Đề tài Nấm mốc penicilium

LỜI NÓI ĐẦU Trong những năm gần đây với sự tiến bộ của khoa học kỹ thuật, quá trình định danh cho nhiều loài vi sinh vật cũng như dễ dàng hơn với thiết bị hiện đại hơn. Nhiểu loại vi sinh có lợi, hại đều được biết đến rõ ràng hơn. Trong những năm vi sinh học phát triển một loài sinh độc tố nhưng có ít trong đó có loại nấm mốc Peniccilium roqueforti được xác định từ trong sản phẩm phomat xanh vốn quen thuộc với dân châu Âu. Penicilium roqueforti được các nhà khoa học tìm hướng đi mới ngoài việc sử dụng để sản xuất phomat xanh. MỤC LỤC Lời nói đầu Phần I Tổng Quan Về Penicillium Roqueforti I. Lịch sử phát hiện4 II. Phân loại khoa học . 4 III. Đặc điểm nhận dạng . 6 IV. Đặc điểm sinh hoá 9 Phần II Các Phương Pháp Xác Định I. Phương pháp truyền thống 8 II. Các phương pháp hiện đại 1. Phương pháp PCR . 22 2. Phương pháp RAPD 25 Phần III: Kết Luận

doc32 trang | Chia sẻ: lvcdongnoi | Ngày: 04/06/2013 | Lượt xem: 2512 | Lượt tải: 4download
Bạn đang xem nội dung tài liệu Đề tài Nấm mốc penicilium, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
ĐỀ TÀI PENICCILIUM ROQUEFOTI GVHD: K.S. PHẠM MINH NHỰT NHÓM 7 TRẦN THUỴ KIM BÌNH TRƯƠNG THỊ TRÚC HÀ PHẠM NGÔ ÁNH THƯ HUỲNH THỊ DIỆU HIỀN MỤC LỤC Lời nói đầu Phần I Tổng Quan Về Penicillium Roqueforti Lịch sử phát hiện 4 Phân loại khoa học 4 Đặc điểm nhận dạng 6 Đặc điểm sinh hoá 9 Phần II Các Phương Pháp Xác Định Phương pháp truyền thống 8 Các phương pháp hiện đại 1. Phương pháp PCR 22 2. Phương pháp RAPD 25 Phần III: Kết Luận LỜI NÓI ĐẦU Trong những năm gần đây với sự tiến bộ của khoa học kỹ thuật, quá trình định danh cho nhiều loài vi sinh vật cũng như dễ dàng hơn với thiết bị hiện đại hơn. Nhiểu loại vi sinh có lợi, hại đều được biết đến rõ ràng hơn. Trong những năm vi sinh học phát triển một loài sinh độc tố nhưng có ít trong đó có loại nấm mốc Peniccilium roqueforti được xác định từ trong sản phẩm phomat xanh vốn quen thuộc với dân châu Âu. Penicilium roqueforti được các nhà khoa học tìm hướng đi mới ngoài việc sử dụng để sản xuất phomat xanh. PHẦN I : TỔNG QUAN TÀI LIỆU LỊCH SỬ PHÁT HIỆN Đầu tiên được mô tả bởi Thom vào năm 1906, Penicillium roqueforti thoạt đầu là một loài hỗn tạp của nấm xanh sinh bào tử. Chúng được chia thành các nhóm loài khác nhau dựa trên sự khác biệt về kiểu hình, và sau đó chúng được kết hợp thành một loài bởi Raper và Thom. Charles Thom (1872-1956) Nhóm Pencillium được phân loại lại vào năm 1996 dựa vào sự khác nhau của dãy DNA ribosom và đặc tính chuyển hoá thứ cấp. Trước đây được chia thành hai loại khác nhau – một là được dùng cho phomat ( Penicillium roqueforti var. roqueforti) và một là tạo patulin. PHÂN LOẠI KHOA HỌC Giới: Nấm Ngành: Ascomycota Lớp: Eurotiomycetes Bộ: Eurotiales Họ: Trichocomaceae Giống: Penicillium Loài: Penicillium roqueforti Hình ảnh được phóng đại vài trăm triệu lần dưới kính hiển vi điện tử Hình ảnh Penicilium roqueforti (Penicillium roqueforti var. carneum), Penicillium roqueforti được phân loại thành ba loài là Pencillium roqueforti, Penicillium carneum và Penicillium paneum. ĐẶC ĐIỂM Đặc điểm hình thái Penicilium roqueforti là loại mốc có màu xanh, có cuốn đính bào từ, sinh bào tử, sinh sản hữu tính, hình sợi, thuộc ngành nấm nang. Qúa trình hợp giao tử (A – F) ; Toàn giao (Hologamy)(G – J); Tiếp xúc giữa 2 giao tử (K– L); Tự giao (autogamy)(M – N: sinh sản ở nấm mốc. Đặcđiểm bào tử Bào tử Penicilium roqueforti Bào tử của nấm mốc Penicilium roqueforti : hình cầu gần như hình tròn, bề mặt tròn nhẵn(kích thước 3,5- 5,5 µm), không có màng tế bào. Cuống dài 100-200 x 4-5,5,…. Khuẩn lạc Penicilium roqueforti Hình ảnh P.roqueforti Môi trường sống Đặc điểm trên môi tổng hợp: Penicillium roqueforti chỉ là một loài của Penicillium mà nó có thể phát triển trên môi trường chứa 0-5% acid acetic, ở nồng độ rượu cao, và ở nồng độ oxy thấp (nói rõ trong phần sau). Khuẩn lạc trên môi trường Czapek thạch và MEA 25oC phát triển rất nhanh chóng, đường kính đạt 4-5 cm, trong vòng 14 ngày, các bào tử có các cuống mọc dày đặc, mượt, Màu xanh xanh, sau đó trở nên tối hơn. Dịch tươi do loài này tiết ra trong như giọt pha lê. Mùi không rõ nét. Sau đó môi trường thay đổi màu sắc từ màu xanh sang xanh đậm. Cuống bào tử đính kích thích 100-200 x 4,0-6,5 μm. Hạt bào tử đính trong cột lỏng lẻo,hình cầu, màu xanh lục, nhẵn-tường, chủ yếu là từ 4-6 mm, có khi đến 8mm. Phân bố trong tự nhiên: Roqueforti Penicillium là một loại nấm hoại sinh phổ biến , nó thì tồn tại khắp nơi trong tự nhiên và có thể được phân lập từ đất, các chất hữu cơ phân hủy và các bộ phận của cây .. Ngoài ra, chúng được tìm thấy trong ẩm ướt, hầm tối, đến vườn đất và tán lá, mà còn trong phòng tắm, nước, đường ống, con dấu cao su, ngưỡng cửa sổ, thảm, nệm và đồ nội thất… Tốc độ phát triển Tốc độ phát triển nhanh trên các môi trường và đạt kích thước sau: CYA: 34-55mm, MEA: 35-56 mm, YES: 47-74 mm. Khuẩn lạc của Penicilium roqueforti phát triển rất tốt trên môi trường acid acetic : 0,5%, và cũng phát triển tốt trên CREA thích hợp trên môi trường acid. ĐẶC TÍNH SINH HOÁ Sinh hợp chất thứ cấp Penicilium roqueforti là loài sinh ra hợp chất thứ cấp marcfortines và fumigaclvine A. Marcfortines từ Penicilium roqueforti Những tư liệu về những hợp chất này tạm thời chưa được rộng nên khó khăn trong việc lấy nó làm tư liệu. Độc tố PR và eremofortin C Là chất chuyển hóa thông thường của Penicilium roqueforti. Các cấu trúc hóa học của hai hợp chất liên quan chặt chẽ với nhau và khác nhau chỉ bởi một aldehyde và một nhóm acohol tại vị trí C-12 . Định tính, định lượng độc tính enzyme: Các hoạt động tối đa các enzym trong các môi trường đã được tìm thấy vừa xảy ra vào ngày 13 tính từ khi bắt đầu thí nghiệm, trong đó tương ứng cực đại của PR trong vật chứa độc tố. Enzyme này được phân lập và tinh chế từ các môi trường và vừa khuẩn ty thể của nấm tương ứng thông qua một thao tác liên quan đến amoni sulfat và fractionation DEAE-cellulose sắc ký. Sản lượng đã được 33,3 và 21,6% cho các enzym có hoạt tính trung. Độ pH tối ưu cho enzym khi pH 5,6. Khi nó xúc tác sự chuyển đổi ở 30 ° C và phân rã với thời gian phản ứng khi ở nhiệt độ cao. Ở 100 ° C, hoạt động của enzyme đã hoàn toàn bị mất. Các K. và Vmax của các enzym như được xác định ở 30 ° C là 0,02 mM và 4.0, umol / phút mỗi mg, tương ứng. Trọng lượng phân tử của enzyme đã được ước tính bằng cách lọc ,áp suất sắc ký lỏng thu được là I-250 protein đến 40.000. Độc tố PR và eremofortin C (EC) là chất chuyển hóa thứ cấp của nấm Penicillium roqueforti, những độc tố này gây nguy hiểm cho những người sử dụng sản phẩm phomat bị nhiễm penicilium roqueforti. Hình: phân tích chất độc bằng phương pháp HPLC . sự hoạt động của độc tính trong Penicilium roqueforti. Kể từ khi phát hiện và cô lập PR độc tố , nó làm sáng tỏ độc tố nấm mốc con đường tổng hợp sinh học của các độc tố khác có liên quan và chuyển hóa qua lại lẫn nhau. Cấu trúc của PR : Công thức một số loại chất độc do Penicilium roqueforti sinh tổng hợp Oxy hoá các acib béo Khả năng của nấm để ôxi hóa của các axit béo chuỗi trung bình được thu Ketones methyl lần đầu tiên được ghi nhận, người đã cho thấy Penicillium roqueforti và hai loài của chi Aspergillus sản xuất Ketones methyl khi nuôi vi nấm trong vài tuần trong môi trường acid béo. Năng lực của các bào tử của P. roqueforti để tạo Ketones methyl nhanh chóng biến mất dần dần khi bào tử nảy mầm.Tỷ lệ sự hình thành của 1-2-heptan trong những axít octanoic do sự không hoạt động P.roqueforti đã được tăng lên đáng kể bằng cách thêm những axít amin và đường khi kích thích nảy mầm của các bào tử. Phương pháp: Gehrig & Knight (1963) đã tăng trưởng của khuẩn ty thể Penicillium roqueforti trên phương diện hóa học trong đó có cả acetate và oleate. Ban đầu ở pH 4,0 thể khuẩn ty ở pH 4,0 lần ít hoạt động trong ôxi hóa axít béo hơn khoảng 5 sự phát triển ở pH 6,5. Môi trường Ammonium nitrate, 2 g. ; Magiê sulfat (MgSO,. 7H, O), 0,1 5 g. ; Kali clorua, 0,25 g. ; Sắt sulfat (FeSO,. 7H20), 0,0125 g. Tăng trưởng của khuẩn ty thể: Bào tử của Penicillium roqueforti đã được nhân giống trên môi trường Czapek-Dox agar (Oxoid) . Sau 5-6 ngày các bào tử đã được chuyển giao cho 100 ml của trung bình trong 500 ml trong Erlenmeyer Flasks. Việc nhân giống được ủ qua đêm, để cho phép bào tử nảy mầm trong 24 giờ. Nồng độ của khuẩn ty thể pha trộn đã được điều chỉnh để khoảng 10 mg. / ml. Wt khô, nồng độ chính xác được xác định bằng cách đo lường trọng lượng khô. Hình 1: Sự hấp thu oxy ở pH 5,2 do khuẩn ty thể của roqueforti Penicillium ủ với axít béo. Phản ứng các điều kiện: Iomg. khô wt equiv. khuẩn ty thể, thu hoạch sau khi 66h. Hình 2: Các ức chế hấp thu oxy bằng cách bổ sung của C, hoặc C, các axit béo để khuẩn ty thể của Penicillium roquefortiincubated với axít béo Kết quả: Ảnh hưởng trung vào khả năng tăng trưởng của khuẩn ty thể để ôxi hóa axít béo . Sản lượng của Ketones methyl thấp từ axit béo đã thu được với khuẩn ty thể trồng trong các axit Casamino (3 g./500 ml). Độc tính: Penicilium roqueforti sinh độc tố roquefortine. Độ độc thấp của roquefortine C đã được tìm thấy trong pho mát xanh nhưng nồng độ chính xác đã không báo cáo. Scott và Kennedy (1976) tìm thấy nồng độ roquefortine lên đến 6,8 mg / kg trong các mẫu phó mát xanh trên thị trường mà họ kiểm tra. Trong thực tế,độc tính roquefortine tạo ra bởi hầu hết các chủng của P. roqueforti được phân lập từ phô mai xanh. Một tỷ lệ nhỏ các chủng tìm thấy từ thịt cũng tạo ra roquefortine. Khả năng gây bệnh của Penicillium roqueforti là rất thấp, thậm chí là ít cơ hội gây bệnh. Giá trị LD50 của roquefortine khoảng 10 mg / kg được thử nghiệm trên chuột. Cho bò ăn ngô bị nhiễm P. roqueforti làm bò biếng ăn, và viêm đường ruột . Con người tiếp xúc độc tính đó qua da và đường hô hấp và tiêu hoá Một trường hợp được Campbell et al (1983) mô tả về một bệnh nhân làm việc tại một nhà máy, nơi pho mai xanh được sản xuất bằng cách sử dụng. Penicillium roqueforti. Triệu chứng là ho, khó thở, khó chịu, thể tích phổi giảm. Penicillium Roqueforti có thể gây ra phản ứng dị ứng như sổ mũi, ho, hắt hơi, nổi mề đay, hoặc bệnh suyễn.. Không có bằng chứng để kết luận độc tính roquefortine có khả năng gây ung thư. ỨNG DỤNG Sản xuất poliscchacarides, sản xuất hợp chất thứ cấp,…. Sản xuất Exo-polygalacturonase (Exo-p): Dựa trên môi trường kem dầu bí ngô (PuOC ) kết hợp bổ sung lúa mì, cám (WB), và vi nấm mốc Penicilium roqueforti, nhằm thực hiện quá trình lên men bề mặt bán rắn SSF. Hình trên cho thấy : Khả năng tổng hợp của Penicilium roqueforti sản sinh Exo- P, trên môi trường PuoC. Exo-P tăng từ đầu quá trình và đạt những giá trị tối đa là 1452U/g.d.w. Sản xuất protease trong sản xuất phomat xanh, Roquefort, Stilton Khả năng tổng hợp protease có khả năng đông tụ sữa sử dụng trong sản xuất các sản phẩm lên men từ sữa và protein 2.1. Phomat xanh(Stilton): Stilton là một pho mát kem với làn vân màu xanh, và nó có một hương vị đặc trưng, với khả năng chống oxy hoá. Stilton là một loại phomat làm từ sữa tiệt trùng. Sữa được bổ sung nấm mốc roqueforti, thêm muối và không ép khuôn để sản phẩm có kết cấu lỏng lẽo, để nấm mốc phát triển tự nhiên ăn lan thành các đường vân trước khi thành phẩm. Phomat xanh 2.2. Roquefort Roquefort là sản phẩm lên men từ sữa cừu hoà với nước nóng ở 32o C , sản phẩm đông tụ nhờ các enzyme protease( trong đó một là pepsin), giai đoạn này người ta bổ sung vi nấm Penicilium roqueforti Phô mai này sau đó tăng trưởng và phát triển ở nhiệt độ thích hợp là 8oC, với điều kiện nhiệt độ. Roquefort sinh trưởng thoát hơi CO2 trong quá trình lên men. Sản phẩm sau đó được đóng gói và bảo quản trong điều kiện thiếu O2. Hình ảnh sản phẩm Roquefort PHẦN II: PHƯƠNG PHÁP XÁC ĐỊNH XÁC ĐỊNH BẰNG PHƯƠNG PHÁP TRUYỀN THỐNG Phân tích định tính Quy trình: Đồng nhất mẫu trong SDB thành độ pha loãng 10-1, ủ ở 30o trong 1- 7 ngày ↓ Cấy canh trường có mốc mọc lên đĩa SDA, MEA hay PDA ủ ở 30o C trong 7 ngày ↓ Kết luận có hay không có nấm mốc phát triển. Sơ đồ: quy trình định tính nấm mốc Thuyết minh quy trình: - Môi trường sử dụng: SDB: Sabouraud’s Dextrose Broth . Thành phần môi trường gồm có: Polypeptone hoặc neopeptone :10g Dextrone: 40 g Nước cất: 1000ml. ph= 5,8. SDA: như môi trường SDB trên nhưng thêm 15- 20g agar. Phân phối vào đĩa petri sau khi hấp khử trùng. MEA: malt extract agar Cao malt 30g Agar 20g Nước cất 1000ml Hấp khử trùng, phân phối vào đĩa petri. pH= 5,5 Hình ảnh:a) khuẩn lạc sau một tuần trên. Hình c,d: miếng phó mát Roquefort trong đó khuôn được thấy như tĩnh mạch sẫm màu (màu xanh) trong phô mai. PDA: Potato Dextrose Agar. Thành phần: Potato infusion 200g Dextrone 20 g Agar 20g Nước cất 1000ml. Môi trường trên chỉ xác định nấm mốc, muốn định danh Penicilium roqueforti cần môi trường CYA(môi trường thạch Czapek Yeast Autolysate), YES. Khuẩn lạc phát triển trên môi trường CYA: làm môi trường chuyển từ màu vàng kem sang màu nâu nhạt. Khuẩn lạc có màu xanh nhạt.Trên môi trường YES: khuẩn lạc làm môi trường từ vàng nhạt sang màu nâu. Khuẩn lạc có màu xanh lục. Penicilium roqueforti trên CYA Penicilium roqueforti trên YES Phân tích định lượng: Quy trình: Đồng nhất và pha loãng mẫu 10-1, 10-2, 10-3, 10-4…. ↓ Trãi 0,1 ml mẫu lên đĩa DRBC hoặc DG18, ủ ngữa đĩa ở 25oC, 5-7 ngày ↓ Đếm khuẩn lạc nấm mốc, tính mật độ(CFU/g) ↓ Cấy lên môi trường ống thạch nghiêng SDA, ủ 30 độ, 7 ngày ↓ Định danh( môi trường CYA, YES) Môi trường: DGBC: Dichloran Rose Bengal Chloramphenicol agar. Thành phần gồm có: Glucose 10g Peptone 5g KH2PO4 1g MgSO4 0,5g Rose bengal( dung dich5 5%, w/w trong ethanol) 1ml Dichloran (0,2%(w/w) trong ethanol) 1ml(2,6- dichhloro-4- nitroaniline) Chloramphenicol 0,1g Agar 15g Nước cất 1000ml Ph= 5,6. Môi trường đỗ đĩa petri. Môi trường DG18: dichloran 18% glycerol agar. Thành phần: Glucose 10g Petone 5g KH2PO4 1g Dichloran (0,2%(w/w) trong ethanol) 1ml(2,6- dichhloro-4- nitroaniline) MgSO4 0,5g Chloramphenicol 0,1g Glycerol 220g Nước cất 800ml Agar 15g. Hai môi trường trên pha lẫn các chất trừ chloramphenicol, hấp khử trùng, để nguội 50 độ sau đó thêm chloramphenicol(1ml/100ml môi trường), Glycerol 220g. Tiến hành định danh cho loài nấm mốc Penicilium roqueforti bằng môi trường CYA,YES. XÁC ĐỊNH P.ROQUEFORTI BẰNG PHƯƠNG PHÁP HIỆN ĐẠI Xác định bào tử Penicilium roqueforti bằng phương pháp PCR Phương pháp lấy mẫu không khí tích hợp và phân tích DNA để phát hiện các bào tử nấm Penicilium roqueforti. Tóm tắt: Bào tử P.roqueforti được thu thập trực tiếp vào ống Eppendorf sau đó ngâm huyền phù trong dung dịch 0,1% Nonidet P-40 và được tính bằng cách sử dụng kính hiển vi, dung dịch sẽ pha loãng mẫu với các nồng độ pha loãng khác nhau tuỳ theo số bào tử đếm được. Ba phương pháp đã được sử dụng sản xuất DNA để thử nghiệm PCR: thêm các bào tử chưa bất hoạt để PCRs, ) sử dụng các hạt Ballotini phá vỡ các bào tử (khe nứt của bức tường bào tử để phát phản ứng), và phá vỡ các bào tử DNA sau tinh chế. Số lượng thêm các bào tử bất hoạt vào không được nhỏ hơn 1000. Sau đó bằng cách phá vỡ các bào tử, có hoặc không có tinh chế DNA, Penicilium roqueforti đã có thể phát hiện DNA từ một bào tử duy nhất. P. roqueforti bào tử được thêm vào từ không khí các mẫu nồng độ cao của các bào tử nấm không rõ nguồn gốc: phấn hoa, bụi đã làm giảm độ nhạy phát điện. Tuy nhiên, bằng cách sử dụng DNA tinh khiết, nó đã có thể phát hiện 10 loại bào tử P. Đối với tất cả các phương pháp tách chiết DNA, PCR lồng nhau được nhạy cảm hơn so với bước đơn PCR hoặc PCR theo sau phương pháp Southern blotting. Vật liệu và phương pháp: Kết quả và định lượng P. roqueforti spores. roqueforti bào tử: phản ứng xác định số lượng bào tử trên chủng P. roqueforti C2709 cô lập từ hạt lúa mì tại Rothamsted(Anh), Nó được cấy trên bông thấm bấc ngâm trong dextrose agar khoai tây (Oxoid Ltd, Basingstoke, Vương quốc Anh) và ủ ở 25 ° C. Các bào tử đã được ngâm điều chỉnh để 2 × 10 4 bào tử / ml, pha loãng với cơ số log 10. Chuẩn bị mẫu Air spiked( mẫu trong dịch huyền phù) để kiểm tra hiệu quả của chất nền: sử dụng cơn bão thu nhỏ lấy mẫu không khí đã được sử dụng để thu thập mẫu từ không khí xung quanh thành ống Eppendorf khoảng 1,5 ml( mẫu không khí đã được lưu giữ khô ở nhiệt độ phòng cho đến khi sử dụng). Các mẫu thu thập được treo huyền phù trong 1 ml 0,1% Nonidet P-40 của vortexing trong 2 phút. Các mẫu pha loãng ở nồng độ khoảng 9 × 10 5 / ml. Tinh sạch DNA P.roqueforti và hệ sợi của nó: Bốn phương pháp chuẩn bị mẫu được sử dụng cho phân tích PCR : _ 5 μL của dịch huyền phù bào tử được thêm vào ống PCR _ 200 μL của dịch huyền phù được phá vỡ và 5 μL bào tử đã được thêm vào ống PCR _ DNA được chiết xuất từ 50 μL của các mẫu bào tử bị phá vỡ, một phần đã được hòa tan trong 50 μL của nước cất vô trùng, và 5μL của dịch huyền phù, kết quả DNA đã được thêm vào ống PCR _50 μL của dịch huyền phù được phá vỡ bào tử, DNA được tách ra và hòa tan trong 5μL của nước cất vô trùng, và toàn bộ các mẫu đã được thêm vào ống PCR Cách 3 được gọi là chiết xuất DNA quy mô lớn, và cách 4 được gọi là chiết xuất DNA quy mô nhỏ. Sự phá vỡ các bào tử bằng cách lắc treo bào tử với 0,2 g acid-rửa hạt Ballotini (8,5point, đường kính 400-455 μm) cho 8 phút trong một máy nghiền. Kiểm tra mẫu của bào tử huyền phù bằng kính hiển vi, trước và sau khi các phương thực hiện cho thấy rằng chúng bị gián đoạn hơn 90% của bào tử P. roqueforti. Điều này liên quan đến việc trộn các mẫu với một vùng đệm ức chế (có chứa Tris, EDTA, sodium dodecyl sulfate, và β-mercaptoethanol), ủ chúng ở 65 ° C cho 1 h, và sau đó thực hiện khai thác phenol-chloroform và lượng isopropanol. Chúng tôi đổi cách thực hiện bằng cách thêm 20 ng của glycogen ở bước thêm isopropanol trong quá trình ly tâm. DNA cũng được chiết xuất từ sợi nấm của P. roqueforti Phát hiện của P. roqueforti DNA by PCR. roqueforti DNA bằng PCR: Đoạn mồi: người ta sử dụng 2 loại đoạn mồi một là ITS4 ( 5’TCCTCCGCTTAGATATGC) và ITS5 ( 5’AGTAAAAGTCGTAACAAGG) hai là ITS183 (5′CTGTCTGAAGAATGCAGTCTGAGAAC) và ITS401 (5′CCATACGCTCGAGGACCGGAC) Những mồi khuyếch đại một vùng DNA kéo dài từ cuối đầu '3 của gen 18 đến hết đầu 5' của gen 28S. Each 25-μl reaction mixture contained 25 pmol of both primers, 0.5 U of Platinum Taq (Life Technologies, Ltd., Paisley, United Kingdom), buffer (20 mM Tris HCl [pH 8.4], 50 mM KCl, 1.5 mM MgCl 2 ), 0.2 mM deoxyribonucleoside triphosphates, and DNA (various amounts from log 10 dilutions of P. roqueforti spores and 5 to 50 ng from mycelium or spores of other fungi). Mỗi 25μL hỗn hợp của phản ứng có 25 pmol cả hai đoạn mồi, 0,5 U của Platinum Taq, đệm (20 mM Tris HCl [pH 8,4], 50 mM KCl, 1,5 mM MgCl 2 ), 0,2 mM triphosphates deoxyribonucleoside, và DNA dung dịch pha loãng của bào tử P. roqueforti và 5-50 ng mycelium hoặc bào tử của nấm khác. Điều kiện chu kì bào tử được 95 ° C trong 10 phút và nhiệt độ 94 ° C trong 30 s, 42 ° C trong 2 phút, và 72 ° C trong 2 phút. Kết hợp PCR và Southern blotting: đó là phương pháp kết hợp để cho một kết quả chính xác hơn là chỉ xác định dựa trên một kết quả từ 1 phản ứng PCR. Kết quả: Khuếch đại một đoạn 300-bp của DNA từ bào tử P. roqueforti bằng phương pháp nested PCR. Kết quả từ 1-4, 0, 100, 1.000, và 10.000 bào bổ sung vào các PCR; dãy 5-8, 0, 10, 100, và 1.000 bào tử phá vỡ thêm vào các PCR; dãy 9-12, DNA từ 0, 1 , 10, và 100 bào tử tinh chế bằng phương pháp khai thác trên quy mô lớn; dãy 13-16, DNA từ 0, 1, 10, và 100 bào tử tinh chế bằng phương pháp khai thác trên quy mô nhỏ; dãy 17, DNA P. roqueforti roqueforti lấy từ khuẩn ty thể, dãy 18, nước, dãy 19 là kích thước DNA marker (100-bp ). Xác định bằng phương pháp RAPD Là phương pháp sửa đổi những thủ tục PCR của Saiki (1990) sử dụng phổ mồi NS2, 3, 5 và 7 và các sửa đổi sau đây: 200 của mồi trong 50 p1 phản ứng hỗn hợp, 0,25% Tween 20, 10% (v / v) DMSO, 10 của gen DNA. Biến tính ban đầu tại 94 oC cho 1 phút tiếp theo là 40 chu kỳ của 94 oC cho 10 s, 40 "C trong 60 s, 72 oC cho 60 s, trên một Tap polymerase. Cuối cùng, nhiệt độ đã được lưu giữ tại 72 "C trong 10 phút. Taq polymerase (AmpliTaq. Vân tay là hình tượng của UV sau khi chạy PCR pl 10 sản phẩm trên một 15 cm, 2,0% (w / v) agarose gel cho 4 giờ ở 90 mA và nhuộm với ethidium bromua. Kỹ thuật fingerprinting được thực hiện ít nhất ba lần cho mỗi cô lập. Các bước tiến hành kĩ thuật RAPD: Bước 1: Tách chiết DNA DNA được tách chiết có chất lượng tốt. Sử dụng phương pháp của Doyle và Doyle. Phương pháp này sử dụng CTAB (Hexadecyltrimethylammoniumbromid) là một chất tẩy cation hình thành phức hợp với những polysaccharide, protein, polyphenol,…. Phức hợp này sau đó được tách ra khỏi dung dịch tách chiết bằng hỗn hợp chloroform – isoamyl alcohol, bằng cách hình thành 2 pha: pha thứ nhất là dung dịch sạch ở phía trên có chứa DNA, pha thứ hai đặc hơn ở dưới chứa chloroform và tất cả những thành phần cần loại bỏ khác (polysaccharides, protein,…). Sau khi ly tâm, thu được DNA. Thông thường quy trình ly trích DNA ở thực vật gồm 3 giai đoạn: • Giai đoạn 1: Phá vỡ màng tế bào và màng nhân. Tế bào lá được nghiền với dịch trích EB (extraction buffer) để phá vỡ màng tế bào, giải phóng các thành phần có trong tế bào ra ngoài môi trường dịch trích. • Giai đoạn 2: Làm biến tính protein, loại bỏ protein và các thành phần hữu cơ khác (polysaccharides, polyphenols, lipids,…). • Giai đoạn 3: Tủa DNA bằng isopropanol hay ethanol 100 %, thường tủa bằng isopropanol lạnh trước, sau đó tiếp tục tủa bằng ethanol 100 % kết hợp với muối. Một số vấn đề có thể gặp phải khi tách chiết DNA: • DNA bị phân hủy hoặc bị gãy. • Có RNA trong mẫu DNA. • Có polysaccharide trong mẫu DNA. • Có polyphenol trong mẫu DNA. PH ức chế hoạt động của những enzyme phân hủy (như enzyme DNase hoạt động ở pH=7). Tris-HCl Dung dịch đệm duy trì pH phù hợp. EDTA ethylenediamine-tetraacetate ức chế những enzyme phân hủy DNA sodium acetat. Muối -Kết hợp với ethanol 100% kết tủa và rửa sạch DNA. CTAB hexadecyltrime-thylammonium-bromide. Chất tẩy cation. Hòa tan màng tế bào. Biến tính protein. Thành lập phức hợp với những protein, polysaccha-ride. CIA chloroform-isoamylalcohol. Chiết xuất protein và những polycaccharide. Isopropanol: kết tủa DNA. ß-mercaptoetha-nol: tác nhân phá hủy màng nhân và kháng lại sự oxi hóa, ức chế quá trình oxi hóa,há vỡ màng nhân, bảo vệ DNA khỏi những quinone, disulfite, peroxi-dase, polyphenoloxydase. ethanol 100% , kết tủa DNA.Rửa sạch DNA: có thể gây hại cho DNA do vậy phải kết hợp với muối. ethanol 70% rửa sạch DNA khi đó sẽ không gây hại cho DNA do ở nồng độ thấp. Bước 2:Thực hiện phản ứng PCR: Phản ứng PCR được thực hiện với các primer ngắn, thiết lập điều kiện phản ứng nghiêm ngặt để hạn chế tạo ra những sản phẩm không chính xác. Bước 3: Điện di phát hiện: Kết quả PCR – RAPD được điện di trên gel agarose. Bước 4: Dùng kết quả điện di mã hoá và chạy trên chương trình NTSYS để phân tích đa dạng di truyền giữa các chủng giống Kết quả : Có được bảng hệ số đồng dạng di truyền và sơ đồ cây loài từ đó có thể biết được mức độ gần gũi giữa các loài. Những ưu điểm của kỹ thuật RAPD : Về mặt kỹ thuật: Kỹ thuật RAPD dễ thực hiện và dễ thành công do không cần biết trước trình tự bộ gene của đối tượng cần nghiên cứu, thao tác đơn giản. Chất lượng DNA khuôn không cần độ tinh sạch cao. Thời gian thực hiện nhanh. Khả năng nhân bản cao. Về mặt kinh tế: Chi phí thực hiện thấp. Kỹ thuật RAPD thường được sử dụng kết hợp với những kỹ thuật cao cấp khác để đánh giá đa dạng di truyền và nhận diện chỉ thị phân tử có độ tin cậy cao Những hạn chế của kỹ thuật RAPD Kỹ thuật RAPD có độ chính xác không cao, không ổn định (thể hiện ở mức độ lặp lại giống nhau thấp). Khả năng nhân bản trong phản ứng PCR cao nhưng khả năng xuất hiện đa hình thấp và độ tin cậy không cao. Khả năng nhận diện chỉ thị phân tử thấp và có độ tin cậy không cao Primer: ITS 4 (5'-TCCTCCGCTTAT - TGATATGC) ITS 5 (5'-GGAAGTAAAAGTCGT - AACAAGG), Trình tự sắp xếp DNA của ITS của các loài thí nghiệm trong bảng 1: Kết quả: Trình tự phân tích Penicilium chủng Các khu vực 600 bp giữa 18S và 28S gen trong đó có 5-8s gen đã được khuếch đại. Hình trên thực hiện phản ứng RAPD phân tích 10 chủng P. roqueforti (1-10). 5 của P. carneum(11-15) và 5 của P. panium (16-20). Sử dụng mồi NS2(a) NS7(b). thứ tự các chủng như sau: PHẦN III: KẾT LUẬN Trong các kết luận gần đây về Penicilium roqueforti có những đều bất ngờ về các sản phẩm chuyển hoá thứ cấp của loài nấm mốc này ngoài việc sử dụng nó trong sản xuất phomat xanh. Tuy nhiên những phương pháp xác định hiện đại lẫn cổ điển về nó còn khiêm tốn, bởi những nghiên cứu này chủ yếu phục vụ cho những lợi nhuận kinh doanh riêng, những nghiên cứu cũng chỉ dừng lại ở việc biết rằng hoạt tính có lợi của nó, mà ít gây bệnh cho người sinh độc tố nhưng mức độ gây độc thấp. Đó là nói về thế giới xong ở Việt Nam chưa có nhiều tài liệu nghiên cứu về loài này. Hy vọng trong tương lai không xa loài này được biết đến với tài liệu rõ ràng và thông dụng hơn bây giờ. Penicilium roqueforti này sẽ có nhiều nữa những ứng dụng thực tế trong mọi khía cạnh cuộc sống.

Các file đính kèm theo tài liệu này:

  • docNấm Mốc Penicilium.doc