Đề tài Sử dụng kỹ thuật das-Elisa và rt-pcr để phát hiện virus gây bệnh đốm võng trên cây đu đủ (Papaya ringspot virus) tại hai tỉnh Đồng Nai và Đồng Tháp

MỤC LỤC LỜI CẢM ƠN .i TÓM TẮT .iv MỤC LỤC vi DANH SÁCH CÁC CHỮ VIẾT TẮT .ix DANH SÁCH CÁC HÌNH x DANH SÁCH CÁC BẢNG .xi DANH SÁCH CÁC ĐỒ THỊ . xii PHẦN I 1 GIỚI THIỆU 1 1.1. Đặt vấn đề .1 1.2. Mục đích .2 1.3. Yêu cầu .2 1.4. Đối tượng và phạm vi nghiên cứu 2 PHẦN II .3 TỔNG QUAN TÀI LIỆU 3 2.1. Sơ lược về cây đu đủ (Carica papaya L .) .3 2.1.1. Phân loại học 3 2.1.2. Nguồn gốc, phân bố .4 2.1.3. Đặc điểm thực vật học 4 2.1.4. Nhu cầu sinh thái 5 2.1.5. Ý nghĩa kinh tế và giá trị dinh dưỡng của đu đủ 6 Giá trị dinh dưỡng .6 Ứng dụng thực tiễn 7 2.1.6. Tình hình sản xuất 8 2.1.7. Sâu bệnh .9 Các loài côn trùng gây hại chính .10 Các bệnh phổ biến trên đu đủ 10 2.2. Sơ lược về Papaya ringspot virus và tác hại của nó trên đu đủ 11 2.2.1. Khái niệm chung về bệnh virus hại thực vật 11 2.2.2. Virus gây bệnh đốm vòng- Papaya ringspot virus (PRSV) 15 2.2.3. Những phương pháp chẩn đoán bệnh virus PRSV 20 Phương pháp quan sát triệu chứng 20 Phương pháp cây chỉ thị 20 Phương pháp chẩn đoán bằng hiển vi điện tử .21 Phương pháp huyết thanh học .21 Phương pháp chẩn đoán sinh học phân tử .22 Các phương pháp khác 22 2.2.4. Sơ lược về phương pháp ELISA- Enzyme Linked Immunosorbent Assay .22 2.2.5. Sơ lược về kĩ thuật RT-PCR (Reverse Transcriptase- Polymerase Chain Reaction) 24 PHẦN III .27 VẬT LIỆU VÀ PHưƠNG PHÁP NGHIÊN CỨU .27 3.1. Thời gian và địa điểm nghiên cứu 27 3.2. Phương pháp lấy mẫu .27 3.3. Phương pháp giám định bệnh đốm vòng trên đu đủ (Papaya Ringspot Desease) 28 3.3.1. Dụng cụ và thiết bị .28 3.3.2. Hóa chất .29 3.3.3. Quy trình thực hiện 31 Phương pháp ELISA .31 Phương pháp RT-PCR .35 PHẦN IV .39 KẾT QUẢ VÀ THẢO LUẬN .39 4.1. Hiện trạng canh tác cây đu đủ ở nơi lấy mẫu .39 4.2. Kết quả thu được từ thí nghiệm với bộ kit DAS- ELISA .40 4.2.1. Tỉ lệ nhiễm bệnh theo địa bàn điều tra 40 4.2.2. Tỉ lệ nhiễm bệnh theo giống cây .42 4.2.3. Tỉ lệ nhiễm bệnh theo tuổi cây .43 4.3. Kết quả thí nghiệm PCR .44 4.4. Kết quả giải trình tự một số mẫu 53 PHẦN V 56 KẾT LUẬN VÀ ĐỀ NGHỊ .56 5.1. Kết luận .56 5.2. Đề nghị 57 TÀI LIỆU THAM KHẢO .58 PHỤ LỤC 61 SỬ DỤNG KỸ THUẬT DAS-ELISA VÀ RT-PCR ĐỂ PHÁT HIỆN VIRUS GÂY BỆNH ĐỐM VÕNG TRÊN CÂY ĐU ĐỦ (Papaya ringspot virus) TẠI HAI TỈNH ĐỒNG NAI VÀ ĐỒNG THÁP

pdf99 trang | Chia sẻ: lvcdongnoi | Ngày: 04/06/2013 | Lượt xem: 1715 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Đề tài Sử dụng kỹ thuật das-Elisa và rt-pcr để phát hiện virus gây bệnh đốm võng trên cây đu đủ (Papaya ringspot virus) tại hai tỉnh Đồng Nai và Đồng Tháp, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
......................................................................................... Giống cây .................................................................................................................... Tuổi cây ...................................................................................................................... Tình trạng vƣờn .......................................................................................................... Cách trồng ................................................................................................................... Phƣơng pháp trồng .................................................................................................... Diện tích vƣờn, năng suất ........................................................................................... Độ thuần của vƣờn ...................................................................................................... Có vector truyền bệnh hay không? ............................................................................. Mùa vụ ........................................................................................................................ Bệnh có thƣờng xảy ra không? ................................................................................... Triệu chứng ................................................................................................................. .................................................................................................................................... 65 Phụ lục 7: BẢNG PHÂN PHỐI MẪU VÀ KẾT QUẢ THU ĐƢỢC TRÊN MỖI DĨA ELISA Đối tƣợng: Mẫu ly trích từ lá đu đủ Thời gian thực hiện: 25-5-2005 Các bƣớc thực hiện: Bƣớc 1: Coating antibodies Bƣớc 2: Coating sample Bƣớc 3: Coating enzyme Bƣớc 4: Substrate Thể tích phân phối: Coating antibody solution: 100 μl/giếng Mẫu ly trích và mẫu đối chứng: 100 μl/giếng Enzyme conjugate solution: 100 μl/giếng PNP substrate (S): 100 μl/giếng BF: Lysis buffer PC: Positive control NC: Negative control DĨA 1 1 2 3 4 5 6 7 8 9 10 11 12 A B S BF MH1 1.6 (+++) MH1 1.5 (+++) MH1 1.3 (+) MH1 1.4 (+) MH1 2.10 (+++) BT 3.8 (+) ĐQ 2.2 (-) ĐQ 2.1 (+) ĐQ 2.3 (+) C S BF MH1 1.6 (+++) MH1 1.5 (+++) MH1 1.3 (+) MH1 1.4 (+) MH1 2.10 (+++) BT 3.8 (+) ĐQ 2.2 (-) ĐQ 2.1 (+) ĐQ 2.3 (+) D S PC MH1 1.7 (+) MH1 1.10 (+) MH1 1.9 (+) MH1 2.5 (+++) MH1 2.6 (+) MH1 3.3 (-) ĐQ 2.9 (+) ĐQ 2.5 (-) ĐQ 2.10 (-) E S PC MH1 1.7 (+) MH1 1.10 (+) MH1 1.9 (+) MH1 2.5 (+++) MH1 2.6 (+) MH1 3.3 (-) ĐQ 2.9 (+) ĐQ 2.5 (-) ĐQ 2.10 (-) F S NC MH1 1.2 (+) MH1 1.1 (+++) MH1 1.8 (+) MH1 2.4 (+) BT 3.11 (+) BT 3.1 (+) ĐQ 2.7 (+) ĐQ 2.7 (-) ĐQ 2.11 (+) G S NC MH1 1.2 (+) MH1 1.1 (+++) MH1 1.8 (+) MH1 2.4 (+) BT 3.11 (+) BT 3.1 (+) ĐQ 2.7 (+) ĐQ 2.7 (-) ĐQ 2.11 (+) H 66 DĨA 2 1 2 3 4 5 6 7 8 9 10 11 12 A B S BF TP 2.2 (-) TP 2.10 (+) TP 2.3 (-) TP 2.18 (++) TP 2.8 (+) TP 2.4 (-) TP 3.1 (-) TP 2.5 (+) TP 3.10 (-) C S BF TP 2.2 (-) TP 2.10 (+) TP 2.3 (-) TP 2.18 (++) TP 2.8 (+) TP 2.4 (-) TP 3.1 (-) TP 2.5 (+) TP 3.10 (-) D S PC TP 2.20 (-) TP 2.13 (-) TP 2.12 (-) TP 2.16 (-) TP 2.17 (+) TP 2.6 (-) TP 2.14 (-) TP 3.5 (-) TP 3.6 (-) E S PC TP 2.20 (-) TP 2.13 (-) TP 2.12 (-) TP 2.16 (-) TP 2.17 (+) TP 2.6 (-) TP 2.14 (-) TP 3.5 (-) TP 3.6 (-) F S NC TP 2.19 (+++) TP 2.15 (++) TP 2.7 (-) TP 2.9 (-) TP 2.11 (+) TP 3.2 (+) TP 2.1 (-) TP 3.4 (+) TP 3.9 (-) G S NC TP 2.19 (+++) TP 2.15 (++) TP 2.7 (-) TP 2.9 (-) TP 2.11 (+) TP 3.2 (+) TP 2.1 (-) TP 3.4 (+) TP 3.9 (-) H DĨA 3 1 2 3 4 5 6 7 8 9 10 11 12 A B S BF MH1 5.1 (+) MH1 5.6 (+) MH1 5.4 (+++) MH1 5.10 (+++) MH1 3.3 (+++) MH1 3.4 (+++) MH1 3.8 (+++) MH1 2.8 (+++) MH1 2.3 (+++) C S BF MH1 5.1 (+) MH1 5.6 (+) MH1 5.4 (+++) MH1 5.10 (+++) MH1 3.3 (+++) MH1 3.4 (+++) MH1 3.8 (+++) MH1 2.8 (+++) MH1 2.3 (+++) D S PC MH1 5.7 (+) MH1 5.2 (-) MH1 5.5 (+) MH1 3.11 (+) MH1 3.1 (+++) MH1 3.6 (++) MH1 3.9 (+++) MH1 2.9 (++) MH1 2.1 (++) E S PC MH1 5.7 (+) MH1 5.2 (-) MH1 5.5 (+) MH1 3.11 (+) MH1 3.1 (+++) MH1 3.6 (++) MH1 3.9 (+++) MH1 2.9 (++) MH1 2.1 (++) F S NC MH1 5.3 (+) MH1 5.8 (+++) MH1 5.9 (-) MH1 3.5 (+++) MH1 3.2 (+) MH1 3.7 (+) MH1 3.10 (+++) MH1 2.2 (+) MH1 2.7 (+++) G S NC MH1 5.3 (+) MH1 5.8 (+++) MH1 5.9 (-) MH1 3.5 (+++) MH1 3.2 (+) MH1 3.7 (+) MH1 3.10 (+++) MH1 2.2 (+) MH1 2.7 (+++) H 67 DĨA 4 1 2 3 4 5 6 7 8 9 10 11 12 A B S BF ĐQ 1.1 (-) ĐQ 1.6 (-) ĐQ 1.5 (+) ĐQ 2.4 (+) TP 1.10 (-) TP 1.2 (-) TP 1.6 (-) TP 1.5 (-) TP 1.15 (-) C S BF ĐQ 1.1 (-) ĐQ 1.6 (-) ĐQ 1.5 (+) ĐQ 2.4 (+) TP 1.10 (-) TP 1.2 (-) TP 1.6 (-) TP 1.5 (-) TP 1.15 (-) D S PC ĐQ 1.3 (-) ĐQ 1.2 (-) ĐQ 1.8 (-) TP 1.12 (-) TP 1.11 (+) TP 3.7 (-) TP 1.7 (-) TP 1.14 (-) TP 1.8 (+) E S PC ĐQ 1.3 (-) ĐQ 1.2 (-) ĐQ 1.8 (-) TP 1.12 (-) TP 1.11 (+) TP 3.7 (-) TP 1.7 (-) TP 1.14 (-) TP 1.8 (+) F S NC ĐQ 1.7 (+) ĐQ 1.4 (-) ĐQ 2.8 (+) TP 1.3 (-) TP 1.13 (-) TP 3.8 (-) TP 1.9 (-) TP 1.4 (-) TP 1.17 (+) G S NC ĐQ 1.7 (+) ĐQ 1.4 (-) ĐQ 2.8 (+) TP 1.3 (-) TP 1.13 (-) TP 3.8 (-) TP 1.9 (-) TP 1.4 (-) TP 1.17 (+) H DĨA 5 1 2 3 4 5 6 7 8 9 10 11 12 A B S BF BT 1.1 (+) BT 1.4 (+++) BT 1.7 (+++) BT 1.9 (-) BT 2.2 (+) BT 2.4 (+) BT 2.9 (+) BT 3.2 (+) BT 3.9 (+) C S BF BT 1.1 (+) BT 1.4 (+++) BT 1.7 (+++) BT 1.9 (-) BT 2.2 (+) BT 2.4 (+) BT 2.9 (+) BT 3.2 (+) BT 3.9 (+) D S PC BT 1.2 (-) BT 1.5 (-) BT 1.10 (-) BT 2.11 (++) BT 2.12 (+) BT 2.7 (-) BT 2.10 (+) BT 3.10 (+) BT 3.4 (+) E S PC BT 1.2 (-) BT 1.5 (-) BT 1.10 (-) BT 2.11 (++) BT 2.12 (+) BT 2.7 (-) BT 2.10 (+) BT 3.10 (+) BT 3.4 (+) F S NC BT 1.3 (+) BT 1.6 (+) BT 1.8 (+) BT 2.1 (-) BT 2.6 (+) BT 2.8 (+) BT 3.5 (-) BT 3.7 (+) BT 3.6 (-) G S NC BT 1.3 (+) BT 1.6 (+) BT 1.8 (+) BT 2.1 (-) BT 2.6 (+) BT 2.8 (+) BT 3.5 (-) BT 3.7 (+) BT 3.6 (-) H 68 Phụ lục 8 Kết quả đọc trình từ của mồi P14 trên mẫu Mỹ Hiệp 69 Kết quả đọc trình tự của mồi M31 trên mẫu Mỹ Hiệp 70 Sự tƣơng đồng giữa hai mồi P14 và M31 của mẫu Mỹ Hiệp CLUSTAL X (1.83) multiple sequence alignment 25 ABI3100_Ic-P14_008_2005-08-2 1 CTTGCTTGATCGCTATGTCGATAG AAAAGATAACAAAAAGAAGAAAAAGA 50 ABI3100_Ic-M31_010_2005-08-2 ------------------------ -------------------------- ABI3100_Ic-P14_008_2005-08-2 51 TAAACAAAAAGACAAGAATTCATGAAGGTACTAGTGACGGAAACAATGTG 100 ABI3100_Ic-M31_010_2005-08-2 -------------------------------------------------- ABI3100_Ic-P14_008_2005-08-2 101 TCAACTAGTACCAAAACTGGAGAGAGAGATAGAGATGTCAATGCCGGAAC 150 ABI3100_Ic-M31_010_2005-08-2 -------------------------------------------------- ABI3100_Ic-P14_008_2005-08-2 151 TAGTGGAACTTTCACTGTTCCGAGAATAAAATCATTTACTGACAAGATCA 200 ABI3100_Ic-M31_010_2005-08-2 -------------------------------------------------- ABI3100_Ic-P14_008_2005-08-2 201 TTTTACCGAAAATTAAAGGAAAAACTGTCCTTAATTTAAATCATCTTCTT 250 ABI3100_Ic-M31_010_2005-08-2 -------------------------------------------------- ABI3100_Ic-P14_008_2005-08-2 251 CAGTATAATCCGCAACAAATTGATATCTCAAACACTCGTGCCACTCAAAC 300 ABI3100_Ic-M31_010_2005-08-2 -------------------------------------------------- ABI3100_Ic-P14_008_2005-08-2 301 TCAATTCGAAAAGTGGTATGGGGGAGTGAGGAATGATTACGGTCTCAACG 350 ABI3100_Ic-M31_010_2005-08-2 -------------------------------------------------- ABI3100_Ic-P14_008_2005-08-2 351 ATAACGAAATGCAAGTGATGTTAAACGGTTTGATGGTTTGGTGTATTGAA 400 ABI3100_Ic-M31_010_2005-08-2 -------------------------------------------------- ABI3100_Ic-P14_008_2005-08-2 401 AATGGTACATCTCCAGACTTATCTGGTGTTTGGGTAATGATGGATGGGGA 450 ABI3100_Ic-M31_010_2005-08-2 -------------------------------------------------- ABI3100_Ic-P14_008_2005-08-2 451 AACACAAGTTGATTATCCCATTAAGCCTTTAATTGAACATGCAACTCCTT 500 ABI3100_Ic-M31_010_2005-08-2 -------------------------------------------------- ABI3100_Ic-P14_008_2005-08-2 501 CGTTTAGGCAAATCATGGCTCACTTCAGTAACGCGGCAGAGGCATACATC 550 ABI3100_Ic-M31_010_2005-08-2 -------------------------------------------------- ABI3100_Ic-P14_008_2005-08-2 551 GCGAAGAGGAATGCAACTGAAAGGTATATGCCGCGGTATGGAATCAAGAG 600 ABI3100_Ic-M31_010_2005-08-2 -------------------------------------------------- ABI3100_Ic-P14_008_2005-08-2 601 GAATTTGACTGACATTAGCCTCGCTAGATACGCTTTCG ATA 641 ABI3100_Ic-M31_010_2005-08-2 ------------------------------NNNNN--- --- 639 71 Phụ lục 9 Kết quả giải trình tự với mồi P14 của mẫu Định Quán 72 Kết quả giải trình từ với mồi M30 của Định Quán 73 Sự tƣơng đồng của hai mồi P7 và M30 của mẫu Định Quán CLUSTAL X (1.83) multiple sequence alignment ABI3100_DQ17-P7_015_2005-08- -------------------------------------------------- ABI3100_DQ17-M30_002_2005-08 1 CCTCCCCGCGGCTCTCTCCCGCGAAAAATCTCCCGTTTTAATGGCCCTTT 50 ABI3100_DQ17-P7_015_2005-08- -------------------------------------------------- ABI3100_DQ17-M30_002_2005-08 51 TGGGGGAGGGTGTTAATAATATGTTTTTTTTTTTGTGGGGGGCCCCCTCC 100 ABI3100_DQ17-P7_015_2005-08- -------------------------------------------------- ABI3100_DQ17-M30_002_2005-08 101 CCCCCCACACACCACTATTTTTTTTTTTTAACCCACAAAAAAAAAACAAC 150 ABI3100_DQ17-P7_015_2005-08- -------------------------------------------------- ABI3100_DQ17-M30_002_2005-08 151 CTAAAACCCCTCTTTTTGTGGTGGAGAGAATAGACCCCCCCCCCCCTAAA 200 ABI3100_DQ17-P7_015_2005-08- -------------------------------------------------- ABI3100_DQ17-M30_002_2005-08 201 AAATATAAAAAAAGTGATGCGCAGTTGGGGTTACCAATTGGGCTTTGAAG 250 ABI3100_DQ17-P7_015_2005-08- -------------------------------------------------- ABI3100_DQ17-M30_002_2005-08 251 AAAAATTTTTTAATATTAACCTTTTCCCCTTATTTTTTTAATATCATCTT 300 341-m30 ABI3100_DQ17-P7_015_2005-08- ---------------------------------------- ---------- ABI3100_DQ17-M30_002_2005-08 301 GTCAGTAAATGATTTTATTCTAATCTCGGGACCAGTGGAA CTTTCACGGT 350 1 ABI3100_DQ17-P7_015_2005-08- --CGAGAATAAAATCATTTACTGACAAGATGATATTACCAAAAATTAAGG 47 ABI3100_DQ17-M30_002_2005-08 351 TCCGAGAATAAAATCATTTACTGACAAGATGATATTACCAAAAATTAAGG 400 * ** *************** *********************** ABI3100_DQ17-P7_015_2005-08- 48 GAAAAACTGTCCTTAATTTAAATCATCTTCTTCAGTATAATCCGCAACAA 97 ABI3100_DQ17-M30_002_2005-08 401 GAAAAACTGTCCTTAATTTAAATCATCTTCTTCAGTATAATCCGCAACAA 450 ************************************************** ABI3100_DQ17-P7_015_2005-08- 98 ATTGATATCTCAAACACTCGTGCCACTCAAACTCAATTTGAAAAGTGGTA 147 ABI3100_DQ17-M30_002_2005-08 451 ATTGATATCTCAAACACTCGTGCCACTCAAACTCAATTTGAAAAGTGGTA 500 ************************************************** ABI3100_DQ17-P7_015_2005-08- 148 TGAGGGAGTGCGGAATGATTACGGTCTTAACGATGACGAAATGCAAGTGA 197 ABI3100_DQ17-M30_002_2005-08 501 TGAGGGAGTGCGGAATGATTACGGTCTTAACGATGACGAAATGCAAGTGA 550 ************************************************** ABI3100_DQ17-P7_015_2005-08- 198 TGTTAAATGGTTTGATGGTTTGGTGTATCGAAAATGGTACATCTCCAGAC 247 ABI3100_DQ17-M30_002_2005-08 551 TGTTAAATGGTTTGATGGTTTGGTGTATCGAAAATGGTACATCTCCAGAC 600 ************************************************** ABI3100_DQ17-P7_015_2005-08- 248 TTGTCTGGTGTTTGGGTAATGATGGATGGGGAAATACAAGTAGATTATCC 297 ABI3100_DQ17-M30_002_2005-08 601 TTGTCTGGTGTTTGGGTAATGATGGATGGGGAAATACAAGTAGATTATCC 649 *********************** * * ********************** ABI3100_DQ17-P7_015_2005-08- 298 CATCA-AGCCTTTAATTGAACATGCAACTCCCTCGTTTAGGCAAATCATG 346 ABI3100_DQ17-M30_002_2005-08 650 CATCA-AGCCTTTAATTGAACATGCAACTCCCTCGTTTAGGCAAATCATG 699 **** ************* ************************ ***** ABI3100_DQ17-P7_015_2005-08- 347 GCTCACTTCAGTAACGCGGCAGAGGCATACATCGCAAAGAGAATG CCACT 396 ABI3100_DQ17-M30_002_2005-08 701 GCTCACTTCAGTAACGCGGCAGAGGCATACAT------------- ----- ****** ******************* * *732 391-P7 ABI3100_DQ17-P7_015_2005-08- 397 GAGAGGAGTGAAAGTTCCCCTGGTCCCCAAAACGGAGGGGTAGGAAAAGG 446 ABI3100_DQ17-M30_002_2005-08 -------------------------------------------------- ABI3100_DQ17-P7_015_2005-08- 447 A ABI3100_DQ17-M30_002_2005-08 - 74 Phụ lục 10 Kết quả giải trình tự với mồi P7 của mẫu Mỹ Hiệp 75 Kết quả giải trình tự với mồi M30 của mẫu Mỹ Hiệp 76 Sự tƣơng đồng của hai mồi P7 và M30 của mẫu Mỹ Hiệp CLUSTAL X (1.83) multiple sequence alignment ABI3100_I-P7_004_2005-08-24 -------------------------------------------------- ABI3100_I-M30_006_2005-08-24 1 TGATTTGTAATTACACCACGTTTTCGCCTTCAAACTTTTCTTGGATATGC 50 ABI3100_I-P7_004_2005-08-24 -------------------------------------------------- ABI3100_I-M30_006_2005-08-24 51 TCAACAAACTTCTCTGTCCGTGAACAATGGAGCAGTCAAGCAATTGGCGG 100 ABI3100_I-P7_004_2005-08-24 -------------------------------------------------- ABI3100_I-M30_006_2005-08-24 101 ATAAGAGGTTTAGGGGTGTGAGTGGGTTTTTCCGGTCAACTCTCTCGGGG 150 1 ABI3100_I-P7_004_2005-08-24 -------------------------------------------CGATCGA 7 ABI3100_I-M30_006_2005-08-24 151 AGATTCATGTGCTAAATTCGGACCCAGTGGAACTTTCACGGTTCGATCGA 200 * * ABI3100_I-P7_004_2005-08-24 8 GATAATCATTTACTGACA-GATGATTTTACCGAAAATTAAAGGAAAAACT 56 ABI3100_I-M30_006_2005-08-24 201 GATAATCATTTACTGACA-GATGATTTTACCGAAAATTAAAGGAAAAACT 250 * **** ********** ************* ***************** ABI3100_I-P7_004_2005-08-24 57 GTCCTTAATTTTAAATCATCTTCTTCAGTATAATCCGCAACAAATTGATA 106 ABI3100_I-M30_006_2005-08-24 251 GTCCTTAATTTTAAATCATCTTCTTCAGTATAATCCGCAACAAATTGGTA 299 **** ****** *********** ********** ********* ** ABI3100_I-P7_004_2005-08-24 107 TCTCAAACACTCGTGCCACTCAAACTCAATTCGAAAAGTG-GTATGAGGG 155 ABI3100_I-M30_006_2005-08-24 300 TCTCAAACACTCGTGCCTCTCAAACTCAATTCGAAAAGTG-GTATGAGGG 349 ******* ** ***** ******* *** **** * ** ABI3100_I-P7_004_2005-08-24 156 AGTGAGGAATGATTACGGTCTCAACGATAACGAAATGCAAGTG-ATGTTA 204 ABI3100_I-M30_006_2005-08-24 350 AGTGAGGAATGATTACGGTCTCAACGATAACGAAATGCAAGTG-ATGTTA 399 ** *** *** ** * * ** * ***** ***** * * * ABI3100_I-P7_004_2005-08-24 205 AACGGTTTGATGGTTTGGTGTATTGAAAATGGTACATCTCCAGACTTATC 254 ABI3100_I-M30_006_2005-08-24 400 AACGGTTTGATGGTTTGGTGTATTGAAAATGGTACATCTCCAGACTTATC 449 ** * * ********* * * ****** ****** ****** *** ABI3100_I-P7_004_2005-08-24 255 TGGTGTTTGGGTAATGATGGATGGGGAAACACAAGTTGATTATCCCATTA 304 ABI3100_I-M30_006_2005-08-24 450 TGGTGTTTGGGTAATGATGGATGGGGAAACACAAGTTGATTATCCCATTA 499 * ******************** ************** ****** *** ABI3100_I-P7_004_2005-08-24 305 AGCCTTTAATTGAACATGC AACTCCTTCGTTTAGGCAAATCATGGCTCAC 354 ABI3100_I-M30_006_2005-08-24 500 AGCCTTTAATTGAACATGC AACTCCTTCGTCCAGGCAAATCATGGCTCAC 544 ******************* ** * ** ** * * * ABI3100_I-P7_004_2005-08-24 255 TTCAGTAACGCGGCAGAGGCATACATCGCAAAGAGAAATGCCACTGAAAG 404 ABI3100_I-M30_006_2005-08-24 545 TTCAGTAACGCGGCAGAGGCATACATCGCAAAGAGAAATGCCACTGAAAG 589 *** * * * * *** * * **** * * ** **** ABI3100_I-P7_004_2005-08-24 405 --GAATATGCCGCGGTATGGAATCAAGAGGAATTTGACTGACATTAGTCT 452 ABI3100_I-M30_006_2005-08-24 590 --GAATATGCCGCGGTATGGAATCAAGAGGAATTTGACTGACATTAGTCT 639 ** * ** *** * * * ** ** * * ABI3100_I-P7_004_2005-08-24 453 CGCCAGAT--ATGCTTTCGACTTCTATG--AGGTGAATTCAAA--AACAC 496 ABI3100_I-M30_006_2005-08-24 640 CGCCAGAT--ATGCTTTCGACTTCTATG--AGGTGAATTCAAA--AACAC 689 * ** ** ** * ** ** * ** **** * * ABI3100_I-P7_004_2005-08-24 497 CTGATA-GAGCTCGTGAAGCTCATATGCAGA-TGAAGGCTGCAGCACTGC 544 ABI3100_I-M30_006_2005-08-24 690 GTGATA-GAGCTCGTGAAGCTCATATGCAGA-TGAAGGCTGCAGCACTGC 739 ** ** *** **** * * * * * ** * * * *** *** ABI3100_I-P7_004_2005-08-24 545 GTACTACTGGTCGCAGAATGTTTGGAATGGACGGCAGTGTCAGTAACAAG 594 ABI3100_I-M30_006_2005-08-24 740 GTACTACTGGTCGCAGAATGTTTGGAATGGACGGCAGTGTCAGTAACAAG 789 * * ** * *** * *** ** *** * *** * * ABI3100_I-P7_004_2005-08-24 595 GAAGAAAACACGGAGAGACACACAGTGGAAGATGTCAATAGA-GACATGC 643 ABI3100_I-M30_006_2005-08-24 790 GAAGAAAACACGGAGAGACACACAGTGGAAGATGTCAATAGA-GACATGC 839 * ******* *** *** * * * * * * * * **** ABI3100_I-P7_004_2005-08-24 644 ACTCTCTCCTGGGTATGCGCAACTGA-ATACTCGCCCATGGTTAGCTAAC 692 ABI3100_I-M30_006_2005-08-24 840 ACTCTCTCCTGGGTATGCGCAACTGA-ATACTCGCCCATGGTTAGCTAAC 899 * * ** * ***** * ** * * *** ************ 77 ABI3100_I-P7_004_2005-08-24 693 CATGGGAGAGCACTCAGTTGCGCGGCAGAGGAAGAGAGCGCATGCACAAG 730 ABI3100_I-M30_006_2005-08-24 890 CATGGGAGAGCACTCAGTTGCGCGGCAGAGGAAGAGAG------------ 935 ****** *** * ***** ************ * *926 ABI3100_I-P7_004_2005-08-24 743 TGCCCCTGAAAGACTGTGCCCTCTCCGTGGTTTCATACAAGAAAGAGACA 792 ABI3100_I-M30_006_2005-08-24 -------------------------------------------------- ABI3100_I-P7_004_2005-08-24 793 AAGGCGTCCCTTCAAAAATTCTGCGACTGTATTACGCGAGCTGGAGCTTT 842 ABI3100_I-M30_006_2005-08-24 -------------------------------------------------- ABI3100_I-P7_004_2005-08-24 843 CTAAGGAATATGGCTCCCGAGCTAAATAGAG 873 ABI3100_I-M30_006_2005-08-24 ------------------------------- 78 Phụ lục 11 Đoạn tƣơng đồng chung cho cả 3 mẫu CLUSTAL X (1.83) multiple sequence alignment DQ ------------------------------------------------------------ Ic 1 AAAAGATAACAAAAAGAAGAAAAAGATAAACAAAAAGACAAGAATTCATGAAGGTACTAG 60 I ------------------------------------------------------------ DQ ------------------------------------------------------------ Ic 61 TGACGGAAACAATGTGTCAACTAGTACCAAAACTGGAGAGAGAGATAGAGATGTCAATGC 120 I ------------------------------------------------------------ 1 12 DQ 1 --------------CTTTCACGGTT CCGAGAATAAAATCATTTACTGACAAGATGATTTT 46 Ic 121 CGGAACTAGTGGAACTTTCACTGTT CCGAGAATAAAATCATTTACTGACAAGATGATTTT 180 I ------------------------- CCGAGAATAAAATCATTTACTGACAAGATGATTTT 34 1* * * *************** *** ** ** DQ 47 ACCGAAAATTAAAGGAAAAACTGTCCTTAATTTTAAATCATCTTCTTCAGTATAATCCGC 105 Ic 181 ACCGAAAATTAAAGGAAAAACTGTCCTTAATTTTAAATCATCTTCTTCAGTATAATCCGC 239 I 35 ACCGAAAATTAAAGGAAAAACTGTCCTTAATTTTAAATCATCTTCTTCAGTATAATCCGC 94 *** ******** ******************** ************************** DQ 106 AACAAATTGATATCTCAAACACTCGTGCCACTCAAACTCAATTCGAAAAGTG-GTATGAG 164 Ic 240 AACAAATTGATATCTCAAACACTCGTGCCACTCAAACTCAATTCGAAAAGTG-GTATGAG 298 I 95 AACAAATTGATATCTCAAACACTCGTGCCACTCAAACTCAATTCGAAAAGTG-GTATGAG 153 ******************************************* ******** ***** * DQ 165 GGAGTGAGGAATGATTACGGTCTCAACGATAACGAAATGCAAGTG-ATGTTAAACGGTTT 223 Ic 299 GGAGTGAGGAATGATTACGGTCTCAACGATAACGAAATGCAAGTG-ATGTTAAACGGTTT 357 I 154 GGAGTGAGGAATGATTACGGTCTCAACGATAACGAAATGCAAGTG-ATGTTAAACGGTTT 212 ****** **************** ****** ************** ******** ***** DQ 224 GATGGTTTGGTGTATTGAAAATGGTACATCTCCAGACTTATCTGGTGTTTGGGTAATGAT 283 Ic 358 GATGGTTTGGTGTATTGAAAATGGTACATCTCCAGACTTATCTGGTGTTTGGGTAATGAT 417 I 213 GATGGTTTGGTGTATTGAAAATGGTACATCTCCAGACTTATCTGGTGTTTGGGTAATGAT 272 *************** *********************** ******************** DQ 284 GGATGGGGAAACACAAGTTGATTATCCCATTAAGCCTTTAATTGAACATGCAACTCCTTC 343 Ic 418 GGATGGGGAAACACAAGTTGATTATCCCATTAAGCCTTTAATTGAACATGCAACTCCTTC 477 I 273 GGATGGGGAAACACAAGTTGATTATCCCATTAAGCCTTTAATTGAACATGCAACTCCTTC 332 *********** ****** *********** ************************** ** DQ 344 GTTTAGGCAAATCATGGCTCACTTCAGTAACGCGGCAGAGGCATACATCGCAAAGAGGAA 402 Ic 478 GTTTAGGCAAATCATGGCTCACTTCAGTAACGCGGCAGAGGCATACATCGCAAAGAGGAA 537 I 333 GTTTAGGCAAATCATGGCTCACTTCAGTAACGCGGCAGAGGCATACATCGCAAAGAGGAA 392 *************************************************** ***** ** 404 DQ 403 TG ---------------------------------------------------------- Ic 538 TG CAACTGAAAG--GTATATGCCGCGGTATGGAATCAAGAGGAATTTGACTGACATTAGC 595 I 393 TG CCACTGAAAG--GAATATGCCGCGGTATGGAATCAAGAGGAATTTGACTGACATTAGT 450 ** DQ ------------------------------------------------------------ Ic 596 CTCGCTAGAT--ACGCTTTCG--------------------------------------- 614 I 451 CTCGCCAGAT--ATGCTTTCGACTTCTATG--AGGTGAATTCAAA--AACACCTGATA-G 503 DQ ------------------------------------------------------------ Ic ------------------------------------------------------------ I 504 AGCTCGTGAAGCTCATATGCAGA-TGAAGGCTGCAGCACTGCGTACTACTGGTCGCAGAA 562 DQ ------------------------------------------------------------ Ic ------------------------------------------------------------ I 563 TGTTTGGAATGGACGGCAGTGTCAGTAACAAGGAAGAAAACACGGAGAGACACACAGTGG 622 DQ ------------------------------------------------------------ Ic ------------------------------------------------------------ I 623 AAGATGTCAATAGA-GACATGCACTCTCTCCTGGGTATGCGCAACTGA-ATACTCGCCCA 680 DQ -------------------------------------------------- Ic -------------------------------------------------- I 681 TGGTTAGCTAACCATGGGAGAGCACTCAGTTGCGCGGCAGAGGAAGAGAG 730 Đoan chung cho ca ba = 393 79 Phụ lục 12 Kết quả so với trình tự của CP-PRSV trên Genebank CLUSTAL X (1.83) multiple sequence alignment 3 ------------------------------------------------------------ AJ012649 TCCAAGAATGAAGCTGTGGATGCTGGTTTGGATGAAAAACTCAAAGAAAAAGAAAAACAG 60 3 ------------------------------------------------------------ AJ012649 AAAGAAAAAGAAAAACAAAAAGAAAAAGAAAAAGACAATGCTAGTGACGGAAATGATGTG 120 3 ------------------------------------------------------------ AJ012649 TCGACTAGCACAAGAACTGGAGAGAAAGATAGAGATGTCAATGTCGGGACCAGTGGAACT 180 3 1 ---------CCGAGAATAAAATCATTTACTGACAAGATGATTTTACCGAAAATTAAAGGA 51 AJ012649 181 TTCACGGTTCCGAGAATTAAATCATTCACTGATAAGATGATTCTACCAAGAATTAAGGGA 240 190******** ******** ***** ********* **** * ****** *** 3 AAAACTGTCCTTAATTTTAAATCATCTTCTTCAGTATAATCCGCAACAAATTGATATCTC 111 AJ012649 AAGACTGTCCTTAATTT-AAATCATCTTCTTCAGTATAATCCGCAACAAATTGACATTTC 299 ** ************** ************************************ ** ** 3 AAACACTCGTGCCACTCAAACTCAATTCGAAAAGTGGTATGAGGGAGTGAGGAATGATTA 171 AJ012649 TAACACTCGTGCCACTCAGTCACAATTTGAGAAATGGTATGAGGGAGTGAGGAATGATTA 359 ***************** * ***** ** ** ************************** 3 CGGTCTCAACGATAACGAAATGCAAGTG-ATGTTAAACGGTTTGATGGTTTGGTGTATTG 230 AJ012649 TGGTCTGAATGATAATGAAATGCAAGTG-ATGCTGAATGGCTTGATGGTTTGGTGTATCG 418 ***** ** ***** ************ *** * ** ** ***************** * 3 AAAATGGTACATCTCCAGACTTATCTGGTGTTTGGGTAATGATGGATGGGGAAACACAAG 290 AJ012649 AGAATGGTACATCTCCAGACATATCTGGTGTTTGGGTTATGATGGATGGGGAAATTCAAG 478 * ****************** **************** **************** **** 3 TTGATTATCCCATTAAGCCTTTAATTGAACATGCAACTCCTTCGTTTAGGCAAATCATGG 350 AJ012649 TTGACTATCCAATCAAGCCTTTAATTGAGCATGCTACCCCGTCATTTAGGCAGATTATGG 538 **** ***** ** ************** ***** ** ** ** ******** ** **** 3 351 CTCACTTCAGTAACGCGGCAGAGGCATACATCGCAAAGAGGAATG--------------- 396 AJ012649 CTCACTTTAGTAACGCGGCAGAAGCATATATTGCAAAGAGAAATGCCACTGAGAGGTACA 598 ******* ************** ***** ** ******** **** 583 3 ------------------------------------------------------------ AJ012649 TGCCGCGGTATGGAATCAAGAGAAATTTGACTGACATTAGCCTCGCTAGATACGCTTTCG 3 ------------------------------------------------------------ AJ012649 ATTTCTATGAGGTTAATTCGAAAACACCTGATAGGGCTCGCGAAGCTCACATGCAGATGA 3 ------------------------------------------------------------ AJ012649 AAGCTGCAGCGCTGCGAAACACTAGTCGCAGAATGTTTGGTATGGACGGCAGTGTTAGTA 3 ------------------------------------------------------------ AJ012649 ATAAGGAAGAAAACACGGAGAGACACACAGTGGAAGATGTCAATAGAGACATGCACTCTC 3 ------------------------------------------------------------ AJ012649 TCCTGGGTATGCGCAACTGAATACTCGCGCTGGTGTGTTTGTCGAGCTCGACTCGACCTT 3 ------------------------------------------------------------ AJ012649 GTTTCACCTTATAGTACTAAATAAGCATTAGAATACAGTGTGGCTGTGCCACCACTTCTA 3 ------------------------------------------------------------ AJ012649 TTTTACAGTGAGGGTAGCCCTCCGTGCTTTTAGTATTATTCGAGTTCTCTGAGTCTCCAT 3 --------------------------- AJ012649 ACAGTGTGGGTGGCCCACGTGTTATTT ALIGN 396 NU 80 Phụ lục 13 Kết quả so với genome của PRSV trên Genebank CLUSTAL X (1.83) multiple sequence alignment 3 ------------------------------------------------------------ AY231130 1 AAATAAAACATCTCAACACAACATAATCAAAAGCATTTCAACAAACATCAACTTATCTCA 60 3 ------------------------------------------------------------ AY231130 TTTTAAATTGTTATAGTAAGCGACAATGTCTTCTTTGTATACTTTGCGAGCAGCAGCTCA 120 3 ------------------------------------------------------------ AY231130 ATACGATAGGAGGTTGGAGAGTAAGAAAGGTGCTGGCTGGATCGAGCACAAACTCGAGAG 180 3 ------------------------------------------------------------ AY231130 GAAAGGGGATAAAGGAAACACTCACTATTGTAGTGAGTTTGACATTAGCAAGGGTGCCAA 240 3 ------------------------------------------------------------ AY231130 AATTCTGCAATTGGTGCAAATTGGTAGCGCTGAAGTTGGAAGGACCTTCCTGGAGGGTAA 300 3 ------------------------------------------------------------ AY231130 CAGATTTGTCCGTGCGAACATATTTGAGATCATCCGGAAAACCATGGTTGGTCGTCTAGG 360 3 ------------------------------------------------------------ AY231130 ATATGATTTCGAGAGTGAACTATGGGTCTGTCATAACTGCAACAGAACTTCTGAAAAATA 420 3 ------------------------------------------------------------ AY231130 CCTCAAGAAATGTGACTGCGGGGAAAAATATTATTACTCTGAAAGAAACCTGATGAAAAC 480 3 ------------------------------------------------------------ AY231130 AATGAACGACCTGACGTATCAATTTGACATGACACCATCAGAGATCAACTCCGTCGATTT 540 3 ------------------------------------------------------------ AY231130 TGATTACCTTGCTGATGCAGTGGATTATGCTGAACGGTCAGTCCAGAAATCTCAAGTTCC 600 3 ------------------------------------------------------------ AY231130 GGAACCTGTGGAACTTGTAGTGGTGGAACCAATTGCGGCTAGTGAGGAAGGTACTCTAAT 660 3 ------------------------------------------------------------ AY231130 GGTTTCTGAACCAGAAGTTGTACCTGCAACTACCAAAATTGAAGATGCATGGACAATACA 720 3 ------------------------------------------------------------ AY231130 GATTGGGGAAATTCCTGTCCCACTTGTCGTCATCAAAGAGACGCCAGTTATCAGTGGTGT 780 3 ------------------------------------------------------------ AY231130 GAACGGAACTTTGAACTCAACTGGTTTCTCACTTGAAGCTGAGATTACAAAACTGGTGGA 840 3 ------------------------------------------------------------ AY231130 GAAGGAAGTCTCTCAAGAAGAGGTTAAAGAAGCAGTGCATCTGGCACTCGAAGTTGGTAA 900 3 ------------------------------------------------------------ AY231130 CGAGATTGCTGAGAAGAAGCCTGAACTCAAGCTAATACCATACTGGAGTGCTAGCCTTGA 960 3 ------------------------------------------------------------ AY231130 GTTGCACAAGAGAATTCGTAAGCATAAGGAGCATGCTAAGATTGCAGCAATTCAAGTCCA 1020 3 ------------------------------------------------------------ AY231130 GAAGGAAAGAGAAAAGAACCAAAAGATATTCTCAATTCTAGAGTCGAAGCTCAACTTAAA 1080 3 ------------------------------------------------------------ AY231130 ATCCAGGAGGAGAAATCAAACTGTGGTCTGTGACAAAAGAGGCACACTTAAATGGAAAAC 1140 3 ------------------------------------------------------------ AY231130 CCGGCAAGGTTACAAGAAGAGTAGACTAATGCAACAAGCGAGTGACTCTGTTGTCACTCA 1200 81 3 ------------------------------------------------------------ AY231130 GATTTACTGTGATTTTGGTTGTGAACCTCAATATTCTGAACCTCACTCTTCTGGCATTAA 1260 3 ------------------------------------------------------------ AY231130 AATAGCGACATCTAAGAAGGTCCACAAACCGCGCAAGCAATCGAGGATTGTTGGTAATAA 1320 3 ------------------------------------------------------------ AY231130 CAAGATAAATTATGTCATGAAACATCTATGTGACACAATTATCGAAAGAAGCATTCCTGT 1380 3 ------------------------------------------------------------ AY231130 AGAGCTTGTTACAAAGCGATGCAAGAGAAGGATTCTTCAGAAGAAAGGTAGAAGCTATGT 1440 3 ------------------------------------------------------------ AY231130 GCAGTTGAGGCACATGGATGGCATTCGTGCACAACAAGATGTGAGCAGCTCGCCTGATAT 1500 3 ------------------------------------------------------------ AY231130 GGAGCGGTTATTCACGCAATTTTGCAAATTTTTAGTTGGGCACAAACCACTCAAATCTGA 1560 3 ------------------------------------------------------------ AY231130 AAGTCTGACGTTTGGTTCTAGTGGTCTGATTTTTAAGCCAAAGTTTGCCGCCAATGTGGG 1620 3 ------------------------------------------------------------ AY231130 GCGATATTTTGGTGATTATTTCGTTGTTCGAGGACGTCTTGAAGGTAAGCTATTTGATGG 1680 3 ------------------------------------------------------------ AY231130 TAGATCAAAACTAGCGAGATCGATCTATGCCAGGATGGAGCAATACAATGATGTGGCCGA 1740 3 ------------------------------------------------------------ AY231130 AAAATTTTGGCTCGGTTTTAATAGGGCTTTTCTACGGCATAGAAAACCAACGGATCACAC 1800 3 ------------------------------------------------------------ AY231130 TTGCACGTCTGATATGGATGTTACAATGTGTGGGGAGGTAGCAGCTCTGGCAACTATAAT 1860 3 ------------------------------------------------------------ AY231130 TTTGTTTCCGTGCCACAAAATAACTTGCAACACTTGCATGAGCAGAGTGAAGGGAAGAGT 1920 3 ------------------------------------------------------------ AY231130 AATTGACGAAGTTGGTGAGGATTTGAATTCTGAGCTTGAACGTTTACGTGAAACTCTTTC 1980 3 ------------------------------------------------------------ AY231130 TTCATATGGAGGGTCATTCGGACATGTTTCAACATTACTTGATCAAATGAATAGAGTTTT 2040 3 ------------------------------------------------------------ AY231130 GAATGCGCGGAACACAAACGATGGAGCTTTTAAAGAGATTGCGAAGAAGATTGATGCAAA 2100 3 ------------------------------------------------------------ AY231130 GAAAGAGAGTCCTTGGACTCACATGACAACTATCAACAACACGCTCATCAAAGGTTCGCT 2160 3 ------------------------------------------------------------ AY231130 AGCAACTGGTTACGAATTTGAAAGAGCGTCTGATAGTCTCCTAGAGATTGTGAGATGGCA 2220 3 ------------------------------------------------------------ AY231130 TCTCAAAAGGACAGAATCAATAAAAGCTGGCAGCGTTGAGAGTTTTAGAAATAAGCGTTC 2280 3 ------------------------------------------------------------ AY231130 TGGGAAAGCTCACTTCAACCCAGCTCTTACGTGTGATAATCAGTTGGATAGGAATGGTAA 2340 3 ------------------------------------------------------------ AY231130 TTTCTTATGGGGTGAAAGGCAATACCACGCCAAAAGATTCTTTGCCAACTATTTCGAGAA 2400 3 ------------------------------------------------------------ AY231130 GATTGATCATAGTAAGGGTTATGAGTACTATAGTCAACGCCAAAACCCAAATGGTACCAG 2460 3 ------------------------------------------------------------ AY231130 GAAAATTGCCATTGGTAATTTAGTATTTTCAACAAATTTGGATAGATTTCGGCAGCAAAT 2520 3 ------------------------------------------------------------ AY231130 GGTTGAACACCACATTGATCAAGGACCAATCACTCGTGAGTGCATCGCATTGCGCAATAA 2580 82 3 ------------------------------------------------------------ AY231130 CAATTATGTTCATGTATGTAGCTGTGTAACTTTAGATGATGGAACTCCAGCAACAAGTGA 2640 3 ------------------------------------------------------------ AY231130 GTTGAAGACTCCTACCAAGAATCATATCGTTCTTGGTAATTCTGGTGATCCCAAGTACGT 2700 3 ------------------------------------------------------------ AY231130 TGACTTGCCGACTCTTGAGTCTGATTCAATGTACATAGCCAAAAAAGGTTATTGCTACAT 2760 3 ------------------------------------------------------------ AY231130 GAACATATTTTTAGCGATGCTCATAAATATACCTGAGAATGAGGCGAAAGATTTCACAAA 2820 3 ------------------------------------------------------------ AY231130 GAGAGTTCGCGACCTCGTGGGTTCAAAACTTGGAGAGTGGCCAACGATGTTGGATGTCGC 2880 3 ------------------------------------------------------------ AY231130 AACATGCGCAAATCAGCTGATAATCTTTCATCCTGACGCAGCCAATGCAGAATTGCCGCG 2940 3 ------------------------------------------------------------ AY231130 AATTTTAGTGGACCATCGACAGAAAACAATGCATGTTATTGACTCTTTTGGTTCCGTGGA 3000 3 ------------------------------------------------------------ AY231130 TTCTGGATATCATATGTTGAAGGCAAACACAGTTAATCAGCTAATCCAATTCGCTAGAGA 3060 3 ------------------------------------------------------------ AY231130 GCCACTCGATAGTGAAATGAAGCACTACATCGTTGGTGGAGAGTTTGACCCAACTACTAA 3120 3 ------------------------------------------------------------ AY231130 CTGCTTGCATCAGTTGATTCGTGTCATCTACAAGCCTCATGAACTCCGGAACTTGCTCAG 3180 3 ------------------------------------------------------------ AY231130 GAATGAACCGTACCTGATTGTGATTGCATTGATGTCACCAAGTGTACTTTTGACTTTGTT 3240 3 ------------------------------------------------------------ AY231130 CAATAGTGGTGCGATTGAGCACGCGTTGAATTACTGGATCAAAAGAGATCAAGATGTTGT 3300 3 ------------------------------------------------------------ AY231130 TGAGGTCATTGTTTTGGTGGAGCAATTATGCAGGAAAGTTACACTTGCTAGAACAATCCT 3360 3 ------------------------------------------------------------ AY231130 GGAGCAATTTAATGAGATTCGTCAAAATGCGAGAGATATACATGAGCTAATGGATCGAAA 3420 3 ------------------------------------------------------------ AY231130 CAATAAGCCTTGGATTTCATATGATCGCTCATTGGAACTATTGAGTGTGTATGCGAATTC 3480 3 ------------------------------------------------------------ AY231130 GCAGTTGACGGATGAAGGTCTACTCAAGCAAGGATTTTCAACATTAGATCCTAGGTTGCG 3540 3 ------------------------------------------------------------ AY231130 TGAAGCTGTGGAAAAAACCTACGCCACTCTTTTACAGGAAGAATGGCGTGCGTTAAGTTT 3600 3 ------------------------------------------------------------ AY231130 GTTTCAAAAGTTGCACTTAAGGTACTTTGCGTTCAAATCACAACCGTCTTTTTCCGAGTA 3660 3 ------------------------------------------------------------ AY231130 TTTAAAGCCAAAAGGGCGCGCAGATTTAAAAATTGTATACGACTTCTCACCGAAGTATTG 3720 3 ------------------------------------------------------------ AY231130 TGTACACGAGGTCGGAAAGGCGTTTCTACAACCAGTCAGGGCTGGGGCTAAAATTGCATC 3780 3 ------------------------------------------------------------ AY231130 GCGAGTCATTAATGGTTGCGGAACTTTCATTCGGAAGAGTGCCGCAAAAGGCTGTGCTTA 3840 3 ------------------------------------------------------------ AY231130 CATTTTTAAGGATCTTTTCCAGTTTGTACATGTAGTGTTAGTTTTAAGCATTTTATTACA 3900 3 ------------------------------------------------------------ AY231130 GATCTTTAGGAATGCGCAAGGAATTGCCACAGAGCATATACAATTGAAGCAGGCTAAGGC 3960 83 3 ------------------------------------------------------------ AY231130 AGAAATGGAAAGACAGAAAGATTTTGATCGTCTGGAGGCTCTATACGCTGAATTGTGCAT 4020 3 ------------------------------------------------------------ AY231130 TAAGAGCGGTGAGCAACCAACTGCTGAAGAATTTATTGATTTTGTGAAGGAGCGTGAGCC 4080 3 ------------------------------------------------------------ AY231130 AAGGCTTAAGGATCAAGCTTACAATTTAATACACATACCAGTGATTCATCAAGCAAAATC 4140 3 ------------------------------------------------------------ AY231130 GGACAATGAGAAAAAGCTCGAGCAAGTCATTGCATTCATTACATTAATTTTAATGATGAT 4200 3 ------------------------------------------------------------ AY231130 CGATGTTGATAAGAGTGATTGTGTCTATAGAATCCTAAATAAATTTAAAGGCGTGATAAA 4260 3 ------------------------------------------------------------ AY231130 ATCTTGCGATGCAAATGTTTATCACCAGTCTTTAGATGACATTCGGGATTTCTATGAAGA 4320 3 ------------------------------------------------------------ AY231130 CAAGCAGTTGACTATTGATTTCGATATCACTGGAGAAAATCAGATCAATCGAGGACCTAT 4380 3 ------------------------------------------------------------ AY231130 AGACGTTACGTTTGAGAAATGGTGGGACAATCAATTGTCCAATAACAACACAATTGGTCA 4440 3 ------------------------------------------------------------ AY231130 TTATCGAATCGGGGGAACGTTTGTTGAATTTTCACGAAGTACTGCAGCAACTGTGGCTAG 4500 3 ------------------------------------------------------------ AY231130 TGAGATAGCTCATAGTCCTGATCGTGAGTTTCTTGTTCGCGGAGCTGTTGGTAGTGGTAA 4560 3 ------------------------------------------------------------ AY231130 ATCAACGAATCTTCCTTTCTTGCTTAGTAAGCATGGTAGCGTGTTGTTAATAGAGCCCAC 4620 3 ------------------------------------------------------------ AY231130 CAGACCTCTTTGTGAGAACGTCTGTAAGCAATTACGTGGTGAACCGTTCCATTGTAATCC 4680 3 ------------------------------------------------------------ AY231130 AACCATTCGCATGCGTGGATTAACAGCTTTTGGTTCTACCAACATCACAATAATGACAAG 4740 3 ------------------------------------------------------------ AY231130 CGGATTTGCTTTACATTATTATGCTCACAATGTTCAACAATTGAGACTCTTTGATTTCAT 4800 3 ------------------------------------------------------------ AY231130 AATCTTTGATGAATGTCATGTCATAGATAGCCAAGCCATGGCTTTCTATTGTCTGATGGA 4860 3 ------------------------------------------------------------ AY231130 GGGGAACGCTATTGAGAAAAAGATCCTTAAAGTTTCTGCTACGCCACCTGGGCGTGAGGT 4920 3 ------------------------------------------------------------ AY231130 TGAATTTTCAACACAATTCCCAACAAAGATTGTAACGGAACAGTCCATAAGCTTTAAGCA 4980 3 ------------------------------------------------------------ AY231130 GTTGGTTGATAACTTTGGTACTGGTGCGAATAGTGATGTGACCGTTTTTGCTGATAACAT 5040 3 ------------------------------------------------------------ AY231130 ATTAGTTTATGTTGCCAGTTACAATGAAGTAGATCAACTAAGTAAGCTCTTATCCGATAA 5100 3 ------------------------------------------------------------ AY231130 AGGCTACTTAGTCACTAAAATCGATGGAAGAACGATGAAAGTTGGAAAAACTGAAATTTC 5160 3 ------------------------------------------------------------ AY231130 CACTAGTGGCACAAAATCCAAGAAGCATTTCATAGTTGCCACGAATATCATTGAGAATGG 5220 3 ------------------------------------------------------------ AY231130 CGTCACACTTGACATAGAAGCCGTTATAGATTTTGGGATGAAAGTTGTACCTGAGATGGA 5280 3 ------------------------------------------------------------ 84 AY231130 TTCAGATAATCGCATGATTCGGTACTCAAAGCAAGCGATCAGTTTTGGAGAGAGAATTCA 5340 3 ------------------------------------------------------------ AY231130 AAGACTTGGCCGAGTGGGAAGACATAAAGAGGGGATTGCACTTAGAATTGGGCACACAGA 5400 3 ------------------------------------------------------------ AY231130 GAAAGGTATCCAAGAAATTCCAGAGATGGCAGCTACTGAAGCAGCTTTTCTGAGCTTCAC 5460 3 ------------------------------------------------------------ AY231130 GTATGGCTTGCCTGTTATGACTCACAATGTAGGGTTAAGCTTGCTTAAAAATTGCACTGT 5520 3 ------------------------------------------------------------ AY231130 GAGACAAGCACGCACAATGCATCAGTATGAACTGAGCCCATTCTTTACACAAAATTTGGT 5580 3 ------------------------------------------------------------ AY231130 AAATTTTGATGGGACAGTGCACCCCAAGATTGATATTCTGTTACGTCCCTATAAGCTGAG 5640 3 ------------------------------------------------------------ AY231130 AGATTGTGAAGTCAGATTAAGTGAAGCAGCAATTCCGCATGGGGTACAGTCTATTTGGTT 5700 3 ------------------------------------------------------------ AY231130 GTCTGCGCGGGATTATGAAGCAGTTGGAGGTCGTCTTTGCTTGGAGAGCGATGTTCGAA 5760 3 ------------------------------------------------------------ AY231130 ACCATTCCTCATTAAGGATGTTCCTGAGCGGTTATACAAAGAATTGTGGGATATCGTGCA 5820 3 ------------------------------------------------------------ AY231130 GACCTACAAGCGTGACTTTACATTTGGGCGAATTAATTCTGTGTCTGCTGGGAAAATTGC 5880 3 ------------------------------------------------------------ AY231130 GTACACATTAAGGACTGATGTGTATTCTATTCCTAGAACTCTCATAACGATTGACAAGCT 5940 3 ------------------------------------------------------------ AY231130 GATTGAGAGTGAAAACATGAAGCATGCCCATTTTAAAGCCATGACAAGTTGCACTGGCTT 6000 3 ------------------------------------------------------------ AY231130 AAACTCCAGCTTTTCTCTCCTTGGTGTTATAAACACTATCCAGAGTAGATATCTAGTTGA 6060 3 ------------------------------------------------------------ AY231130 TCATTCAGTTGAAAATATCAGGAAACTTCAACTAGCGAAGGCCCAGATTCAACAACTTGA 6120 3 ------------------------------------------------------------ AY231130 AGCTCATGTGCAAGAAAACAATGTTGAAAATTTAATTCAATCTCTTGGTGCTGTTAGAGC 6180 3 ------------------------------------------------------------ AY231130 TGTTTACCATCAAAGTGTTGATGGAGTCAAGCACATAAAGCGAGAGTTGGGCTTGAAGGG 6240 3 ------------------------------------------------------------ AY231130 AATTTGGGATGGTTCATTGATGATCAAGGATGCGATTGTATGCGGTTTCACAATGGCTGG 6300 3 ------------------------------------------------------------ AY231130 CGGTGCGATGCTTTTGTACCAACACTTTCGTGATAGGCTTACAAATGTTCATGTGTTTCA 6360 3 ------------------------------------------------------------ AY231130 CCAAGGTTTCTCTGCGCGACAGAGACAAAAGTTAAGATTTAAGTCAGCAGCAAATGCTAA 6420 3 ------------------------------------------------------------ AY231130 GCTTGGTCGAGAGGTCTATGGAGATGATGGAACAATTGAGCACTACTTTGGAGAGGCGTA 6480 3 ------------------------------------------------------------ AY231130 CACGAAGAAAGGAAACAAGAAAGGAAAGATGCATGGCATGGGCGTTAAAACGAGGAAATT 6540 3 ------------------------------------------------------------ AY231130 TGTTGCGACATATGGATTTAAACCGGAGGATTACTCGTATGTGCGGTACTTGGATCCTTT 6600 3 ------------------------------------------------------------ AY231130 AACAGGTGAGACTTTAGATGAAAGCCCACAGACTGATATCTCAATGGTGCAAGAACATTT 6660 3 ------------------------------------------------------------ 85 AY231130 TGGTGAAATTCGGAATAAGTACATGGATTCAGACAGCTTCGACAGGCAAGCTTTGATAGC 6720 3 ------------------------------------------------------------ AY231130 AAACAATACAATTAAGGCCTATTATGTCCGAAACTCCGCGAAGACAGCATTGGAAGTTGA 6780 3 ------------------------------------------------------------ AY231130 TCTGACACCGCACAACCCTCTTAAAGTTTGTGACAATAAGTTGACCATTGCAGGATTTCC 6840 3 ------------------------------------------------------------ AY231130 AGACAGGGAAGCTGAGCTGAGACAAACAGGCCCGCCCAGAACTATTCAAGTCAATCAAGT 6900 3 ------------------------------------------------------------ AY231130 GCCACCACCTTCAAGATCAGTTCATCATGAAGGAAAAAGTCTTTGTCAAGGCATGCGAAA 6960 3 ------------------------------------------------------------ AY231130 TTACAATGGCATAGCTTCTGTAGTTTGCCATTTGAAAAACACATCAGGAAAGGGGAAGAG 7020 3 ------------------------------------------------------------ AY231130 CTTATTTGGAATCGGATATAATTCATTCATCATTACCAACCGACATTTGTTCAAGGAGAA 7080 3 ------------------------------------------------------------ AY231130 TAATGGTGAACTTATAGTGAAATCCCAACACGGTAAGTTTGTCGTCAAGAACACCACGAC 7140 3 ------------------------------------------------------------ AY231130 GCTCCGAGTTGCTCCAGTTGGTAAGACTGATCTTTTAATTATTCAAATGCCGAAAGATTT 7200 3 ------------------------------------------------------------ AY231130 TCCTCCATTTCATAGCAGAGCTAGGTTTAGGGCCATGAAAGCTGGGGACAAGGTTTGCAT 7260 3 ------------------------------------------------------------ AY231130 GATAGGTGTTGATTACCAAGAGAATCATATCGCGAGCAAAGTGTCTGAAACTTCTATCAT 7320 3 ------------------------------------------------------------ AY231130 AGTGAGGGCACGGGAGATTTTGGATGCCACTGGATTTCCACGAATGACGGTGATTGCGG 7380 3 ------------------------------------------------------------ AY231130 CAATCCATTAGTTAGTGTTTCAGATGGTTTTATTGTTGGCTTGCATAGTCTGTCGACATC 7440 3 ------------------------------------------------------------ AY231130 AACTGGAGATCAAAATTTCTTCGCTAAAATACCCGCACAATTTGAAGAAAAGGTCCTGAA 7500 3 ------------------------------------------------------------ AY231130 GAAGATTGATGATTTAACTTGGAGCAAACACTGGAGCTATAATATTAATGAACTGAGTTG 7560 3 ------------------------------------------------------------ AY231130 GGGGGCTCTCAAAGTGTGGGAAAGTCGACCCGAAGCAATTTTTAACGCGCAAAAGGAAGT 7620 3 ------------------------------------------------------------ AY231130 TAATCAATTGAATGCCTTCGAGCAAAGTGGTAGTCGTTGGCTCTTTGACAAACTACACGG 7680 3 ------------------------------------------------------------ AY231130 CAATTTGAAAGGAGTAAGTTCCGCTCCTAGCAATTTGGTGACAAAGCACGTTGTTAAAGG 7740 3 ----------------------------------------------------------- AY231130 TATTTGTCCTCTCTTTAGAAACTATCTCGAGTGTGATAAAGAGGCGAAAGCTTTCTTTAG 7800 3 ------------------------------------------------------------ AY231130 TCCACTTATGGGTCACTACATGAAGAGTGTTCTGAGCAAGGAAGCATACATTAAGGATTT 7860 3 ------------------------------------------------------------ AY231130 ATTTAAATATTCAAGTGACATTGTCGTTGGAGAAGTCAACCATGATATTTTTGAGGATAG 7920 3 ------------------------------------------------------------ AY231130 TGTCGCGCAAGTTGTCGAACTGTTGAACGATCACGAGTGTTTTGAACTTGAATATATTAC 7980 3 ------------------------------------------------------------ AY231130 AGACAGTGAAGTGATTATTCAGGCCTTGAACATGGATGCAGCTGTTGGAGCCTTGTACAC 8040 86 3 ------------------------------------------------------------ AY231130 AGGAAAGAAAAGGAAATATTTTGAGGGTTCAACAGTGGAGCATAGACAAGCACTTGTGCG 8100 3 ------------------------------------------------------------ AY231130 GAAAAGCTGTGAGCGTCTCTATGAAGGGAGAATGGGAGTCTGGAATGGGTCGCTAAAGGC 8160 3 ------------------------------------------------------------ AY231130 TGAACTGAGACCAGCTGAAAAAGTGCTCGCGAAAAAGACAAGGTCATTTACAGCAGCTCC 8220 3 ------------------------------------------------------------ AY231130 TCTTGACACACTGTTAGGAGCCAAAGTCTGCGTTGATGATTTCAACAACTGGTTCTACAG 8280 3 ------------------------------------------------------------ AY231130 TAAGAACATGGAATGTCCATGGACCGTTGGGATGACAAAATTTTACAAAGGCTGGGATGA 8340 3 ------------------------------------------------------------ AY231130 GTTTCTGAAGAAGTTTCCTGAAGGCTGGGTGTATTGTGATGCAGATGGCTCCCAGTTCGA 8400 3 ------------------------------------------------------------ AY231130 TAGCTCATTGACACCATACTTGTTAAATGCTGTGTTGTCAATCCGGTTATGGGCAATGGA 8460 3 ------------------------------------------------------------ AY231130 GGATTGGGATATTGGAGAGCAAATGCTTAAGAATTTGTATGGGGAAATTACTTACACGCC 8520 3 ------------------------------------------------------------ AY231130 AATATTGACACCGGATGGGACAATCGTCAAGAAGTTCAAAGGAAATAATAGTGGTCAACC 8580 3 ------------------------------------------------------------ AY231130 TTCGACAGTTGTTGATAATACATTAATGGTTTTAATCACAATGTATTACGCACTACGGAA 8640 3 ------------------------------------------------------------ AY231130 GATTGGTTATGATACGAAGGCTCAAGAAGACATGTGTGTATTTTATATCAATGGTGATGA 8700 3 ------------------------------------------------------------ AY231130 CCTCTGTATTGCAATTCACCCGGATCATGAGCATGTTCTTGACTCATTCTCTAGTTCATT 8760 3 ------------------------------------------------------------ AY231130 TGCTGAGCTTGGGCTTAAGTATGACTTCACACAAAGGCACCGGAATAAACAGGATTTGTG 8820 3 ------------------------------------------------------------ AY231130 GTTTATGTCGCATCGAGGTATTCTGATCGATGACATTTACATTCCGAAACTTGAACCTGA 8880 3 ------------------------------------------------------------ AY231130 GCGAATTGTTGCAATTCTTGAATGGGACAAATCTAAGCTTCCAGAGCATCGATTAGAGGC 8940 3 ------------------------------------------------------------ AY231130 AATCACAGCAGCAATGATAGAGTCATGGGGTTATGGTGAGCTAACACACCAAATTCGTAG 9000 3 ------------------------------------------------------------ AY231130 ATTTTATCAATGGGTTCTTGAACAAGCTCCATTCAATGAGTTGGCGAAACAAGGAAGGGC 9060 3 ------------------------------------------------------------ AY231130 CCCATACGTCTCAGAAGTTGGATTAAGAAGATTGTATACGAGTGAACGTGGATCAATGGA 9120 3 ------------------------------------------------------------ AY231130 TGAATTGGAAGCGTATATAGATAAGTACTTTGAGCGTGAGAGGGGAGAATCACCCGAATT 9180 3 ------------------------------------------------------------ AY231130 ACTAGTGTATCATGAATCGAAGAGCACCGATGATTATCAACTTGTTTGTAATAACAATGC 9240 3 ------------------------------------------------------------ AY231130 ACATGTGTTTCATCAGTCAAAAAATGAAGCTGTGGATGCTGGTTTGAATGAAAAACTCAA 9300 3 ------------------------------------------------------------ AY231130 AGAAAAAGAAAAACAGAAAGAAAAAGAAAAACAAAAAGAGAAAGAAAAAGACGATGCTAG 9360 3 ------------------------------------------------------------ AY231130 TGACGGAAATGATGTGTCGACTAGCACAAGAACTGGAGAGAAAGATAGAGATGTCAATGT 9420 87 3 1 -------------------------CCGAGAATAAAATCATTTACTGACAAGATGATTTT 35 AY231130 CGGGACCAGTGGAACTTTCACGGTTCCGAGAATTAAATCATTCACTGATAAGATGATTCT 9480 ******** ******** ***** ********* * 9444 3 ACCGAAAATTAAAGGAAAAACTGTCCTTAATTTTAAATCATCTTCTTCAGTATAATCCGC 95 AY231130 ACCAAGAATTAAGGGAAAGACTGTCCTTAATTT-AAATCATCTTCTTCAGTATAATCCGC 9539 *** * ****** ***** ************** ************************** 3 AACAAATTGATATCTCAAACACTCGTGCCACTCAAACTCAATTCGAAAAGTGGTATGAGG 155 AY231130 AACAAATTGACATTTCTAACACTCGTGCCACTCAGTCACAATTTGAGAAATGGTATGAGG 9599 ********** ** ** ***************** * ***** ** ** ********** 3 GAGTGAGGAATGATTACGGTCTCAACGATAACGAAATGCAAGTG-ATGTTAAACGGTTTG 214 AY231130 GAGTGAGGAATGATTATGGTCTGAATGATAATGAAATGCAAGTG-ATGCTGAATGGCTTG 9658 **************** ***** ** ***** ************ *** * ** ** *** 3 ATGGTTTGGTGTATTGAAAATGGTACATCTCCAGACTTATCTGGTGTTTGGGTAATGATG 274 AY231130 ATGGTTTGGTGTATCGAGAATGGTACATCTCCAGACATATCTGGTGTTTGGGTTATGATG 9718 ************** ** ****************** **************** ****** 3 GATGGGGAAACACAAGTTGATTATCCCATTAAGCCTTTAATTGAACATGCAACTCCTTCG 334 AY231130 GATGGGGAAATTCAAGTTGACTATCCAATCAAGCCTTTAATTGAGCATGCTACCCCGTCA 9778 ********** ******** ***** ** ************** ***** ** ** ** 3 TTTAGGCAAATCATGGCTCACTTCAGTAACGCGGCAGAGGCATACATCGCAAAGAGGAAT 394 AY231130 TTTAGGCAGATTATGGCTCACTTTAGTAACGCGGCAGAAGCATATATTGCAAAGAGAAAT 9838 ******** ** *********** ************** ***** ** ******** *** 3 395 G----------------------------------------------------------- AY2311309839 GCCACTGAGAGGTACATGCCGCGGTATGGAATCAAGAGAAATTTGACTGACATTAGCCTC 9898 * 3 ------------------------------------------------------------ AY231130 GCTAGATACGCTTTCGATTTCTATGAGGTTAATTCGAAAACACCTGATAGGGCTCGCGAA 3 ------------------------------------------------------------ AY231130 GCTCACATGCAGATGAAAGCTGCAGCGCTGCGAAACACTAGTCGCAGAATGTTTGGTATG 3 ------------------------------------------------------------ AY231130 GACGGCAGTGTTAGTAATAAGGAAGAAAACACGGAGAGACACACAGTGGAAGATGTCAAT 3 ------------------------------------------------------------ AY231130 AGAGACATGCACTCTCTCCTGGGTATGCGCAACTGAATACTCGCGCTGGTGTGTTTGTCG 3 ------------------------------------------------------------ AY231130 AGCTCGACTCGACCTTGTTTCACCTTATAGTACTAAATAAGCATTAGAATACAGTGTGGC 3 ------------------------------------------------------------ AY231130 TGTGCCACCACTTCTATTTTACAGTGAGGGTAGCCCTCCGTGCTTTTAGTATTATTCGAG 3 ------------------------------------------------------------ AY231130 TTCTCTGAGTCTCCATACAGTGTGGGTGGCCCACGTGTTATTTGAGCCTCTTAGAATGAG 3 -- AY231130 AG ALIGN 395 NU

Các file đính kèm theo tài liệu này:

  • pdfKLTN.pdf
Luận văn liên quan