research. IRRI. Philipphines., pp. 41-73. [35]Arnon D. (1949), Plant Physiology, 24, pp. 1 - 15. [36]Athwal D. S., Pathak M. D., Bacalangco E. H.,Pura C. D. (1971), "Genetics of resistance to brown planthopper and green leafhoppers in Oryza sativa L.", Crop Science, 11, pp. 747-750. [37]Bent A. F. (1996), "Plant disease resistance genes: function meets structure", Plant Cell, 8, pp. 1757-1771. [38]Bhogadhi S. J.,Bentur J. S. (2015), "Screening of Rice Genotypes for Resistance to Brown Plant Hopper Biotype 4 and Detection of BPH Resistance Genes ", International Journal of Life Sciences Biotechnology and Pharma Research, 4 (2), pp. 90-95. [39]Bing L., Hongxia D., Maoxin Z., Di X.,Jingshu W. ( 2007), "Potential resistance of tricin in rice against brown planthopper Nilaparvata lugens (Stal)", Acta Ecologica Sinica, 27, pp. 1300-1307. [40]Bradford M. M. (1976), "A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the priciple of protein-dye binding", Analytical Biochemistry, 72, pp. 248-254. [41]Brar D. S., Virk P. S., Jena K. K.,Khush G. S. (2009), " Breeding for resistance to planthoppers in rice", Planthoppers: new threats to the sustainability of intensive rice production systems in Asia, IRRI, 3, pp. 401-428. [42]Cabauatan P. Q., Cabunagan R. C.,I.R. C. (2009), "Rice viruses transmitted by the brown planthopper Nilaparvata lugens Stal", Planthoppers: new threats to the sustainability of intensive rice production systems in Asia, IRRI, 3, pp. 357- 368. 86 [43]Cagampang G. B., Pathak M. D.,Juliana O. B. (1974), "Metabolic changes in the rice plant during infestation by the brown planthopper, Nilaparvata lugens Stal (Atemiptera: Delphacidae)", Applied entomology and zoology, 9, pp. 174-184. [44]Cagampang G. B., Perez C. M.,Juliano B. O. (1973), "A gel consistency test for eating quality of rice", Journal of the Science of Food and Agriculture, 24, pp. 1589-1594. [45]Catindig J. L. A., Arida G. S., Baehak i. S. E., Bentur J. S., Cuong L. Q., Norowi M., Rattanakarn W., Sriratanasak W., Xia J.,Lu Z. (2009), "Situation of planthoppers in Asia", Planthoppers: new threats to the sustainability of intensive rice production systems in Asia, IRRI, 3, pp. 191-220. [46]Chang T. T.,Bardenas E. A. (1965), "The morphology and varietal characteristics of the rice plant ", Technical Bulletin, IRRI, 4, [47]Chen C. N.,Cheng C. C. (1979), "Ecological physiology of rice plants attacked by the brown planthopper", Proceeding of the Roc-Japan symposium on rice productivity, 3, pp. 135-146. [48]Deshmukh R., Singh A., Jain N., Anand S., Gacche R., Singh A., Gaikwad K., Sharma T., Mohapatra T.,Singh N. (2010), "Identification of candidate genes for grain numberin rice (Oryza sativa L.)", Functional and Integrative Genomics, 10, pp. 339-347. [49]Du B., Zhang W., Liu B., Hu J., Wei Z., Shi Z., He R., Zhu L., Chen R., Han B.,He G. (2009), "Identification and characterization of bph14, a gene conferring resistance to brown planthopper in rice", Proceedings of the National Academy of Sciences of the United States of America, 106 (52), pp. 22163- 22168. [50]Dupo A. L. B.,Barrion A. T. (2009), "Taxonomy and general biology of delphacid planthoppers in rice agroecosytems", Planthoppers: new threats to the sustainability of intensive rice production systems in Asia, IRRI, 3, pp. 191-220. [51]FAO (2010), " FAOSTATAT", FAO Statistics Division, (, 87 [52]Graham R. (2002), A Proposal for IRRI to Establish a Grain Quality and Nutrition Research Center IRRI Discussion Paper Series [53]Hao P., Liu C., Wang Y., Chen R., Tang M., Du B., Zhu L.,He G. (2008), "Herbivore-induced callose deposition on the sieve plates of rice: an important mechanism for host resistance", Plant Physiology, 146, pp. 1810-1820. [54]He J., Liu Y., Jiang L., Wu H., Kang H., Liu S., Chen L.,Liu C. (2013), "High- resolution mapping of brown planthopper (BPH) resistance gene Bph27(t) in rice (Oryza sativa L.)", Molecular Breeding, 31 (3), pp. 549-557. [55]Heong K. L., Tan K. H., Garcia C. P. F., Fabellar L. T.,Lu Z. (2011), Research Methods in Toxicology and Insecticide Resistance Monitoring of Rice Planthoppers, International Rice Research Institute, ISBN 978-971-22-0260-5. [56]Hoa H.,Meyers W. (2015), Rice demand in Vietnam: dietary changes and implications for policy, Southern Agricultural Economics Association. [57]Hu J., Li X., Wu C., Yang C., Hua X., Gao G., Xiao J.,He Y. (2010), "Pyramiding and evaluation of the brown planthopper resistance genes bph14 and bph15 in hybrid rice", Molecular Breeding, DOI: 10.1007/s11032-010-9526-x, [58]Hu J., Xiao C., Cheng M., Gao G., Zhang Q.,He Y. (2015), "Fine mapping and pyramiding of brown planthopper resistance genes QBph3 and QBph4 in an introgression line from wild rice O. officinalis", Molecular Breeding, doi:10. 1007/s11032-015-0228-2, [59]Hu J., Zhou J., Peng X., Xu H., Liu C., Du B., Yuan H., Zhu L.,G. H. (2011), "The bphi008a gene Interacts with the ethylene pathway and transcriptionally regulates MAPK genes in the response of rice to brown planthopper feeding", Plant Physiology, 156, pp. 856–872. [60]Huang D., Qiu Y., Zhang Y., Huang F., Meng J., Wei S., Li R.,Chen B. (2013), "Fine mapping and characterization of BPH27, a brown planthopper resistance gene from wild rice (Oryza rufipogon Griff.)", Theoretical and Applied Genetics, 126 (1), pp. 219-229. 88 [61]IRRI (2002), Standard evaluation system for rice, Genetic Resources Centre, Manila, Philippine, IRRI. [62]IRRI (2009), "Rice Knowledge Bank", ( [63]Jairin J., Sansen K., Wongboon W.,Kothcharerk J. (2010), "Detection of a brown planthopper resistance gene bph4 at the same chromosomal position of bph3 using two different genetic backgrounds of rice ", Breeding Science, 60, pp. 71- 75. [64]Jairin J., Teangdeerith S., Leelagud P., Phengrat K., Vanavichit A.,Toojinda A. (2007), "Physical mapping of bph3, a brown planthopper resistance locus in rice", Maejo International Journal of Science and Technology, 1 (2), pp. 166-177. [65]Jairin J., Teangdeerith S., Leelagud P., Phengrat K., Vanavichitb A.,Toojindab T. (2007), "Detection of brown planthopper resistance genes from different rice mapping populations in the same genomic location", ScienceAsia 33, pp. 347-352. [66]Jena K. K.,Kim S. M. (2010), "Current satus of brown planthopper (BPH) resistance and genetics", Rice, 3, pp. 161-171. [67]Kim S. M.,Sohn J. K. (2005), "Identification of a rice gene (bph1) conferring resistance to brown planthopper (Nilaparvata lugens Stal) using STS markers", Molecules and Cells, 20 (1), pp. 30-34. [68]KITAJIMA K.,HOGAN K. P. (2003), "Increases of chlorophyll a/b ratios during acclimation of tropical woody seedlings to nitrogen limitation and high light", Plant, Cell and Environment, 26, pp. 857-865. [69]Khush G. S.,Brar D. S. (1991), "Genetics of resistance to insects in crop plants", Advances in Agronomy, 45, pp. 223-274. [70]Lang N. T., Brar D. S., Khush G. S., Huang N.,Buu B. C. (1999), "Development of STS markers to indentify brown plant hopper resistance in a segregating population", Omonrice, 7, pp. 26-34. [71]Li J., Chen Q., Wang L., Liu J., Shanga K.,Hua H. (2011), "Biological effects of rice harbouring bph14 and bph15 on brown planthopper, Nilaparvata lugens", Pest Management Science, 67, pp. 528-534. 89 [72]Lindsay (1973), "A colorimetric estimation of reducing sugars in potatoes with 3,5-dinitrosalicylic acid", Potato Research, 16, pp. 176-179. [73]Little R. R., Hilder G. B.,Dawson E. H. (1958), "Differential effect of dilute alkali on 25 varieties of milled white rice", Cereal Chemistry, 35, pp. 111-126. [74]Loka Reddy K., Pasalu I. C., Sreenivasa Raju A.,Reddy D. D. R. (2004), "Biochemical basis of resistance in rice cultivars to brown planthopper Nilaparvata lugens (Stal)", Journal of Entomological Research, 28, pp. 79-85. [75]Maclean J., Hardy B.,Hettel G. P. (2002), Rice almanac-source book for the most important economic activity on earth, IRRI. [76]Matsumura M., Takeuchi H., Satoh M., Morimura S. S., Otuka A., Watanabe T.,Thanh D. V. (2009), "Current status of insecticide resistance in rice planthoppers in Asia", Planthoppers: new threats to the sustainability of intensive rice production systems in Asia, 3, pp. 233-244. [77]Mun J. H., Song Y. H., Heong K. L.,Roderick G. K. (1999), "Genetic variation among Asian populations of rice planthoppers, Nilaparvata lugens and Sogatella furcifera (Hemiptera: Delphacidae): mitochondrial DNA sequences", Bulletin of Entomological Research 89, pp. 245-253. [78]Myint K. K. M., Fujita D., Matsumura M., Sonoda T., Yoshimura A.,Yasui H. (2012), "Mapping and pyramiding of two major genes for resistance to the brown planthopper (Nilaparvata lugens [Stal]) in the rice cultivar ADR52", Theoretical and Applied Genetics 124 (3), pp. 495-504. [79]Mzengeza T. (2010), Genetic Studies of Grain and Morphological Traits in Early Generation Crosses of Malawi Rice (Oryza sativa L.) Landraces and NERICA Varieties, A thesis of Doctor of Philosophy in Plant Breeding, ACCI. [80]Ngoc K. T.,Buu B. C. (1999), "Quantitative genetic analysis on amylose content in rice (Oryza sativa L.)", Omonrice, 7, pp. 171-173. [81]Pathak M. D.,Khan Z. R. (1994), Insect Pests of Rice, International Rice Research Institute. 90 [82]Qiu H. M., Wu J. C., Yang G. Q., Dong B.,Li D. H. (2004), "Changes in the uptake function of the rice root to nitrogen, phosphorus and potassium under brown planthopper, Nilaparvata lugens (Stål) (Homoptera: Delphacidae) and pesticide stresses, and effect of pesticides on rice-grain filling in field", Crop Protection) 23, pp. 1041-1048. [83]Qiu Y., Cheng L., Zhou P., Liu F.,Li R. (2012), "Identification of Antixenosis and Antibiosis in Two Newly Explored Brown Planthopper-resistance Rice Lines ", Advance Journal of Food Science and Technology 4(5), pp. 299-303. [84]Redona E. D.,Mackill D. J. (1998), "Quantitative trait locus analysis for rice panicle and grain characteristics", Theoretical and Applied Genetics, 96, pp. 957-963. [85]Sadavisam,Manikam (1992), Biochemical methods for agricultural sciences, Wiley Eastern Ltd India. [86]Sai Harini A., Sai Kumar S., Padma B., Richa S., Ayyappa Dass M.,Vinay S. (2013), "Evaluation of rice genotypes for brown planthopper (BPH) resistance using molecular markers and phenotypic methods ", African Journal of Biotechnology, 12 (19), pp. 2515-2525. [87]Saxena R. C.,Barrion C. C. (1983), "Biotypes of the brown planthopper, Nilaparvata lugens Stal", Korean Journal of Plant Protection 22 (2), pp. 52-66. [88]Shabanimofrad M., Yusop M., Musa M., Adam N. A., Haifa I., Harun A. R.,Latif M. A. (2015), "Marker-assisted selection for rice brown planthopper (Nilaparvata lugens) resistance using linked SSR markers", Turkish Journal of Biology, 39, pp. 666-673. [89]Sharma P. N., Mori N., Takumi S.,Nakamura C. (2014), "Conventional and Molecular Studies of Brown Planthopper (Nilaparvata lugens Stal) Resistance Genes in Rice: A Basis for Future Study of Natural Insect Resistance Genes Using Molecular Markers in Nepal", Nepal Journal of Science and Technology 15 (1), pp. 145-156. 91 [90]Sharma P. N., Torii A., Takumi S., Mori N.,Nakamura C. (2004), "Marker- assisted pyramiding of brown planthopper (Nilaparvata lugens Stal) resistance genes bph1 and bph2 on rice chromosome 12", Hereditas, 140 (1), pp. 61-69. [91]Shilpa J. B.,Krishnan S. (2010), "Grain quality evaluation of traditionally cultivated rice varieties of Goa, India", Recent Reseach Sciences Technology, 2 (6), pp. 88-97. [92]Siddiqui S. U., Kumamaru T.,Satoh H. (2010), "Pakistan rice genetic resources- III: SDS-PAGE diversity profile of glutelins (seed storage protein)", Pakistan Journal of Botany, 42 (4), pp. 2523-2530. [93]Stevenson P. C., Kimmins F. M., Grayer R. J.,Raveendranath S. (1996), "Schaftosides from rice phloem as feeding inhibitors and resistance factors to brown planthopper, Nilaparvata lugens", Entomologia Experimentalis et Applicata, 80, pp. 246-249. [94]Tanaka K.,Matsumura M. (2000), "Development of virulence to resistant rice varieties in the brown planthopper, Nilaparvata lugens (Homoptera: Delphacidae), immigrating into Japan", Applied Entomology and Zoology, 35, pp. 529 - 533. [95]Timsina J., Buresh R. J., Dobermann A.,Dixon J. (2011), Rice-maize systems in Asia:current situation and potential, IRRI. [96]Thanh V. C.,Hirata Y. (2002), "Seed storage diversity of three rice species in Mekong Delta", Biosphere Conservation, 5 (1), pp. 11-17. [97]Tran A. N., Venea D. D.,Melissa F. (2010), "A single nucleotide polymorphism on the Waxy gene explains gel consistency", Presented at the 28th International Rice Research Conference, IRRI, [98]Wang Y., Wang X., Yuan H., Chen R., Zhu L., He R.,He G. (2008), "Responses of two contrasting genotypes of rice to brown planthopper ", Molecular Plant- Microbe Interactions, 21 (1), pp. 122-132. 92 [99]Wang Z. Y., Zheng F. Q., Shen G. Z., Gao J. P., Snusted D. P., Li M. G., Zhang J. L.,Hong M. M. (1995), "The amylose content in rice endosperm is related to the post-transcriptional regulation of the waxy gene", Plant Journal, 7 (4), pp. 613-622. [100]Wei Z., Hu W., Lin Q., Cheng X., Tong M., Zhu L., Chen R.,He G. (2009), "Understanding rice plant resistance to the brown planthopper (Nilaparvata lugens): A proteomic approach", Proteomics, 9 (10), pp. 2798-2808. [101]Wopereis M. C. S., Defoer T., Idinoba P., Diack S.,Dugué M. J. (2009), Participatory Learning and Action Research (PLAR) for Integrated Rice Management (IRM) in Inland Valleys of Sub-Saharan Africa: Technical Manual. , WARDA Training Series. Cotonou, Benin: Africa Rice Center. Africa Rice Center (WARDA). 128 pp. [102]Wu H., Liu Y., He J., Liu Y., Jiang L., Liu L., Wang C., Cheng X.,Wan J. (2014), "Fine mapping of brown planthopper ( Nilaparvata lugens Stall) resistance gene Bph28(t) in rice ( Oryza sativa L.)", Molecular Breeding, 33 (4), pp. 909-918. [103]Wu Z. (2007), "A chlorophyll-deficient rice mutant with impaired chlorophyllide esterification in chlorophyll biosynthesis", Plant Physiology, 145, pp. 29-40. [104]Xa T. T. T.,Lang N. T. (2011), "Rice breeding for high grain quality through anther culture ", Omonrice, 18, pp. 68-72. [105]Yongfu Q., Jianping G., Shengli J., Lili Z.,Guangcun H. (2014), "Fine mapping of the rice brown planthopper resistance gene BPH7 and characterization of its resistance in the 93-11 background", Euphytica, 198 (3), pp. 369-375. [106]Yoshida S. (1981), Fundamentals of rice crop science IRRI. [107]Zhang F. T., Zhu L. L.,He G. C. (2004), "Differential gene expression in response to brown planthopper feeding in rice", Journal of Plant Physiology, 161, pp. 53-62. 93 MỤC LỤC MỞ ĐẦU .................................................................................................................... 6 1. Tính cấp thiết của đề tài ...................................................................................... 6 2. Mục tiêu nghiên cứu ............................................................................................ 7 3. Ý nghĩa khoa học và thực tiễn ............................................................................. 7 4. Phạm vi nghiên cứu ............................................................................................. 7 Chương 1. TỔNG QUAN TÀI LIỆU ...................................................................... 8 1.1. Giới thiệu về lúa gạo ........................................................................................ 8 1.1.1. Đặc điểm của cây lúa ................................................................................. 8 1.1.2. Giá trị của lúa gạo ...................................................................................... 8 1.1.3. Tình hình sản xuất lúa gạo ở Thừa Thiên Huế ........................................ 10 1.2. Đặc điểm sinh lý của cây lúa .......................................................................... 10 1.2.1. Các giai đoạn sinh trưởng, phát triển của cây lúa .................................... 10 1.2.2. Hoạt động sinh lý của cây lúa .................................................................. 14 1.2.3. Các thành phần năng suất lúa .................................................................. 17 1.2.4. Ảnh hưởng của một số điều kiện sinh thái đến sinh trưởng, phát triển của cây lúa ................................................................................................................ 17 1.3. Đặc điểm hình thái, đặc tính hóa sinh của hạt gạo ......................................... 18 1.3.1. Đặc điểm hình thái hạt gạo ...................................................................... 18 1.3.2. Đặc tính hóa sinh hạt gạo......................................................................... 19 1.4. Rầy nâu gây hại và khả năng kháng rầy nâu của cây lúa ............................... 22 1.4.1. Giới thiệu về rầy nâu ............................................................................... 22 1.4.2. Biotype rầy nâu ........................................................................................ 22 1.4.3. Cơ chế kháng rầy nâu của cây lúa ........................................................... 23 1.4.4. Gen kháng rầy nâu ở cây lúa ................................................................... 25 1.5. Nghiên cứu về cây lúa kháng rầy nâu ở Việt Nam......................................... 27 1.5.1. Tình hình gây hại của rầy nâu đối với sản xuất lúa ở nước ta ................. 27 1.5.2. Tình hình nghiên cứu về cây lúa kháng rầy nâu ...................................... 27 Chương 2. NGUYÊN LIỆU, NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU ... 29 2.1. Nguyên liệu nghiên cứu.................................................................................. 29 94 2.1.1. Các giống lúa ........................................................................................... 29 2.1.2. Rầy nâu .................................................................................................... 29 2.2. Nội dung nghiên cứu ...................................................................................... 29 2.3. Phương pháp nghiên cứu ................................................................................ 30 2.3.1. Bố trí thí nghiệm ...................................................................................... 30 2.3.2. Phương pháp xác định các chỉ tiêu nông sinh học ................................... 30 2.3.3. Phương pháp đánh giá chất lượng gạo .................................................... 34 2.3.4. Phương pháp đánh giá tính kháng rầy nâu .............................................. 37 2.3.5. Phương pháp sinh học phân tử ................................................................ 38 2.3.6. Xử lý thống kê ......................................................................................... 40 Chương 3. KẾT QUẢ NGHIÊN CỨU VÀ THẢO LUẬN .................................. 40 3.1. Đặc điểm nông sinh học của các giống lúa .................................................... 40 3.1.1. Thời gian sinh trưởng và phát triển ......................................................... 41 3.1.2. Tỷ lệ nảy mầm ......................................................................................... 45 3.1.3. Số nhánh .................................................................................................. 45 3.1.4. Diện tích lá đòng ...................................................................................... 45 3.1.5. Chiều dài bông ......................................................................................... 45 3.1.6. Chiều cao cây ........................................................................................... 46 3.1.7. Hàm lượng diệp lục và cường độ quang hợp .......................................... 46 3.2. Năng suất của các giống lúa ........................................................................... 50 3.2.1.Các yếu tố hình thành năng suất và năng suất .......................................... 50 3.2.2. Phân tích mối liên quan giữa năng suất và các chỉ tiêu nông sinh học ... 55 3.3. Chất lượng hạt gạo của các giống lúa ............................................................ 57 3.3.1. Hàm lượng protein ................................................................................... 57 3.3.2. Hàm lượng tinh bột .................................................................................. 57 3.3.3. Hàm lượng amylose ................................................................................. 57 3.3.4. Hàm lượng lipid ....................................................................................... 58 3.3.5. Độ trở hồ và độ trải gel ............................................................................ 58 3.3.6. Hình dạng và độ bạc bụng của hạt ........................................................... 59 3.4. Đánh giá tính kháng rầy nâu của các giống lúa .............................................. 63 3.4.1. Đánh giá tính kháng rầy trong nhà lưới và ngoài đồng ruộng ................. 63 95 3.4.2. Đặc điểm sinh học phân tử liên quan đến khả năng kháng rầy ............... 70 KẾT LUẬN VÀ ĐỀ NGHỊ ..................................................................................... 79 NHỮNG CÔNG TRÌNH ĐÃ ĐƯỢC CÔNG BỐ CÓ LIÊN QUAN ĐẾN LUẬN ÁN ............................................................................................................................. 81 TÀI LIỆU THAM KHẢO ...................................................................................... 81 PHỤ LỤC 96 DANH MỤC BẢNG Bảng 1.1. Thành phần hóa học của lúa gạo so với một số loại cây lương thực khác ...... 19 Bảng 2.1. Các giống lúa nghiên cứu ......................................................................... 29 Bảng 2.2. Các giai đoạn sinh trưởng của cây lúa ...................................................... 30 Bảng 2.3. Phân loại gạo dựa vào độ trở hồ ............................................................... 36 Bảng 2.4. Phân loại chiều dài và hình dạng hạt gạo ................................................. 37 Bảng 2.5. Bảng phân cấp hại, triệu chứng của cây mạ và mức độ kháng rầy nâu trong nhà lưới...................................................................................................................... 37 Bảng 2.6. Trình tự các cặp mồi và kích thước đoạn DNA được khuếch đại ............ 38 Bảng 3.1. Thời gian sinh trưởng của các giống lúa .................................................. 43 Bảng 3.2. Đặc điểm sinh trưởng và phát triển của các giống lúa ............................ 48 Bảng 3.3. Hàm lượng diệp lục và cường độ quang hợp của các giống lúa .............. 48 Bảng 3.4. Yếu tố hình thành năng suất của các giống lúa ...................................... 53 Bảng 3.4. Yếu tố hình thành năng suất của các giống lúa (tiếp theo) ...................... 54 Bảng 3.5. Ảnh hưởng của giống và mùa vụ đối với các chỉ tiêu nông sinh học....... 55 Bảng 3.6. Mô hình các yếu tố sinh học ảnh hưởng đến năng suất ............................ 56 Bảng 3.7. Chỉ tiêu chất lượng gạo của các giống lúa ................................................ 61 Bảng 3.8. Ảnh hưởng của giống và mùa vụ đối với chỉ tiêu chất lượng hạt gạo ...... 62 Bảng 3.9. Cấp gây hại của rầy nâu trên các giống lúa nghiên cứu ........................... 63 Bảng 3.10. Mức độ nhiễm rầy nâu của các giống lúa ngoài đồng ruộng .................. 65 Bảng 3.10. Mức độ nhiễm rầy nâu của các giống lúa ngoài đồng ruộng (tiếp tục) .. 66 Bảng 3.11. Ảnh hưởng của giống và mùa vụ đối với khả năng kháng rầy ............... 69 Bảng 3.12. Mô hình tối ưu ảnh hưởng của thời gian nhiễm bệnh năng suất lúa ...... 70 97 DANH MỤC HÌNH Hình 1.1. Quá trình sinh trưởng của một số giống lúa 120 ngày (Nguồn Yoshida, 1981) .... 11 Hình 1.2. Vị trí của các gen kháng rầy nâu trên bộ NST của cây lúa (Nguồn Jena, 2010) ... 26 Hình 2.1. Sơ đồ bố trí thí nghiệm ............................................................................ 30 Hình 2.2. Sơ đồ vị trí các cặp mồi trên gen bph14 ................................................... 39 Hình 3.1. Các giống lúa thí nghiệm tại hợp tác xã An Đông-Thừa Thiên Huế ........ 41 Hình 3.2. Diễn biến của các yếu tố thời tiết qua các vụ lúa ...................................... 44 Hình 3.3. Biểu đồ so sánh năng suất thực thu giữa vụ Hè Thu và Đông Xuân ........ 52 Hình 3.4. Chiều dài gel của các giống lúa ................................................................ 59 Hình 3.5. Biểu đồ diễn biến mật độ rầy nâu trên các giống lúa vụ Hè Thu .............. 68 Hình 3.6. Biểu đồ diễn biến mật độ rầy nâu trên các giống lúa vụ Đông Xuân ....... 68 Hình 3.7. Kết quả điện di sản phẩm PCR với cặp mồi BpE18-3 .............................. 71 Hình 3.8. So sánh trình tự nucleotide của chỉ thị BpE18-3 với BpE18-3-L1 ........... 72 Hình 3.9. Kết quả điện di sản phẩm PCR với cặp mồi RM589 ................................ 73 Hình 3.10. So sánh trình tự nucleotide của chỉ thị RM589 với RM589-L3 ............. 74 Hình 3.11. Kết quả điện di sản phẩm PCR với cặp mồi RM586 .............................. 75 Hình 3.12. So sánh trình tự nucleotide của chỉ thị RM586 với RM586-L25 ........... 75 Hình 3.13. Kết quả điện di sản phẩm PCR với cặp mồi RG457FL/RL .................... 76 Hình 3.14. Kết quả điện di sản phẩm PCR được cắt bằng enzyme HinfI ................. 76 Hình 3.15. Kết quả điện di sản phẩm PCR với 4 cặp mồi M1-M4 ........................... 78 Hình 3.16. Chiều dài gen bph14-25 .......................................................................... 79 98 PHỤ LỤC 1 Phụ lục 1: Thông tin giống lúa nghiên cứu Số đăng ký Tên giống Ngày gieo Ngày cấy 0BSố ngày từ gieo -chín Địa điểm nơi mô tả, đánh giá Cao mạ Dài bông (cm) Rộng lá Trọng lượng 100 hạt ( g ) 1BTỷ lệ dài/rộng hạt L1.2392 IRRI 352 24/6/2005 17/7/2005 2B119 An Khánh - Hoài Đức - Hà Tây 3B26,50 4B19,00 5B1,80 6B2,30 L25.2447 Sài đường Kiến An 28/6/2004 22/7/2004 7B116 An Khánh - Hoài Đức - Hà Tây 8B46,20 9B29,40 10B ,00 1B3,10 L27.2455 Lốc nước 28/6/2004 25/7/2004 12B 14 An Khánh - Hoài Đức - Hà Tây 13B42,40 14B25,20 15B ,08 16B2,60 17B2,92 L3.6134 BG 367-2 30/9/2001 14/10/2001 18B 05 Nha Hố - Ninh Phước - Ninh Thuận 19B 6,60 20B 0,60 21B ,48 2B ,22 1 Phụ lục 2: Hình ảnh thí nghiệm Hình P1. Giống lúa nghiên cứu Hình P2. Giống lúa L25 được trồng khảo nghiệm trên diện tích lớn 2 Hình P3. Hạt của giống lúa L25 Hình P4. Đánh giá tính kháng rầy nâu theo phương pháp ống nghiệm và hộp mạ 3 Hình P5. Lây nhiễm rầy nâu theo phương pháp ống nghiệm Hình P6. Hình thái cây lúa bị nhiễm rầy nâu ngoài đồng ruộng 4 Hình P7. Xác định chiều dài rộng hạt gạo bằng thước kẹp Hình P8. Kết quả tách chiết DNA tổng số của các giống lúa Hình P9. DNA plasmid pTZ57R/T mang sản phẩm PCR BpE18-3 Hình P10. Vector pTZ57R/T 1 Hình P11. Trình tự nucleotide của chỉ thị BpE18-3 >lcl|53347 Length=518 2 Score = 818 bits (906), Expect = 0.0 Identities = 499/523 (95%), Gaps = 5/523 (1%) Strand=Plus/Plus Query 1 CGCTGCGAGAGTGTGACACTTCTTTGTAGGTTTATCGTGAAAACCTTCCGTTTTGCCTAC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CGCTGCGAGAGTGTGACACTTCTTTGTAGGTTTATCGTGAAAACCTTCCGTTTTGCCTAC 60 Query 61 GAGATGGGTAGTTATCTAGAATCGGCTCCGCTAGCCGGTTTAGTTATCAAAACCCATCTT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GAGATGGGTAGTTATCTAGAATCGGCTCCGCTAGCCGGTTTAGTTATCAAAACCCATCTT 120 Query 121 GGTTTAGCTTTTGCCAGATTGAGGTGGTTGGCGACTCTAAGATCACCATAAGACGTTTAG 180 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 GGTTTAGCTTTTGCTAGATTGAGGTGGTTGGCGACTCTAAGATCACCATAAGACGTTTAG 180 Query 181 GTGTTGCGATCATGCTTGTCAACTTGTCACAAAAAGTTATCAACACCTTCGCCGGAGACT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 GTGTTGCGATCATGCTTGTCAACTTGTCACAAAAAGTTATCAACACCTTCGCCGGAGACT 240 Query 241 AACTAGCGGCGTGCTGGCGCTCGACGGCGGACAAGCTCTCGCGGGCTGCAGCTTCATGTA 300 | |||||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||| Sbjct 241 AGCTAGCGGCGTGCTGGCGCTCGACGGC-GACAAGCCCTCGC-GGCTGCAGCTTCATGTA 298 Query 301 TTGTCGACTTGGTGTGGCTTCCCAAGGCCATGTCCCTGCGCTCGACGAAGCGGCATTCCG 360 ||||||||||| |||||||||||| |||||||||||||||||||||| ||||||| |||| Sbjct 299 TTGTCGACTTGTTGTGGCTTCCCAGGGCCATGTCCCTGCGCTCGACG-AGCGGCA-TCCG 356 Query 361 CAGTTCCAGTCTCCAGATGGCATCAAAGTGGCGTCACGCGATTCTTATGCATTGCCAATT 420 ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 357 CAGCTCCAGTCTCCAGATGGCATC-AAGTGGCGTCACGCGATTCTTATGCATTGCCAATT 415 Query 421 TGCCATGGGTGTGTCTGCATTTTTGGTTCTTCTATGCAGAAGTGGAAAACCACTGGCACG 480 |||||||| ||| |||||||||||| |||| ||||||||| |||||| || | | |||| Sbjct 416 TGCCATGGTTGTTTCTGCATTTTTGTTTCTCCTATGCAGAGGTGGAAGACGATGGCCACG 475 Query 481 GGCGGGCCACCCCGGTTCAACCCGTCAAACCCGTGTAACCCAA 523 | ||||||||| ||||||| ||||||||||||||||||||||| Sbjct 476 GCCGGGCCACCACGGTTCAGCCCGTCAAACCCGTGTAACCCAA 518 Hình P12. Trình tự nucleotide của chỉ thị BpE18-3 3 4 5 6 7 Hình P13. Trình tự nucleotidecủa gen bph14-25 Phụ lục 3: Một số kết quả xử lý thống kê mohinh<-read.csv("~/Desktop/OneDrive - 佐賀大学(edu)/Thanh Mai/Cho LV-Mai/Data-using/twoway.csv",header=TRUE) names(mohinh) summary(lm(production.HT~A.HT+P.HT+Chla.HT+Chlb.HT+Chlab.HT+FA.HT+ T.HT+spikeletlength.HT+spiplantHT+spiarea.HT+seedplant.HT)) Call: 8 lm(formula = production.HT ~ A.HT + P.HT + Chla.HT + Chlb.HT + Chlab.HT + FA.HT + T.HT + spikeletlength.HT + spiplantHT + spiarea.HT + seedplant.HT) Residuals: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 0.4885 -0.6381 0.3546 0.3590 0.9372 -0.2922 0.2825 -1.6394 0.7651 -0.7414 -0.6256 1.6143 0.4955 -1.8239 0.4639 Coefficients: Estimate Std. Error t value Pr(>|t|) (Intercept) 71.17367 47.78100 1.490 0.2331 A.HT 0.99034 0.31783 3.116 0.0526 . P.HT 0.68503 0.73522 0.932 0.4202 Chla.HT 33.01841 10.87201 3.037 0.0560 . Chlb.HT -84.31559 31.48893 -2.678 0.0752 . Chlab.HT -60.34150 20.69867 -2.915 0.0617 . FA.HT 4.03084 1.24335 3.242 0.0478 * T.HT -2.13910 1.01887 -2.099 0.1266 spikeletlength.HT -0.98815 0.94612 -1.044 0.3730 spiplantHT -188.59883 61.63285 -3.060 0.0550 . spiarea.HT 2.06182 0.63832 3.230 0.0482 * seedplant.HT -0.05732 0.10386 -0.552 0.6195 --- Signif. codes: 0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1 Residual standard error: 2.045 on 3 degrees of freedom (15 observations deleted due to missingness) Multiple R-squared: 0.9321, Adjusted R-squared: 0.683 F-statistic: 3.743 on 11 and 3 DF, p-value: 0.1523 > summary(lm(production.HT~FA.HT+spiarea.HT)) Call: lm(formula = production.HT ~ FA.HT + spiarea.HT) Residuals: Min 1Q Median 3Q Max -4.8371 -2.3376 -0.2822 1.9816 5.0822 Coefficients: Estimate Std. Error t value Pr(>|t|) (Intercept) 33.16294 13.49120 2.458 0.0301 * FA.HT 0.08921 0.54950 0.162 0.8737 spiarea.HT 0.07724 0.03510 2.201 0.0481 * --- Signif. codes: 0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1 Residual standard error: 3.259 on 12 degrees of freedom (15 observations deleted due to missingness) Multiple R-squared: 0.3102, Adjusted R-squared: 0.1953 9 F-statistic: 2.699 on 2 and 12 DF, p-value: 0.1077 > summary(lm(production.HT~spiarea.HT)) Call: lm(formula = production.HT ~ spiarea.HT) Residuals: Min 1Q Median 3Q Max -4.8310 -2.3834 -0.2834 1.8237 5.0039 Coefficients: Estimate Std. Error t value Pr(>|t|) (Intercept) 34.55266 10.02953 3.445 0.00435 ** spiarea.HT 0.07504 0.03114 2.409 0.03152 * --- Signif. codes: 0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1 Residual standard error: 3.135 on 13 degrees of freedom (15 observations deleted due to missingness) Multiple R-squared: 0.3087, Adjusted R-squared: 0.2555 F-statistic: 5.806 on 1 and 13 DF, p-value: 0.03152 10 Phụ lục 4: Diễn biến thời tiết khí hậu ở Thừa Thiên Huế từ tháng 1/2010 đến tháng 12/2011 g, Nhiệt độ (0C) Ẩm độ (%) Mưa Nắng (giờ) Nhận xét tình hình khí tượng thuỷ văn trong Ttb Tmax Tmin Utb Umin Ngày R (mm) (2) (3) (4) (5) (6) (7) (8) (9) (10) 0 21,0 28,7 15,6 93 64 17 111,5 85 Ảnh hưởng của 4 đợt KKL và KKL tăng cường nên đã c nhiều nơi 0 23,2 35,5 14,5 90 47 7 12,7 147 Ảnh hưởng 2 đợt của rìa tây nam lưỡi áp cao lạnh tăng c cường yếu nên có mưa, mưa rào rải rác, trời rét. Thời kỳ nắng nóng trên diện rộng, sớm hơn mọi năm. 0 23,7 36,2 15,0 84 41 9 89,3 170 Ảnh hưởng của 4 đợt KKL và KKL tăng cường . Ngoài r hưởng của 2 đợt gió tây khô nóng, với 3 ngày nắng nóng trong đó có ngày nắng nóng gay gắt 0 26,1 38,1 20,0 87 53 4 52,3 139 Có 4 đợt KK lạnh và 3 đợt nắng nóng trên diện rộng, có gay gắt. Nhiệt độ cao hơn, lượng mưa thấp hơn TBNN 0 29,3 38,7 22,7 79 43 6 68,1 252 Xuất hiện 4 đợt gió tây khô nóng gay gắt trên diện rộng. cao, lượng mưa thấp đã gây khô hạn cho một số vùng. 0 29,4 38,2 23,7 78 47 11 139,3 264 Xuất hiện 5 đợt gió tây khô nóng và khô nóng gay gắt trê Nền nhiệt độ cao, lượng mưa thấp đã gây ra khô hạn cho 0 28,8 38,1 24,0 79 42 12 231,3 251 Xuất hiện 3 đợt nắng nóng và nắng nóng gay gắt. Thời k hưởng của cơn bão số 1 nên đã có mưa, mưa vừa 0 27,4 35,0 23,5 88 55 18 648,8 189 Đặc điểm của thời tiết trong tháng 8/2010 có nền nhiệt đ mưa và lượng mưa cao hơn TBNN. Thời kỳ cuối chịu ảnh hưởng của cơn bão số 3 vào ngày gây ra 03 đợt mưa vừa, mưa to đến rất to trên diện rộng. 0 27,4 35,5 23,3 86 52 16 177,4 198 Thời kỳ cuối do ảnh hưởng kết hợp với gió đông và rãnh ra 1 đợt mưa vừa, mưa to có nơi mưa rất to 0 24,8 32,9 19,3 92 59 24 1129,9 90 Thời kỳ đầu và giữa chịu ảnh hưởng rãnh áp thấp và dải có trục qua Trung Bộ kết hợp trường gió đông mạnh. Th hưởng KKL mạnh với gió đông bắc mạnh. Có 4 đợt mưa nơi mưa rất to và giông 0 22,6 28,7 18,8 93 66 23 829,7 54 Ảnh hưởng của KKL kết hợp với gió đông gây ra 3 đợt m to. Ngày 14 đến 17/11 đã có một đợt lũ tương đối lớn 0 21.3 30.5 14.3 92 63 15 107.5 122 Ảnh hưởng 4 đợt KKL tăng cường gây ra 3 đợt: mưa vừ mưa rất to trên diện rộng. 1 17.1 27.6 12.7 96 72 30 361.2 14 Ảnh hưởng7 đợt KKL tăng cường, gây ra 2 đợt mưa vừa gây ra rét, rét đậm kéo dài 24-25 ngày, có 4 ngày rét hại. 1 19.5 31.6 13.5 92 52 7 14.3 101 Ảnh hưởng 2 đợt KKL tăng cường yếu nên có mưa, mưa nhỏ r lượng mưa đạt thấp, thời tiết ấm dần, số ngày rét ít (chủ yếu đêm 1 18.9 31.4 13.3 93 68 18 167.4 80 Ảnh hưởng của 5 đợt KKL tăng cường nên đã gây mưa và có trời rét, vùng núi rét đậm; nền nhiệt độ thấp nhất trong chuỗi s 1 23.9 34.1 21.1 90 63 9 72,9 149 Ảnh hưởng của 1 đợt không khí lạnh tăng cường (16-20/ ngày có mưa, mưa rào, mưa dông rải rác, có ngày mưa v Các ngày còn lại ảnh hưởng của rìa phía nam rãnh áp thấ mưa cả tháng tương đối khá và nền nhiệt độ thấp. 1 28 35 20 87.5 47.5 16 90 175 Ảnh hưởng phía nam của rảnh áp thấp bị nén bởi cao lục Sau đó ảnh hưởng rìa phía đông nam và áp thấp phía tây vậy sẽ có 1-2 đợt mưa vừa, mưa to và dông trên diện rộn dông có gió tố lốc mạnh; xen kẻ các đợt nắng nóng. 1 28.8 36.6 23.4 81 39 8 87.9 218 Ảnh hưởng của rãnh áp thấp có trục qua Bắc Bộ và rìa đ nóng phía tây nên đã có 4 – 5 ngày khô nóng, lượng mưa và thấp hơn trung bình nhiều năm. Tuy có 2 cơn bão và hiện trên biển đông nhưng không ảnh hưởng đến khu vự 11 1 29.0 37.7 22.7 77 48 7 16.0 216 Ảnh hưởng của rãnh áp thấp có trục đi qua Bắc Bộ và rìa thấp nóng phía tây, do vậy ngay 11-14 có nóng khô, thời hiện con bão số 3, ảnh hưởng trực tiếp đến khu vực Bắc Thừa Thiên Huế có mưa, mưa rào rải rác, lượng mưa khô 1 29.0 34.5 25.5 77.5 45.5 14 175 210 Ảnh hưởng chủ yếu của vùng áp thấp nóng phía tây, gió hội tụ nhiệt đới qua trục Bắc Trung Bộ, do vậy trong thá nắng nóng. Vào cuối kỳ có 1-2 đợt mưa vừa và mưa to. 1 26,7 37,7 21,6 90 41 23 741,5 106 Ảnh hưởng của rãnh áp thấp có trục đi qua Bắc Trung B mưa rào rải rác, thời kỳ cuối chịu ảnh hưởng của cơn bão mưa vừa, mưa to, có ngày mưa rất to và dông. 1 24,7 31,4 20,4 93 72 27 1259,5 86 Tháng 10/2011, thời tiết tại tỉnh Thừa Thiên Huế do chịu KKL tăng cường kết hợp đới gió đông trên cao và dải hộ trục đi qua Trung Trung Bộ, nên từ ngày 1-5/10, 09/10, 28/10 đã có mưa, rải rác mưa vừa, mưa to, có ngày mưa 1 23,6 29,7 18,3 93 60 21 842,4 100 Ảnh hưởng của 3 đợt không khí lạnh (KKL) tăng cường đới gió đông và rãnh áp thấp có trục qua Trung Trung Bộ thấp nhiệt đới nên có 4 đợt mưa to, đến rất to. 1 18,7 25,5 14,6 96 73 28 709,5 9 Tháng 12/2011, tại khu vực chịu ảnh hưởng của 5 đợt kh (KKL) tăng cường kết hợp đới gió đông, nên đã có 2 đợt to, có nơi mưa rất to. Do KKL tăng cường liên tục và mạ nhiệt độ trong tháng thấp, lượng mưa lớn.

Các file đính kèm theo tài liệu này:

  • pdfnghiencuukhanangkhangraynau_9858.pdf
Luận văn liên quan