Luận án Nghiên cứu khả năng phân hủy một số thành phần Hydrocarbon có trong nước thải nhiễm dầu của màng sinh học từ vi sinh vật được gắn trên vật liệu mang

1. Hỗn hợp chủng vi sinh vật hình thành biofilm tốt nhất trên vật liệu mang xơ dừa với mật độ vi sinh đạt 3,9*1012 CFU/cm3 sau 36h, trên các vật liệu sỏi nhẹ, cellulose và mút xốp mật độ vi sinh lần lượt đạt 2,1*1012, 4,25*109 và 1,65*1010 CFU/cm3 sau 36h. 2. Biofilm vi sinh vật trên vật liệu mang xơ dừa có khả năng phân hủy 99,8% lượng dầu tổng số, 85,56% phenol và trên 96% các thành phần PAH sau 7 ngày ở mô hình 50 lít. Trên các vật liệu mang sỏi nhẹ, cellulose và mút xốp, biofilm vi sinh vật cho khả năng xử lý thấp hơn trên vật liệu mang xơ dừa, ở mức từ 91,26 - 95,54% hàm lượng dầu tổng số, 72,77-78,68% phenol và trên 69% đối với các thành phần PAH. 3. Trên hệ thống xử lý xử lý 300 lít/mẻ biofilm vi sinh vật cho hiệu quả xử lý 99,76% hàm lượng dầu tổng số và trên 85% các thành phần phenol và PAH trong nước nhiễm dầu sau 14 ngày xử lý. 4. Trên hệ thống xử lý liên tục 300 lít/ngày, biofilm vi sinh vật cho hiệu quả xử lý đạt trên 97% đối với các thành phần n-alkane C10, C11, C14-18, 100% các thành phần C9, C12, C13, C19 và C20, 100% các thành phần phenol và PAH, 98,9% các hydrocarbon no, 95,03% các hydrocarbon thơm, 95% nhựa và aspaten. 5. Trên hệ thống xử lý 20 m3/mẻ, biofilm vi sinh vật cho hiệu quả xử lý đạt 99,94% hàm lượng dầu tổng số, 99,97% phenol và trên 94% các thành phần PAH. Kết quả nước thải đầu ra đạt QCVN 40:2011/BTNMT tiêu chuẩn B. 6. Con đường giả định về sự phân hủy sec-hexylbenzene của chủng nấm men Trichosporon asahii B1 thông qua các sản phẩm trung gian bao gồm benzoic acid, 2-phenylpropionic acid, 3-phenylbutyric acid, 5-phenylhexanoic acid, ß- methylcinnamic acid, acephenone và 2,3 dihydroxybenzoic.

pdf129 trang | Chia sẻ: huydang97 | Ngày: 27/12/2022 | Lượt xem: 28 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận án Nghiên cứu khả năng phân hủy một số thành phần Hydrocarbon có trong nước thải nhiễm dầu của màng sinh học từ vi sinh vật được gắn trên vật liệu mang, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
9,9% acenaphthene và fluorene sau 14 ngày nuôi cấy với nồng độ PAH bổ sung ban đầu là 50 mg/l [139]. Ở Việt Nam, các nghiên cứu cho thấy các chủng vi sinh vật có khả năng phân hủy các thành phần PAH cũng rất đa dạng, các chủng vi khuẩn XL3.1, XL6.2 và XL22.1 cho thấy khả năng phân hủy trên 95% xylene sau 24h với nồng độ ban đầu là 0,125% v/v [85]. Chủng vi khuẩn Pseudomonas sp. BDNR1 phân lập tại Quảng Ninh có khả năng phân hủy tốt thành các thành phần PAH trong dầu, hiệu suất phân hủy 86% đối với pyrene và 14% đối với chrysen với nồng độ ban đầu 100 mg/l [132]. Kết quả trong nghiên cứu trong luận án cho thấy nồng độ các hợp chất PAH trong nước thải cũng nằm trong ngưỡng sinh trưởng, phát triển tốt của các chủng vi sinh vật đã được công bố, tuy nhiên biofilm vi sinh vật cho thấy khả năng phân hủy các thành phần PAH trong thời gian ngắn hơn so với các công bố trước đó, cũng như hỗn hợp chủng vi vật trong biofilm cho khả năng xử lý cao đồng thời nhiều loại hợp chất PAH có trong nước thải. Thực tế, trong nước thải nhiễm dầu cũng như các loại nước thải hiện nay tồn tại các chất cần xử lý rất đa dạng, việc ứng dụng biofilm chứa hỗn hợp chủng vi sinh vật là một hướng đi hiệu quả để giải quyết vấn đề này. Hiệu quả xử lý nước thải nhiễm dầu của biofilm trên vật liệu mang cao hơn so với các công nghệ tuyển nổi được sử dụng thường chỉ loại bỏ được từ 70-90% hàm lượng dầu tổng số trong nước thải [25, 140, 141]. Tuy nhiên thời gian xử lý bằng công nghệ tuyển nổi ngắn hơn nhiều so với việc sử dụng phương pháp sinh học nói chung và biofilm vi sinh vật trên vật liệu mang. Hơn nữa khi nước thải chứa hàm lượng dầu ở ngưỡng ức chế sự sinh trưởng phát triển của vi sinh vật thì việc kết hợp hệ thống tuyển nổi để xử lý ban đầu với hệ thống xử lý bằng biofilm sẽ đem lại hiệu quả cao, kết hợp được những ưu điểm của cả 2 phương pháp xử lý cũng như hạn chế được các nhược điểm của chúng. 87 Biofilm vi sinh vật trên vật liệu mang cho thấy kết quả xử lý tương đương với xử lý nước thải nhiễm dầu bằng công nghệ màng lọc. Các nghiên cứu hiện nay chứng minh công nghệ màng lọc đem lại hiệu quả loại bỏ các thành phần dầu trong nước thải lên đến 90-99% [26, 28, 30]. Công nghệ lọc màng là công nghệ đem lại hiệu quả xử lý cao, nhưng khó triển khai ở quy mô lớn cũng như việc ứng dụng rộng rãi bởi chi phí tốn kém, trong khi đó việc ứng dụng biofilm vi sinh vật có thể dễ dàng mở rộng quy mô, việc sử dụng các vật liệu mang rẻ tiền, dễ kiếm giúp giảm chi phí xử lý. Kết quả về khả năng xử lý nước thải nhiễm dầu của biofilm vi sinh vật trên vật liệu mang cũng phù hợp với các nghiên cứu trước đó trên thế giới về việc sử dụng biofilm trong xử lý nước thải nhiễm dầu [60, 64, 65, 66, 68]. Các kết quả nghiên cứu đều cho thấy biofilm vi sinh vật trên vật liệu mang có khả năng xử lý trên 90% hàm lượng dầu tổng số trong thời gian từ 5-15 ngày, trong nghiên cứu này biofilm vi sinh vật cho thấy khả năng loại bỏ trên 90% lượng dầu tổng số sau 7 đến 14 ngày với hàm lượng dầu trong nước thải ban đầu cao hơn các nghiên cứu trước đây đã công bố. Các nghiên cứu trước đó trong nước đã chỉ ra ở Việt Nam có sự đa dạng về các chủng vi sinh vật vừa có khả năng tạo biofilm cũng như phân hủy các thành phần hydrocarbon trong dầu tốt. Kết quả nghiên cứu này tính đến nay là công bố đầu tiên về việc đánh giá khả năng tạo biofilm của các chủng vi sinh vật trên các loại vật liệu mang, cũng như đánh giá được khả năng xử lý nước thải nhiễm dầu của biofilm vi sinh vật trên vật liệu mang ở các quy mô 50 lít, 300 lít và 20m3. Kết quả nghiên cứu góp phần mở ra hướng đi mới trong việc ứng dụng phương pháp sinh học trong xử lý ô nhiễm dầu một cách hiệu quả và thân thiện với môi trường tại Việt Nam. Trên thực tế, các nguồn nước thải nhiễm dầu có thể phát sinh định kỳ hoặc thường xuyên tùy thuộc vào dạng hoạt động của con người. Đối với các hoạt động như khai thác, chế biến dầu mỏ nước thải nhiễm dầu được phát sinh thường xuyên, còn đối với một số hoạt động như lưu trữ, vận chuyển dầu, thì nước thải phát sinh định kỳ mỗi lần sục rửa, vệ sinh [1]. Nghiên cứu này đã tiến hành thiết kế và thử nghiệm 2 dạng hệ thống xử lý nước thải nhiễm dầu ứng dụng công nghệ biofilm vi sinh vật đó là dạng liên tục (300 lít/ngày) và dạng mẻ (300 lít/ mẻ và 20m3/mẻ) 88 đem lại những thông tin khoa học đáng tin cậy về việc ứng dụng các mô hình xử lý khác nhau vào thực tiễn một cách phù hợp với các dạng nguồn nước thải nhiễm dầu. 4.3. Con đường chuyển hoá sec-hexylbenzene của Trichosporon asahii B1 Sec-hexylbenzene là hợp chất alkylbenzene có chứa mạch alkane phân nhánh ngoài vòng benzene và tồn tại nhiều trong nước ô nhiễm dầu tại các địa điểm ô nhiễm dầu như kho xăng dầu Đức Giang Hà Nội, Thanh Hóa và Quảng Ngãi. Hợp chất này cũng có nhiều trong công nghiệp sản xuất thuốc trừ sâu cũng như trong nhiều chất tẩy rửa tổng hợp do đó được xem là nhóm hợp chất khó phân hủy đối với vi sinh vật. Hiện nay trên thế giới cũng như ở Việt Nam có rất ít các nghiên cứu về khả năng chuyển hóa hợp chất hữu cơ này đặc biệt trên đối tượng nấm men khi ở dạng biofilm. Một số chủng vi khuẩn và nấm men cũng đã được chứng minh về khả năng phân hủy một số loại alkylbenzene, như các chủng Mycobacterium neoaurum, Rhodococcus ruber, Nocardia cyriacigeorgica, Trichosporon mucoides [114], Candida viswanathii TH1 [92] có khả năng phân hủy iso-pentylbenzene. Các chủng Pseudomonas mendocina và Vibrio parahaemolyticus có khả năng phân hủy LAS (linear alkylbenzen sulfonate) [142]. Một số chủng vi khuẩn Mycobacterium neoaurum, Rhodococcus ruber còn có khả năng phân hủy sec-octylbenzene [114]. Nghiên cứu của Amer và cs [143] đã phân lập được chủng vi khuẩn Pseudomonas meridiana và Pseudomonas antarctica có khả năng phân hủy 85-90% hỗn hợp các chất bao gồm: benzene, toluene, xylene, hexylbenzen và butylbenzen sau 24h nuôi cấy. Chủng nấm Yarrowia lipolytica TVN348 có khả năng chuyển hóa một số alkylbenzene bao gồm butylbenzen, hexylbenzen, pentybenzene, heptybenzene và nonylbenzene. Trong quá trình biến đổi sinh học các alkylbenzene, chất biến đổi trung gian được xác định là acid phenylacetic từ quá trình phân hủy sinh học butylbenzen, hexylbenzen và acid benzoic được xác định từ quá trình phân hủy sinh học pentybenzene, heptybenzene và nonylbenzene [144]. Kết quả này cũng phù hợp với kết quả nghiên cứu trong luận án về con đường chuyển hóa sinh học sec- hexylbenzen của màng sinh học chủng Trichosporon asahii B1, theo đó các chất chuyển hóa trung gian được phát hiện cũng bao gồm acid phenylacetic và acid benzoic. Con đường chuyển hóa sinh học iso-pentylbenzene của biofilm chủng nấm 89 men Candida viswanathii TH1 cũng cho thấy sự xuất hiện của các sản phẩm trung gian tương tự với con đường chuyển hóa sec-hexylbenzen của biofilm chủng nấm men Trichosporon asahii B1 là phenylacetic acid, acid benzoic [92]. Việc xác định được 5 phenylalkanoic acid có chứa các đoạn nối bên ngắn hơn sec-hexylbenzene trong quá trình chuyển hoá sec-hexylbenzene cho thấy, có thể sec-hexylbenzene đã được phân huỷ từ mạch nối bên, thay vì là sự phá vỡ cấu trúc vòng thơm trước. 5-phenylhexanoic acid và 3-phenylbutyric acid được xem là các sản phẩm chính của quá trình chuyển hoá/phân huỷ này cho thấy đoạn alkyl mạch bên đã được β-oxi hoá. Trong khi đó, theo nghiên cứu của Webley và cs [145] thì sec-hexylbenzene lại được phá vỡ vòng trước để tạo ra sản phẩm trung gian đầu tiên là 1-phenyl alkane. Tuy nhiên, theo nghiên cứu của Bhatia và Singh [146] thì các sản phẩm trung gian là 2-, 3-, và 4-phenylbutyric acid lại là sản phẩm chính của con đường chuyển hoá sec-hexylbenzene và các tác giả này không phát hiện sự phá vỡ vòng benzene của vi khuẩn Nocardia amarae. Hai chủng Nocardia sp. khác được công bố bởi Baggi và cs [147] cũng chứng minh được khả năng sử dụng 3- phenyldodecane làm nguồn carbon và năng lượng duy nhất cho quá trình sinh trưởng và các sản phẩm trung gian chính được tìm thấy cũng là 2-phenylbutyric acid, 3-phenylvaleric acid và 4-phenylhexanoic acid. Do vậy, việc dự đoán sec- hexylbenzene được β-oxi hoá từ mạch nhánh trước khi phá vỡ cấu trúc vòng thơm là hoàn toàn có cơ sở. Cho đến nay các nghiên cứu công bố về chủng vi sinh vật tạo màng sinh học có khả năng chuyển hoá/phân hủy sec-hexylbenzene, cũng như nghiên cứu về con đường chuyển hóa sinh học của hợp chất này còn rất ít. Các thí nghiệm trong các công bố đều được tiến hành trong điều kiện tế bào nuôi cấy dạng tự do, thay vì ở dạng tạo biofilm như nghiên cứu trên chủng Trichosporon assahi B1. Do vậy, có thể coi kết quả về con đường giải định phân hủy sec-hexylbenzene của biofilm chủng nấm men Trichosporon assahi B1 là báo cáo đầu tiên về con đường phân hủy sinh học của chất hữu cơ này bởi chủng nấm men tạo biofilm. 90 KẾT LUẬN VÀ KIẾN NGHỊ KẾT LUẬN 1. Hỗn hợp chủng vi sinh vật hình thành biofilm tốt nhất trên vật liệu mang xơ dừa với mật độ vi sinh đạt 3,9*1012 CFU/cm3 sau 36h, trên các vật liệu sỏi nhẹ, cellulose và mút xốp mật độ vi sinh lần lượt đạt 2,1*1012, 4,25*109 và 1,65*1010 CFU/cm3 sau 36h. 2. Biofilm vi sinh vật trên vật liệu mang xơ dừa có khả năng phân hủy 99,8% lượng dầu tổng số, 85,56% phenol và trên 96% các thành phần PAH sau 7 ngày ở mô hình 50 lít. Trên các vật liệu mang sỏi nhẹ, cellulose và mút xốp, biofilm vi sinh vật cho khả năng xử lý thấp hơn trên vật liệu mang xơ dừa, ở mức từ 91,26 - 95,54% hàm lượng dầu tổng số, 72,77-78,68% phenol và trên 69% đối với các thành phần PAH. 3. Trên hệ thống xử lý xử lý 300 lít/mẻ biofilm vi sinh vật cho hiệu quả xử lý 99,76% hàm lượng dầu tổng số và trên 85% các thành phần phenol và PAH trong nước nhiễm dầu sau 14 ngày xử lý. 4. Trên hệ thống xử lý liên tục 300 lít/ngày, biofilm vi sinh vật cho hiệu quả xử lý đạt trên 97% đối với các thành phần n-alkane C10, C11, C14-18, 100% các thành phần C9, C12, C13, C19 và C20, 100% các thành phần phenol và PAH, 98,9% các hydrocarbon no, 95,03% các hydrocarbon thơm, 95% nhựa và aspaten. 5. Trên hệ thống xử lý 20 m3/mẻ, biofilm vi sinh vật cho hiệu quả xử lý đạt 99,94% hàm lượng dầu tổng số, 99,97% phenol và trên 94% các thành phần PAH. Kết quả nước thải đầu ra đạt QCVN 40:2011/BTNMT tiêu chuẩn B. 6. Con đường giả định về sự phân hủy sec-hexylbenzene của chủng nấm men Trichosporon asahii B1 thông qua các sản phẩm trung gian bao gồm benzoic acid, 2-phenylpropionic acid, 3-phenylbutyric acid, 5-phenylhexanoic acid, ß- methylcinnamic acid, acephenone và 2,3 dihydroxybenzoic. KIẾN NGHỊ Thử nghiệm đánh giá khả năng phân hủy các thành phần hydrocarbon trong nước thải nhiễm dầu của màng sinh học ở một số kho xăng khác ở Việt Nam. 91 NHỮNG CÔNG TRÌNH CỦA TÁC GIẢ ĐÃ CÔNG BỐ LIÊN QUAN ĐẾN LUẬN ÁN 1. Lê Thị Nhi Công, Vũ Thị Thanh, Cung Thị Ngọc Mai, Nghiêm Ngọc Minh, Đỗ Thị Liên, Hoàng Phương Hà, Đỗ Văn Tuân, Đỗ Thị Tố Uyên, Thử nghiệm khả năng phân hủy dầu diesel của màng sinh học từ vi sinh vật gắn trên giá thể cellulose ở hệ thử nghiệm dung tích 50 lít, Tạp chí Công nghệ Sinh học 2015, 13(2A), 703-708. 2. Le Thi Nhi Cong, Cung Thi Ngoc Mai, Nghiem Ngoc Minh, Hoang Phuong Ha, Do Thi Lien, Do Van Tuan, Dong Van Quyen, Michihiko Ike, Do Thi To Uyen, Degradation of sec-hexylbenzene and its metabolites by a biofilm-forming yeast Trichosporon asahii B1 isolated from oil-contaminated sediments in Quangninh Coastal Zone, Vietnam, Journal of environmental science and health 2016, part A 51(3), 267-275. 3. Do Van Tuan, Do Thi To Uyen, Dong Van Quyen, Le Thi Nhi Cong, Hydrocarbon degradation in oily wastewater by microbial biofilm attached on polyurethane foam carriers, Proceeding at the 4th Academic conference on natural science for Young Scientists, Master and PhD Student from Asean countries 15-18 December, 2015, Bangkok, Thailand: O16, 40-45. 4. Đỗ Văn Tuân, Lê Thị Nhi Công, Đỗ Thị Liên & Đồng Văn Quyền, Đánh giá khả năng phân hủy các thành phần hydrocarbon trong nước thải nhiễm dầu tại kho xăng dầu Đỗ Xá, Hà Nội bằng màng sinh học từ vi sinh vật gắn trên vật liệu mang xơ dừa, Tạp chí Khoa học Đại học Quốc gia Hà Nội 2017, 33 (2S), 274- 279. 5. Đỗ Văn Tuân, Lê Thị Nhi Công, Vũ Ngọc Huy, Hoàng Phương Hà, Khả năng phân hủy các thành phần hydrocarbon trong nước thải nhiễm dầu của màng sinh học (biofilm) từ vi sinh vật trên vật liệu mang sỏi nhẹ keramzit, Tạp chí Công nghệ Sinh học 2017, 15(4A),291-297. 6. Do Van Tuan, Le Thi Nhi Cong, Vu Ngoc Huy, Phi Quyet Tien & Hoang Phuong Ha, Assessment of oil contaminated wastewater treatment by microbial biofilm attached on coconut fiber in 20,000 liter system, Proceeding at the 5th 92 Academic conference on natural science for Young Scientists, Master and PhD Student from Asean countries 4-7 October, 2017, Da Lat, Vietnam, 170-176. 93 TÀI LIỆU THAM KHẢO 1. J. Coca, G. Gutie’rrez & J. Benito, Treatment of oily wastewater. In: Coca J, Gutie’rrez G & Benito J (eds) Water Purification and Management, NATO Science for Peace and Security Series C: Environmental Security. Springer, Dordrecht, 2011. 2. J.F. Lodungi, D.B. Alfred, A.F.M. Khirulthzam, F.F.R.B. Adnan & S. Telllchandran, A Review in oil exploration and production waste discharges according to legislative and waste management practices perspective in Malaysia, International Journal of Waste Resources, 2016, 7(1), 1-8. 3. H.I. Mustapha, Treatment of petroleum refinery wastewater with constructed wetlands, Thesis of Environmental Technology, Wageningen Graduate Schools, 2018. 4. T.C.M. Nonato, A.A.D.A. Alves, M.L. Sens & R.L. Dalsasso, Produced water from oil – A review of the main treatment technologies, Journal of Environmental Chemistry and Toxicology, 2018, 2(1), 23-27. 5. D.A.A. Aljuboury, P. Palaniandy & S. Feroz, Advanced oxidation processes (AOPs) to treat the petroleum wastewater, Project: Advanced oxidation processes (AOPs) to remove inorganic carbon (IC) from petroleum wastewater, 2018, 99-121. 6. P.D. Boehm & J.G. Quinn, Solubilization of hydrocarbons by the dissolved organic matter in sea water, Geochimica et Cosmochimica Acta, 1973, 37(11), 2459-2477. 7. S. Shokrollahzadeh, F. Azizmohseni, F. Golmohammad, H. Shokouhi & F. Khademhaghighat, Biodegrdation potetial and bacterial diversity of a petrochemical wastewater treatment plant in Iran, Bioresource Technology, 2008, 99(4), 6127-6133. 8. W. Al Hashemi, M.A. Maraqa, M.V. Rao & M.M. Hosain, Characterization and removal of phenolic compounds from condensate oil refinery wastewater, Desalination and Water Treatment, 2015, 54, 660-671. 9. A.M. Ali, M.A. Abu-Hassan, R.R.K. Ibrahim, M.A.A. Zaini, B.I. Abdulkarim, A.S. Hussein, S.M. Su, M.I. Mohd Halim, Chracterization of 94 petroleum sludge from refinery industry biological wastewater treatment unit, The International Journal of Engineering and Science, 2017, 6(9), 61- 65. 10. A. Saber, H. Hasheminejad, A. Taebi & G. Ghafari, Optimization of fenton based treatment of petroleum refinery wastewater with scrap iron using reponse surface methodology, Applied Water Science, 2014, 4, 283-290. 11. D.U.B. Hasan, A.R. Abdul Aziz & W.M.A.W. Daud, Oxidative mineralisation of petroleum refinery effluent using Fenton-like process, Chemical Engineering Research and Design, 2012, 90(2), 298-307. 12. A.R. Dincer, N. Karakaya, E. Gunes & Y. Gunes Y, Removal of COD from oil recovery industry wastewater by the Advanced Oxidation Processes (AOP) based on H2O2, Global NEST Journal, 2008, 10, 31-38. 13. M. Fingas & J. Charles, Effects of oil spills on the environment - The basic of oil spill cleanup, Lewis Publishers: United States of American. International Standard Book Number 1-56670-537-1, 2000. 14. D. Yuewen & L. Adzigbli, Assessing the impact of oil spills on marine organisms, Journal of Oceanography and Marine Research, 2018, 6(1), DOI:10.4172/2572-3103.1000179. 15. F. Ahmed & A.N.M. Fakhruddin, A review on environmental contamination of petroleum hydrocarbons and its biodegradation, Int Environ Sci Nat Res, 2018, 11(3), 1-7. 16. O.N. Albert, D. Amaratunga & R.P. Haigh, Evaluation of the impacts of oil spills disaster on communities and its influence on restiveness in Niger Delta, Nigeria, Procedia Engineering, 2018, 212, 1054-1061. 17. G.Z. Kyzas and K. Matis, Flotation in water and wastewater treatment, Processes, 2018, 6(8), 116. 18. W. Strickland, Laboratory results of cleaning produced water by gas flotation, Society of Petroleum Engineering Journal, 1980, 20, 175-190. 19. G.F. Bennett & R.W. Peters, The removal of oil from wastewater by air flotation: A review, Critical Reviews in Environment Control, 1988, 18(3), 95 189-253. 20. D. Belhateche, Choose Appropriate wastewater treatment technologies, Chemical Engineering Progress, 1995, 91(8), 32-51. 21. C. Gopalranam, G. Bennett & R. Peters, The simultaneous removal of oil heavy metals from industrial wastewater by joint precipitation and air flotation, Environmental Progress, 1988, 7, 84-92. 22. J. Duan & J. Gregory, Coagulation by Hydrolysing Metal Salts, Advances in Colloid and Interface Science, 2003, 100-102, 475-502. 23. L. Yu, M. Han & F. He, A review of treating oily wastewater, Arabian Journal of Chemistry, 2013, 24. A. Al-Shamrani, A. James & H. Xiao, Destabilization of Oil-Water Emulsions and Separation by Dissolved Air Flotation, Water Research, 2002, 36, 1503-1512. 25. Z. You, H. Xu, Y. Sun, S. Zhang & L. Zhang, Efective treatment of emulsified oil wastewater by the coagulation flotation process, RSC Advaces, 2018, 71, 40639-40646. 26. N.A. Almad, P.S. Goh, Z.A. Karim & A.F. Ismail, Thin film composite membrane for oily wastewater treatment: recent advances and challenges, Membranes, 2018, 8(4),86. 27. S.R.H. Abadi, M.R. Sebzari, M. Hemati, F. Rekabdar & T. Mohammadi T, Ceramic membrane performance in microfiltration of oily wastewater, Desalination, 2011, 265 (1-3), 222-228. 28. M. Boshrouyeh, F. Zokaee, M. Karrimi & Fouladitajar, A novel appproach to fabricate high performance nano SiO2 embedded PES membranes for microfiltration of oil-in water emulsion, Applied Surface Science, 2015, 349, 393-4. 29. Y. Zhang, P. Cui, T. Du, L. Shan & Y. Wang, Development of a ssulfate Y- doped nonstoichiometric zirconia/polysulfone composite membrane for treatment for treatment of wastewater containing oil, Separation and Purification Technology, 2009, 70(2), 153-159. 30. S. Kumar, B.K. Nandi, C. Guria & A. Mandal, Oil removal from produced water by ultrafiltration using polysulfone membrane, Brazilian Journal of 96 Chemical Engineering, 2017, 34(2), https://doi.org/10.1590/0104- 6632.20170342s20150500. 31. M. Thorben, H. Dennis, S. Michael & K. Ulrich, Electrochemical reactors for wastewater treatment, Chemie Ingenieur Technik, 2019, 91(6), 769-789. 32. M.R.G. Santos, M.O.F. Goulart, J. Tonholo & C. Zanta, The application of electrochemical technology to the remediation of oily wastewater, Chemosphere, 2005, 64(3), 393-399. 33. H. Ma & B. Wang, Electrochemical pilot-scale plant for oil field produced wastewater by M/C/Fe electrodes for injection, Journal of Hazardous Materials, 2006, 132(2-3), 237-243. 34. J.W. Tester & J.A. Cline, Hydrolysis and oxidation in subcritical and supercritical water, Connecting process engineering science to molecular interactions, 1999, 55(11), 1088-1100. 35. N.A. Mostafa, A.M. Tayeb, O.A. Mohamed, R. Farouq, Biodegradation of petroleum oil effluents and production of biosurfactants: Effect of initial oil concentration, Journal of Surfactants and Detergents, 2019, 22(2), 385-394. 36. M.M. Stancu, Bacterial degradation of petroleum and petroleum products, Journal of Molecular Microbiology, 2018, 2(1), 1-3. 37. X. Xu, W. Liu, S. Tian, W. Wang, Q. Qi, P. Jiang, X. Gao, F. Li, H. Li & H. Yu, Petroleum hydrocarbon degrading bacteria for the remediation of oil pollution under aerobic conditions: A perspective analysis, Frontier in Microbiology 2018, 9, 2885. 38. C. Marchand, M.S. Arnaud, W. Hogland, T.H. Bell & M. Hijri, Petroleum biodegradation capacity of bacteria and fungi isolated from petroleum – contaminated soil, International Biodeterioration & Biodegradation 2017, 116, 48-57. 39. A.D. Verderosa, M. Totsika & K.E.F. Smith, Bacterial biofilm eradication agents: a currents review, Frontiers in Chemistry, 2019, https://doi.org/10.3389/fchem.2019.00824. 40. L. Karygianni, Z. Ren, H. Koo, T. Thurnheer, Biofilm matrixome: Extracellular components in strutured microbial communities, Trends in Microbiology, 2020, 28(8), 668-681. 97 41. S. Satpathy, S.K. Sen, S. Pattanaik & S. Raut, Review on bacterial biofilm: An universal cause of contamination, Biocatalysis and Agricultural Biotechnology, 2016, 7, 56-66. 42. H.C. Flemming, J. Wingender, U. Szewzyk, P. Steinberg, S.A. Rice & S. Kjelleberg, Biofilm: an emergent form of baterial life, Nature Reviews Microbiology, 2016, 14, 563-575. 43. C.R. Kokare, S. Chakraborty, A.N. Khopade & K.R. Mahadik, Biofilm: Importance and applications, Indian Journal of Biotechnology, 2009, 8, 159- 168. 44. T. Rasamiravaka, Q. Labtani, P. Duez & M.E. Jaziri, The formation of biofilm by Pseudomonas aeruginosa: A review of the natural and synthetic compounds interfering with control mechanisms, Bioactive Natural Products: Facts, Application and Challenges, 2015, https://doi.org/10.1155/2015/759348. 45. K.C. Cheng, A. Demirci & J.M. Catchmark, Advances in biofilm reactors for production of value-added products, Applied Microbiology and Biotechnology, 2010, 87, 445-456. 46. S. Andersson, Characterization of bacterial biofilms for wastewater treatment, Universitetsservice US-AB, Sweden, 2009. 47. L.F. Melo & R. Oliverira, Biofilm reactors, Taylor & Francis, 2001. 48. M.M. Baum, A. Kainovic, T. O’Keeffe, R. Pandita, K. McDonald, S. Wu & P. Webster, Characterization of strutures in biofilms formed by a Pseudomonas flourencens isolated from soil, BMC Microbiology, 2009, 9, 103. 49. G.P. Sheng, H.Q. Yu & X.Y. Li, Extracellular polymeric substances (EPS) of microbial aggregates in biological wasterwater treatment systems: a review, Biotechnol. Adv., 2010, 28, 882–894. 50. G.A. O’Toole, H.B. Kaplan, R. Kolter R, Biofilm formation as microbial development, Annu Rev Microbiol, 2000, 54, 49-79. 51. V.D. Gordon, M.D. Fields, K. Kovach, C.A. Rodesney, Biofilms and mechanics: a review of experimental technoques and findings, Journal of Physics D: Applied physics, 2017, 50(22), 43-54. 98 52. J.W. Costerton, Z. Lewandowski, D. Debeer, D. Caldwell, D. Korber & G. James, Biofilms, the customized microniche, Journal of Bacteriology, 1994, 176(8), 2137-2142. 53. R.M. Donlan & J.W. Costerton, Biofilms: survival mechanisms of clinically relevant microorganisms, Clin. Microbiol. Rev., 2002, 15(2), 167-193. 54. W.W. Nichols, S.M. Dorrington, M.P.E. Slack&H.L. Walmsley, Inhibition of tobramycin diffusion by binding to alginate, Antimicrobial Agents and Chemotherapy, 1988, 32, 518-523. 55. W.W. Nichols, M.J. Evans, M.P.E. Slack & H.L. Walmsley, Penetration of antibiotic into aggregate of mucoid and nonmucoid Pseudomonas aeruginosa, Journal of General & Applied Microbiology, 1989, 135, 1291- 1303. 56. A.W. Decho, Microbial exopolymer secretion in ocean environment: Their role(s) in food web and marine process, Oceanography and Marine Biology, An Annual Review, 1990, 28, 73-153. 57. H.C. Flemming, Biofilm and environmental protection, Water Science and Technology, 1993, 27, 1-10. 58. J.S. Teh & K.H. Lee, Utilization of n- alkane by Cladosporium resinae, Applied Microbiology, 1973, 25, 454-457. 59. E.L. Prince & L.H.G. Morton, Biofilms and bioemulsifiers in hydrocarbon degradation, International Biodeterioration, 1989, 25(6), 385-391. 60. W.M. Alalayah, Biodegradation of waste water treatment containing petroleum hydrocarbon using rotating biological contractor (RBC), International Journal of Advance Engineering and Research Development 2017, 4(3), 58-65. 61. N. Ghimire & S. Wang, Biological treatment of petroleumchemical wastwater, In: Petroleum Chemicals, Intechopen, 2018. 62. J.G. Leahy & R.R. Colwell, Microbial degradation of hydrocarbons in the environment, Microbial review, 1990, 54(3), 305-315. 63. K. Tong, Y. Zhang, G. Liu, Z. Ye&P.K. Chu, Treatment of heavy oil wastewater by a conventional activated sludge process couple with an immobilized biological filter, International Biodeterioration & 99 Biodegradation, 2013, 84, 65-71. 64. X.L. Zou, Treatment of heavy oil wastewater by UASB – BAFs using the combination of yeast and bacteria, Environmental Technology, 2015, 36(18), 2381-2389. 65. P. Chandran & N. Das, Degradation of diesel oil by immobilized Candida tropicalis and biofilm formed on gravels, Biodegradation, 2011, 22(6), 1181- 1189. 66. A. Chavan & S. Mukherji, Treatment of hydrocarbon rich wastewater using oil degrading bacteria and phototropic microorganisms in rotating biological contactor: effect of N:P ratio, Journal of Hazardous Materials, 2008 154(1-3), 63-72. 67. C.Y. Cao & Y.H. Zhao, The comparison of MBBR and ASP for treatment on petrochemical wastewater, Petroleum Science and Technology, 2012, 30(14), 1461-1467. 68. R. Shokohi, K. Yari & M.S. Hemat, Investigating the performance of moving bed biofilm reactor in the removal of oil and grease from besat hospital wastwater, Journal of Industrial Pollution Control, 2018, 34(1), 1991-1997. 69. M. Delnavaz, B. Ayati, H. Ganjdoust, Biodegradation of aromatic amine compounds using moving bed biofilm reactors, Iranian Journal of Environmental Health Science & Engineering, 2008, 5(4), 243-250. 70. R. Mahmoudkhani, A.M. Azar, A. Dehghani & H. Ghoreishi, Treatment of contaminated waters with petroleum by moving bed biofilm reactor (MBBR), International Conference on Life Science and Engineering, 2012, 45, 12-16. 71. A. Sayahzadeh, H. Ganjidoust & B. Ayati, Removal mechaisms involved in the petroleum refinery wastewater treatment by MBBR system, Journal of Water & Wastewater, 2017, 28(3), 87-96. 72. W. Lin, Application of ozone MBBR process in refinery wastewater treatment, Earth and Environmental Science, 2018, 108, doi:10.1088/1755- 1315/108/4/042124. 73. X. Hu, K. Xi, Z. Wang, L. Ding & H. Ren, Characteristics of biofilm attaching to cariers in moving bed biofilm reactor used to treat vitamin C wastewater, Journal of Scanning Microscopies, 2013, 35(5), 283-291. 100 74. E. Schneider, A.C. Cerqueira & M. Dezotti, MBBR evaluation for oil refinery wastewater treatment, with post ozonation and BAC, for wastewater reuse, Water Science & Technology, 2011, 63(1), 143-148. 75. Lại Thúy Hiền, Đỗ Thu Phương, Hoàng Hải, Phạm Thị Hằng, Lê Thị Nhi Công, Lê Phi Nga, Kiều Hữu Ảnh, Chọn chủng vi sinh vật tạo chất hoạt hóa bề mặt sinh học cao ứng dụng trong công nghiệp dầu khí và xử lý môi trường, Tạp chí Công nghệ sinh học, 2003, 1, 119-129. 76. Lại Thúy Hiền, Dương Văn Thắng, Trần Cẩm Vân, Doãn Thái Hòa, Vi khuẩn tạo chất hoạt hóa bề mặt sinh học phân lập từ biển Nha Trang, Tạp chí Sinh học, 2003, 25(4), 53-61. 77. Lại Thúy Hiền, Nguyễn Thị Thu Huyền, Nguyễn Thị Yên, Phạm Thị Hằng, Phạm Thị Bích Hợp, Trần Đình Mấn, Nghiên cứu sản xuất chất hoạt hóa bề mặt sinh học từ vi khuẩn Rhodococcus 4C3, TD2 và Acinetobacter 6C1, QN15, Tạp chí Công nghệ Sinh học, 2010, 8 (3B), 1751-1759. 78. Lại Thúy Hiền, Nguyễn Thị Yên, Vương Thị Nga, Vi khuẩn tạo chất hoạt hóa bề mặt sinh học Rhodococcus ruber TD2 phân lập từ nước ô nhiễm dầu ven biển Vũng Tàu, Tạp chí Sinh học, 2013, 35(4), 454-460. 79. Bùi Thị Kim Anh, Đặng Đình Kim & A. Maruyama, Ứng dụng kỹ thuật phân tích phân tử để xác định thành phần và số lượng vi sinh vật trong thí nghiệm xử lý ô nhiễm dầu bằng phương pháp sinh học, Tạp chí Công nghệ sinh học, 2007, 5(4), 505-512. 80. Đinh Thị Vân & Ngô Cao Cường, Phân lập, định danh và nghiên cứu đặc điểm sinh học một số chủng vi sinh vật có khả năng phân hủy dầu mỏ trong mẫu đất, bùn nhiễm xăng dầu tại Quân khu 7, Tạp chí Khoa học & Công nghệ Việt Nam, 2019, 61(6), 24-28. 81. Nguyễn Quang Huy, Nguyễn Bá Hữu, Nguyễn Thị Thanh Ngâ, Đặng Thị Cẩm Hà, Sinh enzim ngoại bào peroxidaza, laccaza và phân hủy các hợp chất vòng thơm của chủng xạ khuẩn XKBH1, Tạp chí Khoa học và Công nghệ 2012, 50(3), 285-195. 82. Đặng Thị Cẩm Hà, Nguyễn Bá Hữu, Mai Anh Tuấn, Nguyễn Đương Nhã, Nguyễn Quốc Việt, Nguyễn Nguyên Quang, Khảo sát vi sinh vật trong vùng nhiễm chất diệt cỏ chứa dioxin ở khu vực sân bay Đà Nẵng và khử độc đất 101 nhiễm ở điều kiện phòng thí nghiệm, Tạp chí công nghệ sinh học, 2008, 6(4A), 837- 846. 83. Đặng Thị Cẩm Hà, Trần Thị Như Hòa, Nguyễn Bá Hữu, Nguyễn Nguyên Quang, Đàm Thúy Hằng, Nguyễn Quang Huy, Phân hủy hydrocarbon thơm đa nhân và sinh tổng hợp peroxidase, laccase của chủng vi khuẩn BDNR10 và chủng nấm sợi FDNR40, Tạp chí Độc học, 2010, 14(8), 8-13. 84. Cung Thị Ngọc Mai, Thái Thị Thùy Dung, Nguyễn Văn Bắc, Nguyễn Thị Thu Huyền, Nghiêm Ngọc minh, Phân loại chủng vi khuẩn BTLP1 có khả năng phân hủy phenol bằng phương pháp phân tích trình tự nucleotit của đoạn gen 16s rRNA, Tạp chí Khoa học và Công nghệ, 2012, 50(1), DOI: https://doi.org/10.15625/0866-708X/50/1/9467 85. Nguyễn Thị Phi Oanh & Nguyễn Vũ Bích Triệu, Phân lập vi khuẩn phân hủy xylene từ hệ thống xử lý nước thải, Tạp chí Khoa học trường Đại học Cần Thơ 2017, 52A, 99-103. 86. L.T. Nhi-Cong, M. Morikawa &L.T. Hien LT, Ability of hydrocarbon degradation by several biofilm – forming microorganisms isolated from Vietnam coastal zone. The analytica Vietnam conference 2011. 87. Vũ Thị Thanh, Lê Thị Nhi Công & Nghiêm Ngọc Minh, Nghiên cứu khả năng phân hủy phenol của chủng vi khuẩn DX3 phân lập từ nước thải kho xăng dầu Đỗ Xá, Hà Nội, Tạp chí Sinh học, 2014, 36(1), 28-33. 88. Le Thi Nhi Cong, Cung Thi Ngoc Mai, Nghiem Ngoc Minh, Aromatic hydrocarbon degradation of a biofilm formed by a mixture of marine bacteria, 5th International contaminated site remediation conference: Program and proceedings, CleanUp 2013 conference, Melbourne, Australia, 15-18 september 2013. 89. Cung Thị Ngọc Mai, Lê Thị Nhi Công, Lê Thành Công & Nghiêm Ngọc Minh, Khả năng chuyển hóa và phân hủy phenol do màng sinh học tạo thành từ các chủng vi khuẩn phân lập tại kho xăng dầu Đức Giang, Gia Lâm, Hà Nội, Tạp chí Công nghệ Sinh học, 2014, 12(2), 381-386. 90. Cung Thị Ngọc Mai, Lê Thị Nhi Công, Nghiêm Ngọc Minh, Khả năng phân hủy các hợp chất hydrocarbon có trong dầu diesel bởi màng sinh học của chủng Rhodococcus sp. BN5 phân lập từ nước thải của bể chứa kho xăng 102 dầu Đỗ Xá, Thường Tín, Hà Nội, Báo cáo khoa học hội nghị khoa học công nghệ sinh học toàn quốc, 2013, 355-359. 91. Cung Thị Ngọc Mai, Vũ Thị Thanh, Nghiêm Ngọc Minh, Lê Thị Nhi Công, Hiệu suất phân hủy dầu diesel của chủng vi khuẩn có khả năng tạo màng tốt phân lập từ mẫu nước ô nhiễm dầu ở Quảng Ngãi, Tạp chí Khoa học ĐHQGHN: Khoa học Tự nhiên và Công nghệ, 2015, 31(4S): 214-219. 92. Cung Thị Ngọc Mai, Nghiên cứu khả năng phân hủy hợp chất vòng thơm của các chủng vi sinh vật tạo màng sinh học phân lập tại một số địa điểm ô nhiễm dầu ở Việt Nam, Luận án tiến sĩ Sinh học, Viện Công nghệ Sinh học, Viện Hàn lâm Khoa học và Công nghệ Việt Nam, 2019. 93. Đỗ Thị Tố Uyên, Nghiên cứu tạo màng sinh học (biofilm) từ vi sinh vật dùng trong xử lý ô nhiễm dầu mỏ, Báo cáo kết quả khoa học công nghệ đề tài cấp Bộ Khoa học và Công nghệ, 2016, Mã số KC.04.21/11-15. 94. F. Yamaga, K. Washio and M. Morikawa, Sustainable biodegradation of phenol by Acinetobacter calcoacetius P23 isolated from the rhizosphere of Duckweed Lenma aoukikusa, Environ Sci Technol, 2010, 44, 6470-6474. 95. N.X. Egorov, Thực tập vi sinh vật học (Nguyễn Lân Dũng dịch), Nhà xuất bản Khoa học và Kỹ thuật, 1976. 96. F. Schauer, Abbau ung Verwertung von Mineralölbestandteilen durch Mikroorganismen, Bodden, 2001, 11, 3-31. 97. G. Reed & T.W. Nagodawithana, Yeast technology, 1991, 2nd ed. Van Nostrand Reinhold Co., Inc., New York. 98. Nguyễn Lân Dũng và cs, Giáo trình Vi sinh vật học, Nhà xuất bản Khoa học và kỹ thuật, 1981. 99. N. da Silva, M.H. Taniwaki, V.C.A. Junqueira, N. Silveira, M.M. Okazaki, R.A.R. Gomes, Microbiological examination methods of food and water. In Laboratory Manual 2nd Edition, CRC Press, 2018. 100. S. Harju, H. Fedosyuk, K.R. Peterson, Rapid isolation of yeast genomic DNA: Bust n' Grab, BMC Biotechnol, 2004, 4(8). 101. T.J. White, T. Burns, S. Lee, J. Taylor, Amplification and sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR protocols. Aguide to methods and applications, Academic Press, Inc, San Diego, California, 1990, 103 315-322. 102. S.P. Burghate & N.W. Ingole, Fluidized bed biofilm reactor – A novel wastewater treatment reactor, International Journal of Research in Environmental Science and Technology, 2013, 3(4), 145-155. 103. P. Félix de Castro, E. Stander, R. Garcia-Campà, D. Cornandó Carbó, A. Serpico & J. Gallego-Villanueva, Improvement of biofilm formation in trickle bed reactors by surface modification of different packing materials, AUTEX2019 – 19th World textile conference on textile at the crossroads, 11- 15 June 2019, Ghent, Belgium, 2019. 104. A. Silva, A.K. Karuaratne & V.A. Sumanasinghe, Wastewater treatment using attached growth microbial biofilms on coconut fiber: a short review, Journal of Agriculture and Value Addition, 2019, 2(1), 61-70. 105. N. Sato, T. Saito, H. Satoh, N. Tanaka & K. Kawamotom, Coconut fiber biofilm wastewater treatment system in Srilanka: microcosm experiments for evaluating wastewater treatment efficiencies and oxygen consumption. International Journal of Environmental Science and Development, 2017, 8(10), 691-695. 106. A. Knezev, Microbial activity in granular activated carbon filters in drinking water treatment. pHD Thesis of Socio-Economic and Natural Sciences of the Environment, Wageningen University, Holand, 2015. 107. T.C. Antunes, A.E. Ballarini & S. Van der Sand, Temporal variation of bacterial population and response to physical and chemical parameters along a petrochemical industry wastewater treatment plant, Anais da Academia Brasileira de Ciencias, 2019, 19(2), https://doi.org/10.1590/0001- 3765201920180394. 108. E. Nowicka & A. Machnicka, Hygieniza of surplus activated sludge by dry ice, Ecological Chemistry and Engineering, 2014, 21(4), 651-660. 109. C.M. Nicholas, C.F. John & J.W. Andrew, Survival and catabolic activity of natural and genetically engineered bacteria in a laboratory scale activated sludge unit, Applied and Environmental Microbiology, 1991, 57(2), 366-373. 110. W. Maria, B. Johan & L. Sabine, Comparison of auxacolor with API 20 C Aux in yeast identification, Clinical Microbiology and Infection, 1997, 3(3), 369-375. 104 111. J.A. Barnett, R.W. Payne, D. Yarrow, Yeast; Characteristics and identification, Cambridge University Press, Cambridge, 1990. 112. N.J.W. Kreger Van Rij, The yeast, a taxonomic study, Elsevier, Amsterdam, 1984. 113. F.S. Sariaslani, J.L. Submeier & D.D. Focht, Degradation of 3-phenylbutyric acid by Pseudomonas sp., Journal of Bacteriology, 1982, 152, 411-421. 114. L.T. Nhi-Cong, Degradation of branched chain aliphatic and aromatic petroleum hydrocarbons by microorganisms, PhD thesis, University of Greifswald, Greifswald, Germany, 2008. 115. K.A. Whitehead & J Verran, The effect of substratum properties on the survival of attached miroorganisms on inert surfaces, In book: Marine and Industrial Biofouling, Springer Series on Biofilms Springer, Germany, 2009, 13-33. 116. D.C. Savage & M. Fletcher, Bacterial adhesion: mechanisms and physiological significance, Plenum Press, New York, N.Y, 1985. 117. S.N. Nunal, S.M.S.S. De Leon, E. Bacolod, J. Koyama, S. Uno, Hidaka, T. Yoshikawa& H. Maeda, Bioremediation of heavily oil polluted seawaster by a bacterial consortium immobilized in cocopead and rice hull powder. Biocontrol Science, 2014, 19(1), 11-22. 118. H.R. Kariminia, K. Kanda & F. Kato, Wastewater treatment with bacteria immobilized onto a ceramic carrier in an aerated system, Journal of Bioscience and Bioengineering, 2003, 95(2), 128-132. 119. N.G. Bayat & G. Bradley, A study of a bacterial immobilization substratum for use in the bioremediation of crude oil in a saltwater system, Journal of Applied Microbiology, 1997, 83, 524-530. 120. Z. Bayat, M. Hassanshahian & S. Cappello, Immoniization of microbes for bioremediation of crude oil polluted environments: A mini review. Open Microbiology Journal, 2015, 9, 48-54. 121. Z. Zommere & V. Nikolajeva, Immobilization of bacterial association in alginate beads for bioremediation of oil contaminated lands, Environmental and Experimental Biology, 2017, 15, 105-111. 122. A. Nussinovitch, M. Nussinovitch, R. Shapira & Z. Gershon, Influence of 105 immobilization of bacteria, yeasts and fugal spores on the mechanical properties of agar and alginate gels, Food Hydrocolloids, 1994, 8(3-4), 361- 372. 123. M. Stella, M. Theeba & Z.L. Illani, Organic fertilizer amended with immobilized bacterial cells for extended shelf life, Biocatalysis and Agricultural Biotechnology, 2019, 20, 101248. 124. U. Jasinska, S. Skapska, L. Owczarek, A. Dekowska & D. Lewinska, Immobilization of Bifidobacterium infantis cells in selected hydrogels as a method of increasing their survival in fermented milkless beverages, Natural Strategies to Improve Quality in Food Protetion, 2018, https://doi.org/10.1155/2018/9267038. 125. M. Cyprowski, A. Stobnicka-Kupiec, A. Lawniczek-Watczyk, A. Bakal- Kijek, M. Golofit-Szymczak & R.L. Gorny, Anaerobic bacteria in wastewater treatment plant, International Archives of Occupational and Environmental Health, 2018, 91, 571-579. 126. Trần Thị Thu Hiền, Nguyễn Tiến Hán, Vũ Thị Liễu, Trần Đức Thảo, Nguyễn Ngọc Tân & Võ Thị Thúy Lê, Nghiên cứu ứng dụng công nghệ MBBR sử dụng giá thể biochip M để xử lý nước thải giết mổ gia cầm, Tạp chí Khoa học & Công nghệ Đại học Công nghiệp Hà Nội, 2017, 43, 107-113. 127. Lê Hoàng Việt và Nguyễn Või Châu Ngân, Khảo sát thời gian lưu nước của bể MBBR để xử lý nước thải sản xuất mía đường, Tạp chí Khoa học trường Đại học Cần Thơ, 2017, Số chuyên đề: Môi trường và biến đổi khí hậu, 1, 173-180. 128. Nguyễn Thị Thu Hiền, Nghiên cứu ứng dụng công nghệ MBBR nâng cao hiệu quả xử lý sinh học hiếu khí tại nhà máy giấy bao bì, Báo cáo đề tài nghiên cứu cấp Bộ Khoa học và Công nghệ, Việt Nam, 2019. 129. Nguyễn Thị Hoài Giang, Trần Thị Cúc Phương & Trần Văn Phước, Hiệu quả xử lý nước thải sinh hoạt bằng hệ thống lọc sinh học nhỏ giọt, Tạp chí Khoa học Đại học Huế: Kỹ thuật và Công nghệ, 2018, 127(2A), 43-53. 130. Nguyễn Ngọc Ánh, Nghiên cứu tuyển chọn một số chủng vi sinh vật bổ sung vào quá trình tạo bùn hạt hiếu khí để xử lý nước thải chế biến tinh bột, Luận văn thạc sỹ Kỹ thuật môi trường, Trường Đại học Khoa học Tự nhiên, Đại 106 học Quốc gia Hà nội, 2016. 131. Nguyễn Thị Hương, Đặng Hồng Ánh, Nguyễn Thu Vân, Giang Thế Việt, Nguyễn Xuân Bách, Trần Ngọc Bích, Nghiên cứu cố định tế bào nấm men ứng dụng trong lên men cồn từ rỉ đường, Tạp chí Khoa học và Công nghệ, 2012, 50(6), 621-631. 132. Nguyễn Ngọc Bảo, Đàm Thúy Hằng, Vũ Đức Lợi, Đặng Thị Thu, Đặng Thị Cẩm Hà, Phân hủy sinh học hydrocarbon thơm đa vòng của một số chủng vi khuẩn phân lập từ nước thải nhiễm dầu, Tạp chí Khoa học và Công nghệ, 2008, 46(6), 67-75. 133. A. Hidayat A & M. Turjaman, Biological degradation of crude oil contaminants and its application in Indonesia, In book: Microbes for Restoration of Degraded Ecosystems, New India Publishing Agency, 2016, 335-354. 134. V.K. Mishra & N. Kumar, Microbial degradation of phenol: A review, Journal of Water Pollution & Purification Research, 2017, 4(1), 17-22. 135. K. Przybulewska, A. Wieczorek, A. Nowak & M. Pochrzazcz, The isolation of microorganisms capable of phenol degradation, Polish Journal of Microbiology, 2005, 55(1), 63-67. 136. P. Sachan, S. Madan & A. Husain, Isolation and screening of phenol degrading bacteria from pulp and paper mill effluent, Applied Water Science, 2019, 9, 100. 137. A. Fazilah, I. Darah & N. Ismail, Phenanthrene degrading bateria, Acinetobacter sp. P3d from contaminated soil and their bioactivities, Nature Environment and Pollution Technology, 2018, 17(20), 579-584. 138. S. Rabodonirina, R. Rasolomampianina, F. Krier, D. Drider, D. Merhaby, S. Net&B. Ouddane, Degradation of fluorene and phenanthrene in PAHs contaminated soil using Pseudomonas and Bacillus strain isolated from oil spill sites, Journal of Environmental Management, 2019, 232, 1-7. 139. O.O. Alegbeleye, B.O. Opeolu & V. Jackson, Bioremediation of polycyclic aromatic hydrocarbon (PAH) compounds: (acenaphthene and fluorene) in water using indigenous bacterial species isolated from the Diep and Plankenburg rivers, Western Cape, South Africa, Brazilian Journal of 107 Microbiology, 2017, 48(2), 314-325. 140. K.E.H.K. Ishak & M.A. Ayoub, Removal of oil from polymer-produced water by using flotation process and statistical modelling, Journal of Petroleum Explotation and Production Technology, 2019, 9, 2927-2932. 141. M. Santander, D. Rodrigues & J. Rubio, Modified jet flotation in oil (petroleum) emulsion/water separations, Colloids and surface A: physicochemical and engineering aspects, 2011, 373, 237-244. 142. S.R. Peressutti, N.L. Olivera, P.A. Babay, M. Costagliola & H.M. Alvarez, Degradation of linear alkylbenzene sulfonate by a bacterial consortium isolated from the aquatic environment of Argentina, Journal of Applied Microbiology, 2008, 105 (2), 476-484. 143. R.A. Amer, M.M. Nasier & E.R. El Helow, Biodegradation of monocyclic aromatic hydrocarbons by a newly isolated Pseudomonas strain, Biotechnology, 2008, 7, 630-640. 144. L.M. Ramorobi, Biotranformation of alkylbenzenes and alkylcyclohexanes by genetically enginerred Yarrowia lipolytica strains, Thesis of Chemical enginerring, University of the free state Bloemfontein, South Africa, 2008. 145. D.M. Webley, R.B. Duff, V.C. Farmer, Evidence for ß-oxidation in the metabolism of saturated aliphatic hydrocarbons by soil species of Nocardia. Nature 1956, 178, 1467-1468. 146. M. Bhatia, D.H. Singh, Biodegradation of commercial linear alkyl benzenes by Nocardiaamarae, Journal of Biosciences, 1996, 21, 487-496. 147. G. Baggi, D. Catelani, E. Galli, V. Treccani, The microbial degrada-tion of phenylalkanes. 2-Phenylbutane, 3-phenylpentane, 3-phenyl-dodecane and 4- phenylheptane, Journal of Biochemistry, 1972, 126, 1091-1097. 108 PHỤ LỤC 1. Đặc điểm sinh học của các chủng vi sinh vật sử dụng Chủng vi sinh vật Hình ảnh khuẩn lạc Hình thái tế bào Mô tả Acinetobacter sp. QN1 Khuẩn lạc tròn, lồi, bề mặt bóng, mịn, màu trắng, đường kính 1-2mm. Tế bào hình que ngắn, 2 đầu tù, kích thước (0,6-0,7) x (0,9-1,2) µm. Gram (-). Bacillus sp. B8 Khuẩn lạc tròn, ướt, màu trắng ngà, đường kính 1,3- 1,5mm. Tế bào hình que, kích thước (0,3-0,5) x (0,8–1,2) µm, Gram (+) Rhodococcus sp. BN5 Khuẩn lạc tròn, lồi, ướt, màu vàng nghệ, đường kính 1,5-2mm. Tế bào hình bầu dục, kích thước (0,3 – 0,45) x (0,65-0,72) µm, Gram (+) Serratia sp. DX3 Khuẩn lạc tròn, lồi, bề mặt bóng, mịn, màu hồng, đường kính 1-2mm. Tế bào hình que ngắn, 1cm 1 cm 1 cm 1μm 1μm 1μm 1μm 1 cm 109 Chủng vi sinh vật Hình ảnh khuẩn lạc Hình thái tế bào Mô tả kích thước (0,3- 0,4) x (0,8–1) µm, Gram (-) Debaryomyces sp. QNN1 Khuẩn lạc tròn, lồi, màu trắng sữa, đường kính 2- 3mm. Tế bào có hình quả chanh, kích thước 1,5x2,6µm Debaryomyces sp. QN5 Khuẩn lạc tròn, lồi, hơi khô, trắng đục, đường kính 2- 3mm. Tế bào hình tròn, kích thước 2,1-2,6µm. 2. Kết quả khả năng tạo màng sinh học của các chủng vi sinh vật Hình 3.34. Khả năng tạo màng sinh học của các chủng vi sinh vật phân hủy dầu 3. Kết quả phân tích mẫu nước thải nhiễm dầu sau khi pha loãng 10 lần TT Chỉ tiêu thử nghiệm Đơn vị Hàm lượng 1 pH 7,7+0,01 2 SS (Chất rắn lơ lửng) mg/l 37,51+0,35 3 BOD5 (20oC) mg/l 1334,3+3,6 4 COD mg/l 2668,3+4,36 5 N (Tổng nitơ) mg/l 69,13+0,45 0,5cm 0,5cm 2μm 2μm 110 6 P (Tổng phospho) mg/l 20,26+0,14 7 Tổng dầu mỡ khoáng mg/l 67556,2+6,65 8 Phenol mg/l 90,7+1,53 9 PAH - Acenaphthylene - Fluorene - Phenanthrene - Anthracene - Fluoranthene - Pyrene - Benzo(k)fluoranthene mg/l 115,47+0,67 200,6+1,75 80,44+0,74 5,76+0,03 107,14+2,31 4,8+0,08 1,62+0,01 4. Kết quả phân tích nước thải nhiễm dầu trong mô hình 50 lít, vật liệu mang xốp mút sau 7 ngày Chỉ tiêu Lần thí nghiệm Lần 1 Lần 2 Lần 3 Dầu tổng số 9214,67 4627,6 3870,97 Phenol 24,38 25,23 24,59 Acenaphthylene 6,65 6,64 6,71 Fluorene 59,65 63,98 62,11 Phenanthrene 5,54 3,21 2,42 Anthracene 0,49 0,57 0,46 Fluoranthene 5,02 5,01 6,01 Pyrene 0,21 0,67 0,78 Benzo(k)fluoranthene 0,05 0,06 0,13 5. Kết quả phân tích nước thải nhiễm dầu trong mô hình 50 lít, vật liệu mang cellulose sau 7 ngày Chỉ tiêu Lần thí nghiệm Lần 1 Lần 2 Lần 3 Dầu tổng số 6539,44 3803,41 3526,43 Phenol 20,51 24,15 19,01 Acenaphthylene 6,47 6,94 7,07 111 Fluorene 52,41 61,68 55,66 Phenanthrene 1,56 2,34 2,45 Anthracene KPHĐ 0,42 0,22 Fluoranthene 1,64 0,27 2,08 Pyrene 0,21 KPHĐ 0,15 Benzo(k)fluoranthene 0,05 0,06 0,13 Ghi chú: KPHĐ (Không phát hiện được) 6. Kết quả phân tích nước thải nhiễm dầu trong mô hình 50 lít, vật liệu mang xơ dừa sau 7 ngày Chỉ tiêu Lần thí nghiệm Lần 1 Lần 2 Lần 3 Dầu tổng số KPHĐ 412,09 KPHĐ Phenol 10,23 12,63 16,45 Acenaphthylene KPHĐ KPHĐ KPHĐ Fluorene 4,85 6,67 6,87 Phenanthrene KPHĐ KPHĐ KPHĐ Anthracene KPHĐ KPHĐ KPHĐ Fluoranthene KPHĐ KPHĐ KPHĐ Pyrene KPHĐ KPHĐ KPHĐ Benzo(k)fluoranthene KPHĐ KPHĐ KPHĐ Ghi chú: KPHĐ (Không phát hiện được) 7. Kết quả phân tích nước thải nhiễm dầu trong mô hình 50 lít, vật liệu mang sỏi nhẹ sau 7 ngày Chỉ tiêu Lần thí nghiệm Lần 1 Lần 2 Lần 3 Dầu tổng số 1932,11 3837,19 3262,96 Phenol 19,22 19,41 19,39 Acenaphthylene 5,81 5,91 5,96 Fluorene 60,8 60,01 59,31 Phenanthrene 1,86 1,82 1,85 112 Anthracene KPHĐ KPHĐ KPHĐ Fluoranthene KPHĐ KPHĐ KPHĐ Pyrene KPHĐ KPHĐ KPHĐ Benzo(k)fluoranthene KPHĐ KPHĐ KPHĐ Ghi chú: KPHĐ (Không phát hiện được) 8. Kết quả phân tích nước thải nhiễm dầu trong mô hình 300 lít/mẻ sau 14 ngày Chỉ tiêu Lần thí nghiệm Lần 1 Lần 2 Lần 3 Dầu tổng số 13,51 KPHĐ 479,65 Phenol 10,76 13,09 14,54 Acenaphthylene KPHĐ KPHĐ KPHĐ Fluorene 4,27 6,78 6,98 Phenanthrene KPHĐ KPHĐ KPHĐ Anthracene KPHĐ KPHĐ KPHĐ Fluoranthene KPHĐ KPHĐ KPHĐ Pyrene KPHĐ KPHĐ KPHĐ Benzo(k)fluoranthene KPHĐ KPHĐ KPHĐ Ghi chú: KPHĐ (Không phát hiện được) 9. Kết quả phân tích nước thải nhiễm dầu trong hệ thống 20m3 Chỉ tiêu Hàm lượng (mg/l) 5 ngày 7 ngày 14 ngày Dầu tổng số 25454,56+1,22 11847,03+1,79 19,17+0,02 Phenol 272 + 1,77 0,2 + 0,01 Acenaphthylene 325 + 5,14 5,4 + 0,15 Fluorene 164 + 2,31 10,7 + 0,12 Phenanthrene 288 + 5,13 0,1 + 0,01 Anthracene 21,3 + 0,9 0 Flouranthene 47 + 0,32 0 Pyrene 13,6 + 0,31 0 Benzo(k)flouranthene 6,8 + 0,23 0 113 10. Hình ảnh các hệ thống thí nghiệm Hình 3.35. Mẫu nước thải ban đầu ở kho xăng dầu Đỗ Xá, Thường Tín, Hà Nội Biofilm Đối chứng Hình 3.36. Mô hình 50 lít sau 7 ngày xử lý bằng biofilm trên vật liệu mang mút xốp Biofilm Đối chứng Hình 3.37. Mô hình 50 lít sau 7 ngày xử lý bằng biofilm trên vật liệu mang cellulose Hình 3.38. Nước thải nhiễm dầu trước (a) và sau 7 ngày xử lý (b) ở mô hình 50 lít bằng biofilm vi sinh vật trên vật liệu mang xơ dừa a b 114 Biofilm Đối chứng Hình 3.39. Mô hình 50 lít sau 7 ngày xử lý bằng biofilm trên vật liệu mang sỏi nhẹ Hình 3.40. Thiết kế mô hình xử lý 300 lít/mẻ tại Trại thực nghiệm sinh học Cổ Nhuế - Viện Công nghệ sinh học, VAST (a) (b) Hình 3.41. Mô hình xử lý 300 lít/mẻ tại Trại thực nghiệm sinh học sau 14 ngày a, Mô hình xử lý bằng biofilm; b, Mô hình đối chứng (a) (b) Hình 3.42. Nước thải nhiễm dầu trước khi xử lý (a) và sau khi xử lý 14 ngày (b) 115 11. Trình tự đoạn gen ITS1, 5.8S rRNA, ITS2 của chủng B1 “GCTTATAACTATATCCACTTACACCTGTGACTGTTCTACTACTTGACGC AAGTCGAGTATTTTTACAAACAATGTGTAATGAACGTCGTTTTATTATAA CAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAG AACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATC ATCGAATCTTTGAACGCAGCTTGCGCTCTCTGGTATTCCGGAGAGCATG CCTGTTTCAGTGTCATGAAATCTCAACCACTAGGGTTTCCTAATGGATTG GATTTGGGCGTCTGCGATTTCTGATCGCTCGCCTTAAAAGAGTTAGCAA GTTTGACATTAATGTCTGGTGTAATAAGTTTCACTGGGTCCATTGTGTTG AAGCGTGCTTCTAATCGTCCGCAAGGACAATTACTTTGACTCTGGGCCT GAATCACGTAGGACTACCCGCTGACTTAGCATCATAAAAGCGGGAGGA”

Các file đính kèm theo tài liệu này:

  • pdfluan_an_nghien_cuu_kha_nang_phan_huy_mot_so_thanh_phan_hydro.pdf
  • pdf2. Tóm tắt luận án Eng. Tuân.pdf
  • pdf3. Tóm tắt luận án TV. Tuân.pdf
  • doc4. Đóng góp mới Luận án EN. Tuân.doc
  • doc5. Đóng góp mới luận án TV. Tuân.doc
  • docx6. Trích yếu luận án.docx
  • pdfĐóng góp mới.pdf
  • pdfQĐ.pdf
  • pdfTrích yếu.pdf
Luận văn liên quan