Nghiên cứu biểu hiện, tinh chế và bước đầu đánh giá đặc tính sinh học của interleukin - 11 người tái tổ hợp

Protein IL-11 được biểu hiện và tinh sạch từ tế bào E. coli Rosetta 2 dưới dạng dung hợp với SUMO. Để đánh giá đặc tính một cách chính xác cho protein IL-11 thì cần cắt chúng ra khỏi thể dung hợp đó. Enzyme có khả năng nhận biết đặc hiệu SUMO và cắt phân tử IL-11 ngay tại vị trí nối đó là SUMO protease 2. Theo lý thuyết, sản phẩm cắt sẽ gồm các phân tử IL-11, SUMO, một lượng nhỏ SUMO protease và protein SUMO-IL11 dư. Trong đó trừ protein IL-11, tất cả các phân tử còn lại đều chứa đuôi his-tag ở đầu N nên có thể lợi dụng sắc ký ái lực Ni-NTA để thu protein IL-11 từ dòng chảy phía dưới. Tuy nhiên khi kiểm tra hỗn hợp cắt 2 mg SUMO-IL11 lên cột Hitrap 1 ml và điện di mẫu protein IL-11 đi ra thì thấy rằng protein có nồng độ thấp và không đồng nhất

pdf179 trang | Chia sẻ: tueminh09 | Lượt xem: 1174 | Lượt tải: 0Freedownload
Bạn đang xem trước 20 trang tài liệu Nghiên cứu biểu hiện, tinh chế và bước đầu đánh giá đặc tính sinh học của interleukin - 11 người tái tổ hợp, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
is used to treat haematopoietic disorders. The recombinant human IL-11 was first approved by the FDA for prevention of severe thrombocytopenia and the reduction of the need for platelet transfusions following myelosuppressive chemotherapy in adult patients. This protein is formulated and sold to the market under a trade name of Neumega. Interleukin-11 is not easy to be expressed as monomer under the recombinant form. This reasons 127 why the publications on this type of cytokine are scattered and biocharacteristics of the protein have not been fully evaluated. In Vietnam, research on this interleukin is limited and has just been conducted at the Genetic Engineering Lab, Institute of Biotechnology. Therefore, the study to create a biosimilar as Neumega on the basis of the recombinant protein IL-11 is necessary in order to be active for production technology towards this cytokine for pharmaceutical uses. Although there are certain drawbacks, such as protein expression in inclusion body, endotoxin accumulation, limited protein secreting to the periplasm etc. Escherichia coli is still the most common recombinant protein expression system used today. This host has outstanding advantages over other complicated expression systems with simple handle, fast growth-rate, high cell density, inexpensive medium, recombinant protein up to 50% of total protein in case of suitable plasmid design. In application, E. coli is treated to be easy to receive recombinant plasmids, multiply and express the genes derived from Prokaryotic and Eukaryotic. Moreover, E. coli strains used in production are relatively safe, less harmful in humans and animals. In addition, the genetic and physiological characteristics of E. coli have been fully investigated. On the market, there are many types of vector and mutant strains for the purpose of cloning and gene expression such as E. coli BL21 (high protein expression); SoluBL21 (solubility improvement); Origami B (creation of oxidative environment for S = S bridge); JM109 (stable plasmid); BL21 CodonPlus-RIL, BL21 CodonPlus-RP, Rosetta (overcoming rare codon obstacles)... That is reason why E. coli is increasingly used to produce industrial and pharmaceutical proteins. The yeast strains of Pichia pastoris and Saccharomyces serevisae have some advantages over E. coli strain. They are able to express recombinant protein which is close to its natural form, less hydrolysis nor inclusion body formation. However, the yeasts usually express extracellular protein at a low productivity. In contrast, intracellular proteins expression in yeast are difficult to purify. In addition, the disadvantage of yeast cells is that it is difficult to break the cell wall. Compared to E. coli, the protein expression level in yeast is often lower. There are also fewer vector 128 types available for gene expression in yeast. In addition, there are other common expression system such as insect cells, CHO cells, BHK, genetically modified plants. These systems have the best apparatus for protein to arrange correctly. However, their main drawback is costly due to the long growing time, slow growth rate, expensive media etc. Therefore, it is neccessary to choose an appropriate gene expression system. Aim of the study - Expressing the recombinant human IL-11 in Escherichia coli. - Purifying the recombinant IL-11 protein to meet the requirement as an injection product. - Initially evaluating biocharacteristics of the recombinant IL-11 protein. Research contents: 1. Expressing recombinant human IL-11 protein in E. coli: (i) Cloning gene encoded for IL-11 protein; (ii) Expressing the recombinant IL-11 protein in E. coli and improving its expression level; 2. Producing a product of recombinant IL-11 protein which cab be use as a drug: (i) Purifying of IL-11 protein from E. coli; (ii) Evaluating the purified IL-11 samples; (iii) Formulating, endotoxin removing and free-drying the IL-11 product. 3. Initially evaluating the biological characteristics of the recombinant protein such as the proliferation on TF-1 cell line and its safety on animal models (mice, rat, and rabbit). Results: A nucleotite sequence encoding for mature IL-11 of human without proline (177 amino acid) was cloned into three expression vectors named pET22_il-11 (without codon modification), pET22_il-11opt (codon modification) and pSUMO_il-11opt (codon modification). After transformation into E. coli BL21, JM 109, Rosetta 2 and SoluBL21 by heat shock and screening for protein expression, both of the first constructs expressed the recombinant IL-11 protein at a very low level. This protein 129 has molecular mass of about 19 kDa which was hardly seen on Coomassie gel but on PVDF as a faint band. However, the third construct of pSUMO_il-11opt expressed a fusion protein of SUMO-IL11 with a molecular mass of about 36 kDa in E. coli Rosetta 2 (both seen on Coomassie gel and PVDF membrane). The IL-11 protein is known as one of the most difficult expression proteins due to its high isoelectric point (pI = 11,6). By gene contruction with SUMO expression system, the expression of SUMO-IL11 level was improved significantly in comparision with the first two constructs. Especially, SUMO-IL11 protein expressed as soluble form in cytoplasm of E. coli Rossetta 2 that would favor for purification and maintenance of biological activity. Different factors affected on SUMO-IL11 expression in E. coli Rossetta 2 were tested in shake flasks to push up SUMO-IL11 product via high cell density. Under screened conditions such as TB medium, pH 7, 0.05 mM IPTG at 37 o C, induction at a cell density of OD600 ≈ 2, length of induction of 7 hours, SUMO-IL11 productivity reached to 1.43 g/l cell culture by ELISA (14.3-fold higher than the initial fermentation conditions). The cell density increased over 9 folds. The SUMO-IL11 protein was purified successfully by affinity chromatography using a XK26 column (Amersharm) containing 50 ml of Ni-NTA. Amount of SUMO-IL11 in total eluates was 88.61 mg, accordingly 0.71 g/l culture medium. SUMO-IL11 was subjected to a home-made SUMO protease 2 resulted in SUMO protein (17 kDa) and IL-11 protein (19 kDa). The IL-11 protein was then collected from the enzymatic reaction as inclusion form by centrifugation. These pellets were recovered as soluble form by dissolving in a suitable buffer containing 10 mM sodium phosphate, 300 mM glycine, 1% sucrose, tween-20 0.02%, 10 mM methionine, 20 mM histidine, pH 7. From 88.75 mg of SUMO-IL11 protein, 38 mg IL-11 was collected. The recovery yield of IL-11 from fermentation and purification steps was 34.68%. The IL-11 protein was more than 99% pure assessed by SDS-PAGE, QuantityOne and gel filtration. The endotoxin in the IL-11 protein was removed 130 efficiently by ultrafiltration using an Ultracel membrane having 30 kDa cut-off (Millipore, USA) in combination with 0.05 to 0.1 mM Ca 2+ . Endotoxin level in the resulting IL-11 protein tested by LAL test was lower than threshold set by US Pharmacopoeia and Neumega (<175 EU/dose of 5 mg protein). The recombinant IL- 11 protein was lyophilised in a smooth, uniformly and white powder. When reconstituted with distilled water, the entire mass dissolved completely into a clear solution. There was no significant change in IL-11 content prior and after lyophilization. The protein was observed not to be broken down into small bands on the Coomassie brilliant blue gel. By a proliferation assay on the TF-1 cell line, the specific bioactivity of the IL- 11 product was determined to be 4.17x10 5 IU/mg. By administering 50 µg/kg subcutaneous dose on the clinical trials in mice, rats and rabbits (including extrapolative coefficient), the recombinant IL-11 protein was proved to be safe with no signs of acute toxicity, subacute toxicity, temperature rise. The protein also has general safety on mice and guinea pig. All assessments of general condition, weight, hematopoietic function, liver function, liver cell destruction, kidney function, histopathology of liver and kidney are within the normal range. There were no significant differences between the treatment groups and control group. In conclusion, the study demonstrated that the recombinant human IL-11 was produced efficiently in E. coli Rosetta 2 using a fusion SUMO system. The IL-11 protein was purified successfully from the crude exxtract by a single step and split from SUMO by a home-made SUMO protease. It suggests a feasibility and large- scale production of the protein for pharmaceutics. The resulting IL-11 product showed to stimulate the TF-1 cell line proliferation. The animal trials with subcutaneous injections of the IL-11 protein have fulfiled the safety test. Therefore, this purified protein produced in bacterial expression system may act as an promising cadidate for hematopoiectic pharmaceutics. 131 TÀI LIỆU THAM KHẢO 1. Adrio JL, Demain AL (2010) Recombinant organisms for production of industrial products. Bioeng Bugs 1: 116–131. 2. Agathos SN (1991) Production scale insect cell culture. Biotechnol Adv 9: 51– 68. 3. Aguilar MI, Hearn MT (1996) High-resolution reversed-phase high- performance liquid chromatography of peptides and proteins. Methods Enzymol 270: 3–26 4. Ahmed N, Khan MA, Shahid N, Nasir IA, Zafar AU (2011) One step purification of biological active human interleukin-2 protein produced in yeast: Pichia Pastoris. Afr J Biotechnol 10: 15170–15178. 5. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (2003) Current Protocols in Molecular Biology. John Wiley & Sons, Inc. 6. Avecilla ST, Hattori K, Heissig B, Tejada R, Liao F, Shido K, Jin DK, Dias S, Zhang F, Hartman TE, et al. (2004) Chemokine-mediated interaction of hematopoietic progenitors with the bone marrow vascular niche is required for thrombopoiesis. Nat Med 10: 64–71. 7. Baneyx F (1999) Recombinant protein expression in Escherichia coli. Curr Opin Biotechnol 10: 411–421. 8. Barton VA, Hall MA, Hudson KR, Heath JK (2000) Interleukin-11 signals through the formation of a hexameric receptor complex. J Biol Chem 275: 36197–36203. 9. Basu A, Li X, Leong SSJ (2011) Refolding of proteins from inclusion bodies: rational design and recipes. Appl Microbiol Biotechnol 92: 241–251. 10. Berlec A, Strukelj B (2013) Current state and recent advances in biopharmaceutical production in Escherichia coli, yeasts and mammalian cells. J Ind Microbiol Biotechnol 40: 257–274. 132 11. Bhatia M, Davenport V, Cairo MS (2007) The role of interleukin-11 to prevent chemotherapy-induced thrombocytopenia in patients with solid tumors, lymphoma, acute myeloid leukemia and bone marrow failure syndromes. Leuk Lymphoma 48: 9–15. 12. Bhopale GM, Nanda (2005) Recombinant DNA expression products for human therapeutic use. Current Science 89. 13. Bird LE (2011) High throughput construction and small scale expression screening of multi-tag vectors in Escherichia coli. Methods San Diego Calif 55: 29–37. 14. Bis RL, Stauffer TM, Singh SM, Lavoie TB, Mallela KMG (2014) High yield soluble bacterial expression and streamlined purification of recombinant human interferon α-2a. Protein Expr Purif 99: 138–146. 15. Blommel PG, Becker KJ, Duvnjak P, Fox BG (2007) Enhanced bacterial protein expression during auto-induction obtained by alteration of lac repressor dosage and medium composition. Biotechnol Prog 23: 585–598. 16. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254. 17. Burnette WN (1981) “Western blotting”: electrophoretic transfer of proteins from sodium dodecyl sulfate--polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal. Biochem 112: 195–203. 18. Bussel JB, Mukherjee R, Stone AJ (2001) A pilot study of rhuIL-11 treatment of refractory ITP. Am J Hematol 66: 172–177. 19. Butt TR, Edavettal SC, Hall JP, Mattern MR (2005) SUMO fusion technology for difficult-to-express proteins. Protein Expr Purif 43: 1–9. 20. Cairo MS, Davenport V, Bessmertny O, Goldman SC, Berg SL, Kreissman SG, Laver J, Shen V, Secola R, van de Ven C, et al. (2005) Phase I/II dose escalation study of recombinant human interleukin-11 following ifosfamide, 133 carboplatin and etoposide in children, adolescents and young adults with solid tumours or lymphoma: a clinical, haematological and biological study. Br. J. Haematol. 128: 49–58. 21. Carrington JC, Cary SM, Parks TD, Dougherty WG (1989) A second proteinase encoded by a plant potyvirus genome. Embo J 8: 365–370. 22. Catanzariti AM, Soboleva TA, Jans DA, Board PG, Baker RT (2004) An efficient system for high-level expression and easy purification of authentic recombinant proteins. Protein Sci Publ Protein Soc 13: 1331–1339. 23. Cereghino JL, Cregg JM (2000) Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol Rev 24: 45–66. 24. Choi JH, Lee SY (2004) Secretory and extracellular production of recombinant proteins using Escherichia coli. Appl Microbiol Biotechnol 64: 625–635. 25. Chou CP (2007) Engineering cell physiology to enhance recombinant protein production in Escherichia coli. Appl Microbiol Biotechnol 76: 521–532 26. Costa S, Almeida A, Castro A, Domingues L (2014) Fusion tags for protein solubility, purification and immunogenicity in Escherichia coli: the novel Fh8 system. Front. Microbiol 5: 63. 27. Cotreau MM, Stonis L, Strahs A, Schwertschlag US (2004) A multiple-dose, safety, tolerability, pharmacokinetics and pharmacodynamic study of oral recombinant human interleukin-11 (oprelvekin). Biopharm Drug Dispos 25: 291–296. 28. Cregg JM, Cereghino JL, Shi J, Higgins DR (2000) Recombinant protein expression in Pichia pastoris. Mol Biotechnol 16: 23–52. 29. Czupryn MJ, McCoy JM, Scoble HA (1995). Structure-function relationships in human interleukin-11: Identification of regions involved in activity by chemical modification and site-directed mutagenesis. J Biol Chem 270: 978– 985. 134 30. Dams-Kozlowska H, Gryska K, Kwiatkowska-Borowczyk E, Izycki D, Rose- John S, Mackiewicz A (2012) A designer hyper interleukin 11 (H11) is a biologically active cytokine. BMC Biotechnol 12: 8. 31. Demain AL, Vaishnav P (2009) Production of recombinant proteins by microbes and higher organisms. Biotechnol Adv 27: 297–306. 32. Deutsch VR, Tomer A (2006) Megakaryocyte development and platelet production. Br J Haematol 134: 453–466. 33. Dimitrov D (2012) Therapeutic Proteins. Humana Press: 1–26. 34. Doherty AJ, Connolly BA, Worrall AF (1993) Overproduction of the toxic protein, bovine pancreatic DNaseI, in Escherichia coli using a tightly controlled T7-promoter-based vector. Gene 136: 337–340. 35. Du X, Williams DA (1997) Interleukin-11: review of molecular, cell biology, and clinical use. Blood 89: 3897–3908. 36. Du XX, Williams DA (1994) Interleukin-11: a multifunctional growth factor derived from the hematopoietic microenvironment. Blood 83: 2023–2030. 37. Du XX, Neben T, Goldman S, Williams DA (1993) Effects of recombinant human interleukin-11 on hematopoietic reconstitution in transplant mice: acceleration of recovery of peripheral blood neutrophils and platelets. Blood 81: 27–34. 38. Du XX, Doerschuk CM, Orazi A, Williams DA (1994) A bone marrow stromal-derived growth factor, interleukin-11, stimulates recovery of small intestinal mucosal cells after cytoablative therapy. In Blood: 33–37. 39. Ersson B, Rydén L, Janson JC (1998) Introduction to protein purification. In Protein Purification. Wiley-VCH: pp. 1–40. 40. Farajnia S, Hassanpour R, Lotfipour F (2010) Cloning and expression of human IL-11 in E. coli. Pharm Sci: 353–359. 41. Ferrer M, Chernikova TN, Yakimov MM (2003). Chaperonins govern growth of Escherichia coli at low temperatures. Nat Biotechnol 21: 1266–1267. 135 42. Fischer R, Stoger E, Schillberg S, Christou P, Twyman RM (2004) Plant- based production of biopharmaceuticals. Curr Opin Plant Biol 7: 152–158. 43. Fuhrer DK, Yang YC (1996) Activation of Src-family protein tyrosine kinases and phosphatidylinositol 3-kinase in 3T3-L1 mouse preadipocytes by interleukin-11. Exp Hematol 24: 195–203. 44. Gao X, Chen W, Guo C, Qian C, Liu G, Ge F, Huang Y, Kitazato K, Wang Y, Xiong S (2010) Soluble cytoplasmic expression, rapid purification, and characterization of cyanovirin-N as a His-SUMO fusion. Appl Microbiol Biotechnol 85: 1051–1060. 45. Garbers C, Scheller J (2013) Interleukin-6 and interleukin-11: same same but different. Biol Chem 394: 1145–1161. 46. Ghalib R, Levine C, Hassan M, McClelland T, Goss J, Stribling R, Seu P, Patt YZ (2003) Recombinant human interleukin-11 improves thrombocytopenia in patients with cirrhosis. Hepatology 37: 1165–1171. 47. Gordon, MS, McCaskill-Stevens WJ, Battiato LA, Loewy J, Loesch D, Breeden E, Hoffman R, Beach KJ, Kuca B, Kaye J, et al. (1996) A phase I trial of recombinant human interleukin-11 (neumega rhIL-11 growth factor) in women with breast cancer receiving chemotherapy. Blood 87: 3615–3624 48. di Guan C, Li P, Riggs PD, Inouye H (1988) Vectors that facilitate the expression and purification of foreign peptides in Escherichia coli by fusion to maltose-binding protein. Gene 67: 21–30. 49. Guengerich FP, Gillam EM, Ohmori S, Sandhu P, Brian WR, Sari MA, Iwasaki, M (1993) Expression of human cytochrome P450 enzymes in yeast and bacteria and relevance to studies on catalytic specificity. Toxicology 82: 21–37. 50. Gustafsson C, Govindarajan S, Minshull J (2004) Codon bias and heterologous protein expression. Trends Biotechnol 22: 346–353. 51. Hagel L (2001) Gel-filtration chromatography Curr Protoc Mol Biol Chapter 10: Unit 10.9. 136 52. Han W, Zhang Y, Yan Z, Shi J (2003) Construction of a new tumour necrosis factor fusion-protein expression vector for high-level expression of heterologous genes in Escherichia coli. Biotechnol Appl Biochem 37: 109–113. 53. Hangoc G, Yin T, Cooper S, Schendel P, Yang YC, Broxmeyer HE (1993) In vivo effects of recombinant interleukin-11 on myelopoiesis in mice. In Blood: 965–972. 54. Hatano S, Asano H, Nagai H, Murate T, Mori N, Kawashima K, Saito H, Kinoshita T (2002) In vitro effects of recombinant human IL-11 on human malignant lymphoma cells. J Clin Exp Hematop 42: 55–60. 55. Hawley RG, Fong AZC, Ngan BY, de Lanux VM, Clark SC, Hawley TS (1993) Progenitor cell hyperplasia with rare development of myeloid leukemia in interleukin 11 bone marrow chimeras. J Exp Med 178: 1175–1188. 56. Hermann JA, Hall MA, Maini RN, Feldmann M, Brennan FM (1998) Important immunoregulatory role of interleukin-11 in the inflammatory process in rheumatoid arthritis. Arthritis Rheum 41: 1388–1397. 57. Huang Y, Su Z, Li Y, Zhang Q, Cui L, Su Y, Ding C, Zhang M, Feng C, Tan Y, et al. (2009) Expression and Purification of glutathione transferase-small ubiquitin-related modifier-metallothionein fusion protein and its neuronal and hepatic protection against D-galactose-induced oxidative damage in mouse model. J Pharmacol Exp Ther 329: 469–478. 58. Ishihara K, Hirano T (2002) Molecular basis of the cell specificity of cytokine action. Biochim Biophys Acta 1592: 281–296. 59. Italiano JE, Lecine P, Shivdasani RA, Hartwig JH (1999) Blood platelets are assembled principally at the ends of proplatelet processes produced by differentiated megakaryocytes. J Cell Biol 147: 1299–1312. 60. Janson JC, Rydéns L (1998) Protein purification: Principles, high resolution methods, and application. Wiley-VCH, second edition: 1-679. 137 61. Jenny RJ, Mann KG, Lundblad RL (2003) A critical review of the methods for cleavage of fusion proteins with thrombin and factor Xa. Protein Expr Purif 31: 1–11. 62. Jia D, Yang H, Wan L, Cheng J, Lu X (2012) Production of bioactive, SUMO- modified, and native-like TNF-α of the rhesus monkey, Macaca mulatta, in Escherichia coli. Appl Microbiol Biotechnol 93: 2345–2355. 63. Johnson ES, Blobel G (1999) Cell cycle-regulated attachment of the ubiquitin- related protein SUMO to the yeast septins. J Cell Biol 147, 981–994. 64. Johnstone CN, Chand A, Putoczki TL, Ernst M (2015) Emerging roles for IL- 11 signaling in cancer development and progression: Focus on breast cancer. Cytokine Growth Factor Rev 26: 489–498. 65. Joseph BC, Pichaimuthu S, Srimeenakshi S, Murthy M, Selvakumar K, Ganesan M, Manjunath SR (2015) An overview of the parameters for recombinant protein expression in Escherichia coli. J Cell Sci Ther 6: 1–7. 66. Kane JF (1995) Effects of rare codon clusters on high-level expression of heterologous proteins in Escherichia coli. Curr Opin Biotechnol 6: 494–500. 67. Karlsson E, Rydén L, Brewer J (1998) Ion exchange chromatography. In Protein Purification, Wiley-VCH, second edition: 145–205. 68. Kawashima I, Ohsumi J, Mita-Honjo K, Shimoda-Takano K, Ishikawa H, Sakakibara S, Miyadai K, Takiguchi Y (1991) Molecular cloning of cDNA encoding adipogenesis inhibitory factor and identity with interleukin-11. FEBS Lett 283: 199–202. 69. Kaye JA (1998) FDA licensure of NEUMEGA to prevent severe chemotherapy-induced thrombocytopenia. Stem Cells Dayt Ohio 16 Suppl 2: 207–223. 70. Kong B, Guo GL (2011) Enhanced in vitro refolding of fibroblast growth factor 15 with the assistance of SUMO fusion partner. PloS One 6: e20307. 71. LaVallie ER, DiBlasio EA, Kovacic S, Grant KL, Schendel PF, McCoy JM (1993) A thioredoxin gene fusion expression system that circumvents 138 inclusion body formation in the E. coli cytoplasm. Biotechnol Nat Publ Co 11: 187–193. 72. Lee SJ, Lee SY (2002) Efficient high-level production of spider silk protein by fed-batch cultivation of recombinant Escherichia coli and its purification. Theories and Applications of Chem Eng 8: 246–359. 73. Lee CD, Sun HC, Hu SM, Chiu CF, Homhuan A, Liang SM, Leng CH, Wang TF (2008) An improved SUMO fusion protein system for effective production of native proteins. Protein Sci Publ Protein Soc 17: 1241–1248. 74. Lee CD, Yan YP, Liang SM, Wang TF (2009) Production of FMDV virus-like particles by a SUMO fusion protein approach in Escherichia coli. J Biomed Sci 16: 69. 75. Léon A, Wang XM, Champion-Arnaud P, Sobczyk A, Pain B, Content J, Jacques Y, Valarché I (2005) Expression of a bioactive recombinant human interleukin-11 in chicken HD11 cell line. Cytokine 30: 382–390. 76. Leonard JP, Quinto CM, Kozitza MK, Neben TY, Goldman SJ (1994) Recombinant human interleukin-11 stimulates multilineage hematopoietic recovery in mice after a myelosuppressive regimen of sublethal irradiation and carboplatin. Blood 83: 1499–1506. 77. Levin J, Bang FB (1968) Clottable protein in Limulus: its localization and kinetics of its coagulation by endotoxin. Thromb Diath Haemorrh 19: 186– 197. 78. Li H, Li N, Gao X, Kong X, Li S, Xu A, Jin S, Wu D (2011a) High level expression of active recombinant human interleukin-3 in Pichia pastoris. Protein Expr Purif 80: 185–193. 79. Li H, Wang Y, Xu A, Li S, Jin S, Wu D (2011b) Large-scale production, purification and bioactivity assay of recombinant human interleukin-6 in the methylotrophic yeast Pichia pastoris. FEMS Yeast Res 11: 160–167. 139 80. Li JF, Cui XW, Ji HY, Qiu T, Ji XM, Du MX, Wu HT, Xu XZ, Zhang SQ (2011c). High efficient expression of bioactive human BMP-14 in E. coli using SUMO fusion partner. Protein J 30: 592–597. 81. Ma JKC, Drake PMW, Christou P (2003). The production of recombinant pharmaceutical proteins in plants. Nat Rev Genet 4: 794–805. 82. Ma Q, Yu Z, Han B, Wang Q, Zhang R (2012) Expression and purification of lacticin Q by small ubiquitin-related modifier fusion in Escherichia coli. J Microbiol Seoul Korea 50: 326–331. 83. Magalhães PO, Lopes AM, Mazzola PG, Rangel-Yagui C, Penna TC, Pessoa, AJ (2007) Methods of endotoxin removal from biological preparations: a review. J Pharm Pharm Sci 10: 388–404. 84. Makrides SC (1996) Strategies for achieving high-level expression of genes in Escherichia coli. Microbiol Rev 60: 512–538. 85. Malakhov MP, Mattern MR, Malakhova OA, Drinker M, Weeks SD, Butt TR (2004) SUMO fusions and SUMO-specific protease for efficient expression and purification of proteins. J Struct Funct Genomics 5: 75–86. 86. Mant CT, Hodges RS (1996) Analysis of peptides by high-performance liquid chromatography. Methods Enzymol 271: 3–50. 87. Marblestone JG, Edavettal SC, Lim Y, Lim P, Zuo X, Butt TR (2006) Comparison of SUMO fusion technology with traditional gene fusion systems: enhanced expression and solubility with SUMO. Protein Sci Publ Protein Soc 15: 182–189. 88. Martich GD, Boujoukos AJ, Suffredini AF (1993) Response of man to endotoxin. Immunobiology 187: 403–416. 89. Matakas JD, Balan V, Carson WF, Gao D (2013) Plant-produced recombinant human interleukin-2 and its activity against splenic CD4 + T-cells. Int J LifeSc Bt & Pharm Res 2: 192–203. 140 90. McKinley D, Wu Q, Yang-Feng T, Yang YC (1992) Genomic sequence and chromosomal location of human interleukin-11 gene (IL11). Genomics 13: 814–819. 91. Menzella HG (2011) Comparison of two codon optimization strategies to enhance recombinant protein production in Escherichia coli. Microb Cell Factories 10: 15. 92. Moreland L, Gugliotti R, King K, Chase W, Weisman M, Greco T, Fife R, Korn J, Simms R, Tesser J et al. (2001) Results of a phase-I/II randomized, masked, placebo-controlled trial of recombinant human interleukin-11 (rhIL- 11) in the treatment of subjects with active rheumatoid arthritis. Arthritis Res 3: 247–252. 93. Morris JC, Neben S, Bennett F, Finnerty H, Long A, Beier DR, Kovacic S, McCoy JM, DiBlasio-Smith E, La Vallie ER, et al (1996) Molecular cloning and characterization of murine interleukin-11. Exp Hematol 24: 1369–1376. 94. Mossessova E, Lima CD (2000) Ulp1-SUMO crystal structure and genetic analysis reveal conserved interactions and a regulatory element essential for cell growth in yeast. Mol Cell 5: 865–876. 95. Musashi M, Clark SC, Sudo T, Urdal DL, Ogawa M (1991) Synergistic interactions between interleukin-11 and interleukin-4 in support of proliferation of primitive hematopoietic progenitors of mice. Blood 78: 1448– 1451. 96. Nausch H, Huckauf J, Koslowski R, Meyer U, Broer I, Mikschofsky H (2013). Recombinant production of human interleukin 6 in Escherichia coli. PloS One 8: e54933. 97. Neben TY, Loebelenz J, Hayes L, McCarthy K, Stoudemire J, Schaub R, Goldman SJ (1993) Recombinant human interleukin-11 stimulates megakaryocytopoiesis and increases peripheral platelets in normal and splenectomized mice. Blood 81: 901–908. 141 98. Nelson LL (1978) Removal of pyrogens from parenteral solutions by ultrafiltration. Pharm Technol 2: 46–52. 99. OECD (2008) Test No. 407: Repeated Dose 28-day Oral Toxicity Study in Rodents (Paris: Organisation for Economic Co-operation and Development). 100. Orazi A, Cooper R, Tong J, Gordon MS, Battiato L, Sledge GW, Kaye J, Hoffman R (1993) Recombinant human interleukin-11 (NeumegaTM rhIL-11 growth factor: rhIL-11) has multiple profound effects on human hematopoiesis. In Blood. 101. Pang L, Weiss MJ, Poncz M (2005) Megakaryocyte biology and related disorders J Clin Invest 115: 3332–3338. 102. Pearson FC (1985) Pyrogens: Endotoxins, LAL Testing, and depyrogenation. Journal of Pharmaceutical Science 75: 822–823. 103. Peciak K, Tommasi R, Choi J, Brocchini S, Laurine E (2014) Expression of soluble and active interferon consensus in SUMO fusion expression system in E. coli. Protein Expr Purif 99: 18–26. 104. Petsch D, Anspach FB (2000) Endotoxin removal from protein solutions. J. Biotechnol 76: 97–119. 105. Pugsley AP, Francetic O, Driessen AJ, de Lorenzo V (2004) Getting out: protein traffic in prokaryotes. Mol Microbiol 52: 3–11. 106. Putoczki T, Ernst M (2010) More than a sidekick: the IL-6 family cytokine IL- 11 links inflammation to cancer. J Leukoc Biol 88: 1109–1117. 107. Putoczki TL, Dobson RCJ, Griffin MDW (2014) The structure of human interleukin-11 reveals receptor-binding site features and structural differences from interleukin-6. Acta Crystallogr D Biol Crystallogr 70: 2277–2285. 108. Rietschel ET. Kirikae T, Schade FU, Mamat U, Schmidt G, Loppnow H, Ulmer AJ, Zähringer U, Seydel U, Di Padova F, et al. (1994) Bacterial endotoxin: molecular relationships of structure to activity and function. FASEB J 8: 217–225. 142 109. Rosano GL, Ceccarelli EA (2014) Recombinant protein expression in Escherichia coli: advances and challenges. Front Microbiol 5. 110. Sadeghi A, Mahdieh M, Salimi S (2016) Production of Recombinant Human Interleukin-11 (IL-11) in Transgenic Tobacco (Nicotiana tabacum) Plants. J Plant Biotechnol 43: 432–437. 111. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press. 112. Sands BE, Winston BD, Salzberg B, Safdi M, Barish C, Wruble L, Wilkins R, Shapiro M, Schwertschlag US, RHIL-11 Crohn’s Study group (2002) Randomized, controlled trial of recombinant human interleukin-11 in patients with active Crohn’s disease. Aliment Pharmacol Ther 16: 399–406. 113. Satakarni M, Curtis R (2011) Production of recombinant peptides as fusions with SUMO. Protein Expr Purif 78: 113–119. 114. Schindler M, Osborn MJ (1979) Interaction of divalent cations and polymyxin B with lipopolysaccharide. Biochemistry Mosc 18: 4425–4430. 115. Schwertschlag US, Trepicchio WL, Dykstra KH, Keith JC, Turner KJ, Dorner AJ (1999) Hematopoietic, immunomodulatory and epithelial effects of interleukin-11. Leukemia 13: 1307–1315. 116. Sedov SA, Belogurova NG, Shipovskov S, Levashov AV, Levashov PA (2011). Lysis of Escherichia coli cells by lysozyme: discrimination between adsorption and enzyme action. Colloids Surf B Biointerfaces 88: 131–133. 117. Sengupta P, Meena K, Mukherjee R, Jain SK, Maithal K (2008) Optimized conditions for high-level expression and purification of recombinant human interleukin-2 in E. coli. Indian J Biochem Biophys 45: 91–97. 118. Sokolov AS, Kazakov AS, Solovyev VV, Ismailov RG, Uversky VN, Lapteva YS, Mikhailov RV, Pavlova EV, Terletskaya IO, Ermolina LV, et al (2016) Expression, purification, characterization of Interleukin-11 orthologues. Mol Basel Switz 21. 143 119. Sorensen HP, Mortensen KK (2005) Advanced genetic strategies for recombinant protein expression in Escherichia coli. J Biotechnol 115: 113– 128. 120. Souto RB, Stamm FP, Ribela MT, de CP, Bartolini P, Calegari GZ, Dalmora SL (2012) Validation of a stability-indicating RP-LC method for the assessment of recombinant human interleukin-11 and its correlation with bioassay. Anal Sci Int J Jpn Soc Anal Chem 28: 215–220. 121. Studier FW, Rosenberg AH, Dunn JJ, Dubendorff JW (1990) Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol 185: 60– 89. 122. Sweadner KJ, Forte M, Nelsen LL (1977) Filtration removal of endotoxin (pyrogens) in solution in different states of aggregation. Appl Environ Microbiol 34: 382–385. 123. Taga T (1997) The signal transducer gp130 is shared by interleukin-6 family of haematopoietic and neurotrophic cytokines. Ann Med 29: 63–72. 124. Tan H, Dan G, Gong H, Cao L (2005) Purification and characterization of recombinant truncated human interleukin-11 expressed as fusion protein in Escherichia coli. Biotechnol Lett 27: 905–910. 125. Tatham MH, Jaffray E, Vaughan OA, Desterro JM, Botting CH, Naismith JH, Hay RT (2001) Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J Biol Chem 276: 35368–35374. 126. Teramura M, Kobayashi S, Hoshino S, Oshimi K, Mizoguchi H (1992) Interleukin-11 enhances human megakaryocytopoiesis in vitro. Blood 79: 327– 331. 127. Terpe K (2006) Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems. Appl Microbiol Biotechnol 72: 211–222. 128. Tsuji K, Lyman SD, Sudo T, Clark SC, Ogawa M (1992) Enhancement of murine hematopoiesis by synergistic interactions between steel factor (ligand 144 for c-kit), interleukin-11, and other early acting factors in culture. Blood 79: 2855–2860. 129. Turner PV, Brabb T, Pekow C, Vasbinder MA (2011) Administration of Substances to Laboratory Animals: Routes of Administration and Factors to Consider. J Am Assoc Lab Anim Sci JAALAS 50: 600–613. 130. Wagner S, Klepsch MM, Schlegel S, Appel A, Draheim R, Tarry M, Högbom M, van Wijk KJ, Slotboom DJ, Persson JO, et al (2008) Tuning Escherichia coli for membrane protein overexpression. Proc Natl Acad Sci U. S. A. 105: 14371–14376. 131. Walsh G (2010) Biopharmaceutical benchmarks 2010. Nat Biotechnol 28: 917–924. 132. Wang C, Castro AF, Wilkes DM, Altenberg GA (1999) Expression and purification of the first nucleotide-binding domain and linker region of human multidrug resistance gene product: comparison of fusions to glutathione S- transferase, thioredoxin and maltose-binding protein. Biochem J 338: 77–81. 133. Wang H, Xiao Y, Fu L, Zhao H, Zhang Y, Wan X, Qin Y, Huang Y, Gao H, Li X (2010) High-level expression and purification of soluble recombinant FGF21 protein by SUMO fusion in Escherichia coli. BMC Biotechnol 10: 14. 134. Wang Z, Li N, Wang Y, Wu Y, Mu T, Zheng Y, Huang L, Fang X (2012) Ubiquitin-intein and SUMO2-intein fusion systems for enhanced protein production and purification. Protein Expr Purif 82: 174–178. 135. Warne NW, Ingram RL, Macmillan S (2006) Formulations for IL-11. US7033992 B2. 136. Waugh DS (2011) An overview of enzymatic reagents for the removal of affinity tags. Protein Expr Purif 80: 283–293. 137. Weich NS, Wang A, Fitzgerald M, Neben TY, Donaldson D, Giannotti J, Yetz-Aldape J, Leven RM, Turner KJ (1997) Recombinant human interleukin- 11 directly promotes megakaryocytopoiesis in vitro. Blood 90: 3893–3902. 145 138. Whetstone PA, Butlin NG, Corneillie TM, Meares CF (2004) Element-coded affinity tags for peptides and proteins. Bioconjug Chem 15: 3–6. 139. Xu XJ, Niu XM, Guo ZW, He HQ, Qiu DF, Liu C, Lin SH, Song K, Ren ZJ, Li WC, et al. (2011) Effects of recombinant human interleukin 11 on hematological malignancy after allogeneic hematopoietic cell transplantation. 91: 100–102. 140. Yang G, Ma F, Zhong M, Fang L, Peng Y, Xin X, Zhong J, Zhu W, Zhang Y (2014) Interleukin-11 induces the expression of matrix metalloproteinase 13 in gastric cancer SCH cells partly via the PI3K-AKT and JAK-STAT3 pathways. Mol Med Rep 9: 1371–1375. 141. Yin J, Li G, Ren X, Herrler G (2007) Select what you need: a comparative evaluation of the advantages and limitations of frequently used expression systems for foreign genes. J Biotechnol 127: 335–347. 142. Yonemura Y, Kawakita M, Masuda T, Fujimoto K, Kato K, Takatsuki K (1992) Synergistic effects of interleukin 3 and interleukin 11 on murine megakaryopoiesis in serum-free culture. Exp Hematol 20: 1011–1016. 143. Yuzhalin AE, Kutikhin AG (2014) Interleukins in cancer biology: Thier heterogeneous role. Elsevier. 144. Zhang QR. (2004) Progress on research and clinical application of interleukin- 11 in treatment of leukemia-review. J Exp Hematol Chin Assoc Pathophysiol 12: 718–720. 145. Zhang CC, Lodish HF (2008) Cytokines regulating hematopoietic stem cell function. Curr Opin Hematol 15: 307–311. 146. Zhu F, Wang Q, Pu H, Gu S, Luo L, Yin Z (2013) Optimization of soluble human interferon-γ production in Escherichia coli using SUMO fusion partner. World J Microbiol Biotechnol 29: 319–325. 147. www.lookfordiagnosis.com 148. www2.nau.edu/~fpm/immunology/lectures/Chapter012.pdf 1 PHỤ LỤC Phụ lục 1: Trình tự cassette biểu hiện gen il-11 đƣợc thiết kế và đặt tổng hợp gồm: NdeI/pelB/gen il-11/NotI. Ký tự gạch chân là trình tự lần lượt của NdeI và NotI. Ký tự in đậm là trình tự của tín hiệu tiết pelB (66 nucleotit). Phần còn lại là gen il-11 (Nu 203-733: 531 Nu chưa kể bộ ba kết thúc). AGGCCATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGC CGGCGATGGCCGGGCCACCACCTGGCCCCCCTCGAGTTTCCCCAGACCCTCGGGCCGA GCTGGACAGCACCGTGCTCCTGACCCGCTCTCTCCTGGCGGACACGCGGCAGCTGGCTGC ACAGCTGAGGGACAAATTCCCAGCTGACGGGGACCACAACCTGGATTCCCTGCCCACCCT GGCCATGAGTGCGGGGGCACTGGGAGCTCTACAGCTCCCAGGTGTGCTGACAAGGCTGCG AGCGGACCTACTGTCCTACCTGCGGCACGTGCAGTGGCTGCGCCGGGCAGGTGGCTCTTC CCTGAAGACCCTGGAGCCCGAGCTGGGCACCCTGCAGGCCCGACTGGACCGGCTGCTGCG CCGGCTGCAGCTCCTGATGTCCCGCCTGGCCCTGCCCCAGCCACCCCCGGACCCGCCGGC GCCCCCGCTGGCGCCCCCCTCCTCAGCCTGGGGGGGCATCAGGGCCGCCCACGCCATCCT GGGGGGGCTGCACCTGACACTTGACTGGGCCGTGAGGGGACTGCTGCTGCTGAAGACTCG GCTGTGAGCGGCCGCATTAG 2 3 Phụ lục 2: Cải biến trình tự gen il-11 ngƣời phù hợp với hệ biểu hiện E. coli (trên 3 thông số: chỉ số phù hợp codon CAI (Codon Adaption Index), sự phân bố phần trăm mã bộ ba sử dụng hiệu quả, hàm lượng GC và sự phân bố của GC trong gen). 4 Phụ lục 3: Trình tự gen il-11opt trong cassette biểu hiện gen gồm: NdeI/gen il- 11opt/NotI: 5 Sau khi cải biến, gen il-11opt mã hóa trình tự axit amin giống của Neumega (nhưng có thêm methionine đầu N): ký tự gạch chân là trình tự lần lượt của NdeI và NotI. Phần ký tự còn lại là gen il-11opt (Nu: 203-733 gồm cả bộ ba kết thúc): catatgggtccgccgccgggtccgccgcgtgtttcaccggatccgcgtgccgaactggat H M G P P P G P P R V S P D P R A E L D tctaccgtcctgctgacccgctcgctgctggcggatacccgtcagctggcagcacaactg S T V L L T R S L L A D T R Q L A A Q L cgtgacaaatttccggccgatggcgaccataacctggattcactgccgaccctggcgatg R D K F P A D G D H N L D S L P T L A M tcggcaggtgcactgggtgcactgcagctgccgggtgtgctgacgcgtctgcgtgcagat S A G A L G A L Q L P G V L T R L R A D ctgctgagctatctgcgtcacgttcaatggctgcgtcgcgctggcggtagctctctgaaa L L S Y L R H V Q W L R R A G G S S L K accctggaaccggaactgggtacgctgcaggcacgtctggatcgtctgctgcgtcgcctg T L E P E L G T L Q A R L D R L L R R L cagctgctgatgagtcgtttagcattaccacagccaccaccagacccgcctgcacctcca Q L L M S R L A L P Q P P P D P P A P P ctggctcctccaagttctgcatggggtggtattagagcagctcatgctatcctgggcggt L A P P S S A W G G I R A A H A I L G G ctgcacctgacgctggattgggctgttcgtggtttattattgttaaaaacccgcctgtaa L H L T L D W A V R G L L L L K T R L - gcggccgc A A 6 Phụ lục 4: Sơ đồ cấu trúc của vector pET22b(+) (Novagen): 7 Phụ lục 5: Sơ đồ cấu trúc của vector pE-SUMO3 (LifeSensors): 8 Phụ lục 6: Kết quả giải trình tự gen il-11 trong vector biểu hiện pET22b(+) và pE-SUMO3: * Giải trình tự gen il-11 trong vector pET22_pelB_il-11: - Giải trình tự gen il-11 bằng mồi xuôi: Trình tự tương đồng với trình tự mã hóa tín hiệu tiết pelB (vị trí 63-132, đánh dấu bằng mũi tên đường liền) và toàn bộ gen il-11 kể cả bộ ba mã kết thúc (tương đương vị trí Nu 133-674 trên trình tự, đánh dấu bằng mũi tên đường đứt quãng): 9 - Giải trình tự gen il-11 bằng mồi ngược: Trình tự tương đồng với đoạn trình tự của 2 enzyme giới hạn và tín hiệu tiết pelB (tương đương vị trí Nu 616-685 trên trình tự, vị trí mũi tên đường liền) và toàn bộ trình tự gen il-11 kể cả bộ ba mã kết thúc (tương đương vị trí Nu 75-615, vị trí mũi tên đứt quãng): 10 - Trình tự nucleotit của gen pelB_il-11 sau khi giải trình tự (trong đó phần ký tự in đậm là trình tự của pelB, phần còn lại là gen il-11) là: CATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCGGG CCACCACCTGGCCCCCCTCGAGTTTCCCCAGACCCTCGGGCCGAGCTGGACAGCACCGTGCTCCTGACCCGCT CTCTCCTGGCGGACACGCGGCAGCTGGCTGCACAGCTGAGGGACAAATTCCCAGCTGACGGGGACCACAAC CTGGATTCCCTGCCCACCCTGGCCATGAGTGCGGGGGCACTGGGAGCTCTACAGCTCCCAGGTGTGCTGACA AGGCTGCGAGCGGACCTACTGTCCTACCTGCGGCACGTGCAGTGGCTGCGCCGGGCAGGTGGCTCTTCCCTG AAGACCCTGGAGCCCGAGCTGGGCACCCTGCAGGCCCGACTGGACCGGCTGCTGCGCCGGCTGCAGCTCCT GATGTCCCGCCTGGCCCTGCCCCAGCCACCCCCGGACCCGCCGGCGCCCCCGCTGGCGCCCCCCTCCTCAGCC TGGGGGGGCATCAGGGCCGCCCACGCCATCCTGGGGGGGCTGCACCTGACACTTGACTGGGCCGTGAGGG GACTGCTGCTGCTGAAGACTCGGCTGTGAGCGGCCGC 11 - Kết quả so sánh trình tự nucleotit của gen pelB_il-11 sau khi đọc từ vector pET22_pelB_il-11 (ký hiệu là Query) với gen il-11opt thiết kế (ký hiệu là Sbjct) bằng phần mềm Expasy Aligment Tools: Query 1 CATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCG 60 Query 61 GCGATGGCCGGGCCACCACCTGGCCCCCCTCGAGTTTCCCCAGACCCTCGGGCCGAGCTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GCGATGGCCGGGCCACCACCTGGCCCCCCTCGAGTTTCCCCAGACCCTCGGGCCGAGCTG 120 Query 121 GACAGCACCGTGCTCCTGACCCGCTCTCTCCTGGCGGACACGCGGCAGCTGGCTGCACAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 GACAGCACCGTGCTCCTGACCCGCTCTCTCCTGGCGGACACGCGGCAGCTGGCTGCACAG 180 Query 181 CTGAGGGACAAATTCCCAGCTGACGGGGACCACAACCTGGATTCCCTGCCCACCCTGGCC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 CTGAGGGACAAATTCCCAGCTGACGGGGACCACAACCTGGATTCCCTGCCCACCCTGGCC 240 Query 241 ATGAGTGCGGGGGCACTGGGAGCTCTACAGCTCCCAGGTGTGCTGACAAGGCTGCGAGCG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 ATGAGTGCGGGGGCACTGGGAGCTCTACAGCTCCCAGGTGTGCTGACAAGGCTGCGAGCG 300 Query 301 GACCTACTGTCCTACCTGCGGCACGTGCAGTGGCTGCGCCGGGCAGGTGGCTCTTCCCTG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 GACCTACTGTCCTACCTGCGGCACGTGCAGTGGCTGCGCCGGGCAGGTGGCTCTTCCCTG 360 Query 361 AAGACCCTGGAGCCCGAGCTGGGCACCCTGCAGGCCCGACTGGACCGGCTGCTGCGCCGG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 AAGACCCTGGAGCCCGAGCTGGGCACCCTGCAGGCCCGACTGGACCGGCTGCTGCGCCGG 420 Query 421 CTGCAGCTCCTGATGTcccgcctggccctgccccagccacccccggacccgccggcgccc 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 CTGCAGCTCCTGATGTCCCGCCTGGCCCTGCCCCAGCCACCCCCGGACCCGCCGGCGCCC 480 Query 481 ccgctggcgccccccTCCTCAGCCTgggggggCATCAGGGCCGCCCACGCCATCCTgggg 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 CCGCTGGCGCCCCCCTCCTCAGCCTGGGGGGGCATCAGGGCCGCCCACGCCATCCTGGGG 540 Query 541 gggCTGCACCTGACACTTGACTGGGCCGTGAGGGGACTGCTGCTGCTGAAGACTCGGCTG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 GGGCTGCACCTGACACTTGACTGGGCCGTGAGGGGACTGCTGCTGCTGAAGACTCGGCTG 600 Query 601 TGAGCGGCCGCATTAG 616 |||||||||||||||| Sbjct 601 TGAGCGGCCGCATTAG 616 12 * Giải trình tự gen il-11opt trong vector pSUMO_il-11opt: - Giải trình tự gen il-11opt bằng mồi xuôi: Trình tự tương đồng với gen il-11opt từ Nu 18-534 (tương đương vị trí Nu 3-523 trên trình tự, đánh đấu bằng mũi tên): 13 - Giải trình tự gen il-11opt bằng mồi ngược: Trình tự tương đồng với gen il- 11opt từ Nu 1-506 (tương đương vị trí Nu 518-12 trên trình tự, đánh dầu bằng mũi tên). - Trình tự nucleotit của gen il-11opt giải được là: GGTCCGCCGCCGGGTCCGCCGCGTGTTTCGCCGGATCCGCGTGCCGAACTGGATTCTACCGTCCTGCTGACC CGCTCGCTGCTGGCGGATACCCGTCAGCTGGCAGCACAACTGCGTGACAAATTTCCGGCCGATGGCGACCAT AACCTGGATTCACTGCCGACCCTGGCGATGTCGGCAGGTGCACTGGGTGCACTGCAGCTGCCGGGTGTGCTG ACGCGTCTGCGTGCAGATCTGCTGAGCTATCTGCGTCACGTTCAATGGCTGCGTCGCGCTGGCGGTAGCTCTC TGAAAACCCTGGAACCGGAACTGGGTACGCTGCAGGCACGTCTGGATCGTCTGCTGCGTCGCCTGCAGCTGC TGATGAGTCGTTTAGCATTACCACAGCCACCACCAGACCCGCCTGCACCTCCACTGGCTCCTCCAAGTTCTGCA TGGGGTGGTATTAGAGCAGCTCATGCTATCCTGGGCGGTCTGCACCTGACGCTGGATTGGGCTGTTCGTGGT TTATTATTGTTAAAAACCCGCCTGTAA 14 - Kết quả so sánh trình tự nucleotit của gen il-11opt sau khi đọc từ vector pSUMO_il-11opt (ký hiệu là Query) với gen il-11opt thiết kế (ký hiệu là Sbjct) bằng phần mềm Expasy Aligment Tools: Query 1 GGTCCGCCGCCGGGTCCGCCGCGTGTTTCACCGGATCCGCGTGCCGAACTGGATTCTACC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 GGTCCGCCGCCGGGTCCGCCGCGTGTTTCACCGGATCCGCGTGCCGAACTGGATTCTACC 60 Query 61 GTCCTGCTGACCCGCTCGCTGCTGGCGGATACCCGTCAGCTGGCAGCACAACTGCGTGAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 GTCCTGCTGACCCGCTCGCTGCTGGCGGATACCCGTCAGCTGGCAGCACAACTGCGTGAC 120 Query 121 AAATTTCCGGCCGATGGCGACCATAACCTGGATTCACTGCCGACCCTGGCGATGTCGGCA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 AAATTTCCGGCCGATGGCGACCATAACCTGGATTCACTGCCGACCCTGGCGATGTCGGCA 180 Query 181 GGTGCACTGGGTGCACTGCAGCTGCCGGGTGTGCTGACGCGTCTGCGTGCAGATCTGCTG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 GGTGCACTGGGTGCACTGCAGCTGCCGGGTGTGCTGACGCGTCTGCGTGCAGATCTGCTG 240 Query 241 AGCTATCTGCGTCACGTTCAATGGCTGCGTCGCGCTGGCGGTAGCTCTCTGAAAACCCTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 AGCTATCTGCGTCACGTTCAATGGCTGCGTCGCGCTGGCGGTAGCTCTCTGAAAACCCTG 300 Query 301 GAACCGGAACTGGGTACGCTGCAGGCACGTCTGGATCGTCTGCTGCGTCGCCTGCAGCTG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 GAACCGGAACTGGGTACGCTGCAGGCACGTCTGGATCGTCTGCTGCGTCGCCTGCAGCTG 360 Query 361 CTGATGAGTCGTTTAGCATTACCACAGCCACCACCAGACCCGCCTGCACCTCCACTGGCT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 CTGATGAGTCGTTTAGCATTACCACAGCCACCACCAGACCCGCCTGCACCTCCACTGGCT 420 Query 421 CCTCCAAGTTCTGCATGGGGTGGTATTAGAGCAGCTCATGCTATCCTGGGCGGTCTGCAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 CCTCCAAGTTCTGCATGGGGTGGTATTAGAGCAGCTCATGCTATCCTGGGCGGTCTGCAC 480 Query 481 CTGACGCTGGATTGGGCTGTTCGTGGTTTATTATTGTTAAAAACCCGCCTGTAA 534 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 CTGACGCTGGATTGGGCTGTTCGTGGTTTATTATTGTTAAAAACCCGCCTGTAA 534 15 Phụ lục 7: Số liệu khảo sát điều kiện nuôi cấy cảm ứng ảnh hƣởng đến mật độ tế bào của chủng E. coli Rosetta 2 tái tổ hợp Bảng 1: Ảnh hƣởng của nồng độ IPTG đến mật độ tế bào ở thời điểm thu mẫu Nồng độ IPTG (mM) Mật độ tế bào thu mẫu (OD600) Trung Bình Lần 1 Lần 2 Lần 3 0 5,42 5,38 5,72 5,51 0,05 4,88 5,09 5,28 5,08 0,1 2,48 2,21 2,70 2,46 0,3 1,52 1,79 2,02 1,78 0,5 1,62 1,92 1,80 1,78 1 1,49 1,82 1,79 1,70 1,5 1,38 1,58 1,74 1,57 2 1,52 1,83 1,71 1,69 Bảng 2: Ảnh hƣởng của nhiệt độ đến mật độ tế bào ở thời điểm thu mẫu Nhiệt độ ( o C) Mật độ tế bào thu mẫu (OD600) Trung Bình Lần 1 Lần 2 Lần 3 20 2,2 2,45 2,64 2,43 25 5,5 5,63 6,05 5,73 30 4,76 4,92 5,57 5,08 37 5,42 4,92 5,66 5,33 40 4,52 4,02 3,82 4,12 16 Bảng 3: Ảnh hƣởng của pH môi trƣờng nuôi cấy đến mật độ tế bào thu mẫu pH môi trƣờng nuôi cấy Mật độ tế bào thu mẫu (OD600) Trung Bình Lần 1 Lần 2 Lần 3 5 1,62 1,74 2,26 1,87 5,5 4,86 4,54 3,88 4,43 6 5,53 5,08 4,82 5,14 6,5 5,12 5,82 4,98 5,31 7 6,38 5,8 5,68 5,95 7,5 5,76 5,58 6,02 5,79 8 5,72 6,07 5,92 5,90 Bảng 4: Ảnh hƣởng của thời điểm cảm ứng đến mật độ tế bào thu mẫu Thời điểm cảm ứng (OD600) Mật độ tế bào thu mẫu (OD600) Trung Bình Lần 1 Lần 2 Lần 3 0,4 5,85 5,62 6,85 6,11 0,8 7,78 6,3 6,74 6,94 1 8,12 6,6 7,18 7,30 1,5 8,05 10,52 9,42 9,33 2 17,48 21,2 19,02 19,23 2,5 12,7 11,6 10,5 11,60 3 8,68 8,12 10,56 9,12 3,5 7,84 8,12 9,48 8,48 4 8,02 6,64 7,06 7,24 17 Phụ lục 8: Biểu đồ của 19 axit amin chuẩn dùng để phân tích các axit amin giải phóng từ phản ứng phân giải Edman Phụ lục 9: Biểu đồ phân tích trình tự 15 axit amin đầu N của protein IL-11 ngƣời tái tổ hợp: Biểu đồ gốc axit amin 1: G Biểu đồ gốc axit amin 2: P Biểu đồ gốc axit amin 3: P Biểu đồ gốc axit amin 4: P 18 Biểu đồ gốc axit amin 5: G Biểu đồ gốc axit amin 6: P Biểu đồ gốc axit amin 7: P Biểu đồ gốc axit amin 8: R Biểu đồ gốc axit amin 9: V Biểu đồ gốc axit amin 10: S 19 Biểu đồ gốc axit amin 11: P Biểu đồ gốc axit amin 12: D Biểu đồ gốc axit amin 13: P Biểu đồ gốc axit amin 14: R Biểu đồ gốc axit amin 15: A 18 Phụ lục 10: Số liệu khảo sát hoạt tính của IL-11 tái tổ hợp trên dòng tế bào TF-1 C (ng/ml) 100 50 10 5 2.5 1 0.5 0.125 0.0125 0.001 Log10C 2 1,69897 1 0,69897 0,39794 0 -0.30103 -0,90309 -1,90309 -3 Độ hấp phụ 5516,903 5409,089 5164,103 4603,274 4106,603 3560,05 3509,463 3404,767 3497,592 3396,893 6000,803 5341,833 5248,871 4990,701 4044,043 3771,140 3808,297 3056,572 3324,528 3260,772 7019,369 6512,216 6051,024 5385,464 4711,997 3937,543 3888,521 3262,85 3164,494 2837,798 Trung bình 6179,025 5375,461 5487,999 4993,146 4287,548 3756,244 3735,427 3241,396 3328,871 3165,154 Độ lệch chuẩn 766,9246 47,55717 489,4323 391,1007 368,9124 189,1868 199,7593 175,0861 166,5915 291,5542 Ghi chú: C: Nồng độ của IL-11 tái tổ hợp 19 Phụ lục 11: Đồ thị biểu diễn sự tăng sinh của tế bào TF-1 đối với nồng độ IL-11 tái tổ hợp (đối chứng dƣơng của Biovision) đo ở bƣớc sóng 550 nm và 615 nm Logarit của nồng độ protein IL-11 tái tổ hợp (Biovision) đối với sự tăng sinh của tế bào (lặp lại 3 lần): Độ hấp phụ thấp nhất: 3264 Độ hấp phụ cao nhất: 5870 Logarit của nồng độ IL-11 - Biovision có tác dụng kích thích tế bào tăng lên 50%: 0,8352 Nồng độ của IL-11 - Biovision kích thích tế bào tăng lên 50%: 6,843 (ng/ml) Sự chênh lệch giữa độ hấp phụ cao nhất và độ hấp phụ thấp nhất: 2606 Log conc (ng/ml) R P M -2 -1 0 1 2 2500 3500 4500 5500 BV Human; control O/N Đ ộ h ấ p p h ụ Logarit của nồng độ IL-11 - Biovision (ng/ml)

Các file đính kèm theo tài liệu này:

  • pdfnghien_cuu_bieu_hien_tinh_che_va_buoc_dau_danh_gia_dac_tinh.pdf
Luận văn liên quan