Luận văn Phát hiện và đánh giá tính gây bệnh của Pepper yellow leaf curl Việt Nam virus

Do PeYLCVV được phát hiện đầu tiên ở cây cà chua và ớt tại Đà Nẵng, đồng thời gần đây chúng tôi phát hiện thấy virus này trên ruộng ớt và cà tím tại Đồng Tháp. Vậy một câu hỏi đặt ra là liệu nguồn bệnh PepYLCVNV từ trên cà chua có lây sang được cây ớt hay không và ngược lại, và liệu PepYLCVNV có lan truyền nhờ bọ phấn nhờ các begomovirus khác. Với những mục đích đó, chúng tôi đã tiến hành thí nghiệm thử khả năng lan truyền của PepYLCVNV trên cây ớt và cà tím bằng côn trùng môi giới là bọ phấn (B. tabaci) trên hai nguồn bệnh khác nhau trên cây cà tím và cây ớt, sau khi lây 2 ngày tất cả cây thí nghiệm được xử lý bằng thuốc trừ côn trùng chích hút và 20 ngày sau lây tiến hành thu mẫu lá đem kiểm tra bằng phản ứng PCR. Nguồn bệnh chúng tôi sử dụng trong thí nghiệm là cây cà tím và cây ớt nhiễm PepYLCVNV, được chạy PCR trước khi lây nhiễm, để đảm bảo rằng cây cà tím và cây ớt dây nguồn chắc chắn nhiễm PepYLCVNV. Kết quả thu được thể hiện ở bảng 4.10 và 4.11.

docx95 trang | Chia sẻ: anhthuong12 | Ngày: 26/09/2020 | Lượt xem: 11 | Lượt tải: 0download
Bạn đang xem trước 20 trang tài liệu Luận văn Phát hiện và đánh giá tính gây bệnh của Pepper yellow leaf curl Việt Nam virus, để xem tài liệu hoàn chỉnh bạn click vào nút DOWNLOAD ở trên
VNP93-5-8-2à VNP93-5-8-3à VNP93-5-8-4à VNP93-5-8-5 (ladder 100bp) Phục hồi các dòng vi khuẩn A. tumefaciens mang 2 cấu trúc xâm nhiễm của PepYLCVNV Lấy cặp dòng vi khuẩn AT-VNP93-5-4 (mang cấu trúc xâm nhiễm của DNA-A) và AT-VNP93-5-4 (mang cấu trúc xâm nhiễm của DNA-B) bảo quản ở -80oC để làm nguồn lây nhiễm. Hai dòng này sau khi phục hồi được bảo quản ngắn hạn trong nước cất vô trùng ở điều kiện 4oC cho các nghiên cứu lây nhiễm trong quá trình thực tập. Hai dòng vi khuẩn trên được cấy zic zắc trên môi trường LB – agar có bổ sung thêm ba loại kháng sinh Streptomycin, Rifamycin, Kanamycin. Nuôi vi khuẩn trong điều kiện nhiệt độ dưới 280C và đánh giá kết quả sau 2 - 3 ngày. Sau 2 ngày thì vi khuẩn bắt đầu mọc, đến ngày thứ 3 nhìn chung các dòng vi khuẩn nuôi cấy trên môi trường LB – agar, có khuẩn lạc mọc đều và đẹp, khuẩn lạc hình tròn, màu trắng sữa, rìa nhẵn, bề mặt khuẩn lạc ướt (Hình ảnh 4.2). Khuẩn lạc đặc trưng cho dòng vi khuẩn Agrobacterium. Tổng số 2/2 dòng vi khuẩn đã được phục hồi (Bảng 4.2). Bảng 4.2. Kết quả phục hồi 2 dòng vi khuẩn mang cấu trúc xâm nhiêm của PepYLCVNV STT DNA Dòng vi khuẩn Số khuẩn lạc mọc trên LB- agar 1 DNA-A AT-VNP93-5-4-11 ~200 2 DNA-B AT-VNP93-5-8-1 ~150 Hình 4.2. Hình ảnh khuẩn lạc trên môi trường LB–Agar sau 3 ngày nuôi cấy Nhân sinh khối dòng vi khuẩn A.Tumerfaciens trong môi trường LB- lỏng Chọn cặp dòng vi khuẩn VNP93-5-4 và VNP-5-8 nuôi nhân sinh khối để tiến hành lây nhiễm. Sau khi đã phục hồi các dòng vi khuẩn A.tumerfacins chứa cấu trúc xâm nhiễm, các khuẩn lạc được đem nuôi lắc trong môi trường LB – lỏng có chứa 3 loại kháng sinh (Streptomycin, Rifamycin, Kanamycin), với mục đích nhân sinh khối các dòng vi khuẩn cho lây nhiễm. Vi khuẩn nuôi qua đêm ở điều kiện lắc 250 rmp và nhiệt độ dưới 280C. Kết quả cho thấy tất cả các khuẩn lạc đều phát triển tốt trong môi trường LB – lỏng, các lọ dung dịch vi khuẩn có vẩn đục ( Hình ảnh 4.2). Hình 4.2: Dòng vi khuẩn A.tumerfaciens chứa cấu trúc xâm nhiễm PepYLCVNV nuôi trong LB – lỏng Kết quả đánh giá tính gây bệnh của PepYLCVNV bằng phương pháp Agroinoculation Các dòng vi khuẩn A.tumerfaciens có chứa cấu trúc xâm nhiễm của PepYLCVNV chứa bộ gen (DNA-A và DNA-B ) riêng rẽ, đã được nuôi trong môi trường LB – lỏng. Dịch vi khuẩn thu được sau khi nuôi lỏng, lắc được mang đi li tâm lấy cặn vi khuẩn và hòa tan cặn vi khuẩn bằng đệm MgCl2 cùng với 1 µl/ml acetonringone 0.1M giúp kích thích sự phát triển của vi khuẩn trong tế bào ký chủ. Sau đó dịch vi khuẩn được sử dụng để lây nhiễm bằng cách tiêm trực tiếp vào mô lá khi cây ở giai đoạn có 3-4 lá thật. Cây thí nghiệm là cà chua mẫn cảm giống Hồng Lan T20, ớt Hiểm Lai F1-207, và các giống chỉ thị: thuốc lào (N. glutinosa), thuốc lá (N. tabacum) cv. K326, thuốc lá (N. tabacum) cv. Samsum, thuốc lá cảnh (Nicotiana benthamiana), hoa ngũ sắc (Ageratum conyzoides). Trên cùng 1 cây thí nghiệm, chúng tôi đã sử dụng 2 phương pháp để đưa vi khuẩn vào trong cây. Các phương pháp lây nhiễm được trình bày ở bảng 4.2.3. Bảng 4.3. Các phương pháp lây nhiễm nhân tạo sử dụng A. tumerfaciens (Agroinoculation) STT Tên phương pháp Mô tả phương pháp 1 Tiêm trực tiếp dịch khuẩn vào nách lá Là phương pháp lây nhiễm khi cây được 3-4 lá mầm, dịch vi khuẩn được tiêm trực tiếp nách lá bằng xi lanh y tế loại 1 mL nhỏ. 2 Tiêm trực tiếp dịch khuẩn vào mô lá Là phương pháp lây nhiễm khi cây được 3-4 lá mầm, dùng xy lanh y tế loại 1 mL nhỏ nhưng tháo kim và bơm dịch vi khuẩn vào mặt dưới của lá để vi khuẩn có thể xâm nhập vào mô qua khí khổng. Các công thức thí nghiệm bao gồm: Chỉ lây nhiễm một mình dòng VNP93-A Lây nhiễm hỗn hợp 2 dòng vi khuẩn: VNP93-A và VNP93-B Đối chứng: tiêm acetosyrigone 10 mM Một công thức thực hiện trên 5 cây, mỗi cây được tiêm trực tiếp 3 mũi tại 3 nách lá tính từ ngọn xuống, tiếp theo được bơm 3 vết trên 3 lá khác với ba lá đã được tiêm vào nách. Vì nhiệt độ tối thích cho vi khuẩn A. tumefeciens chuyển gien là 28oC – 30oC nên cây thí nghiệm được chuyển vào phòng điều hòa nhiệt độ ở 28oC trước, sau và trong suốt quá trình lây nhiễm nhân tạo để tạo điệu kiện cho vi khuẩn hoạt động thuận lợi. Sau đó cây thí nghiệm được chuyển ra nhà lưới và đề đảm bảo cho cây sạch bọ phấn (môi giới truyền Begomovirus) tất cả cây thí nghiệm được xử lý bằng thuốc trừ côn trùng chích hút với mật độ phun 2 tuần/lần. Thí nghiệm lây nhiễm agroinoculation được minh họa ở Hình 4.6. Hình4.3. Phương pháp tiêm trực tiếp dịch vi khuẩn vào mô lá Tính gây bệnh của DNA-A (lây nhiễm bằng agroinoculation) PepYLCVNV là một begomovirus có bộ gen kép (có cả DNA-A và DNA-B). Tuy nhiên, nhiều begomovirus có bộ gien đơn đã được chứng minh là có thể tạo ra triệu chứng điển hình mà không cần sự có mặt của DNA-B chẳng hạn như đối với TYLCSV (Kheyr-Pour et al., 1991) và Tobacco yellow leaf curl Yunnan virus (TYLCYNV) (Xie et al., 2006) trên cà chua. Mặt khác, một số nghiên cứu tại TTBCND (Chi, 2013) đã kết luận chỉ cần DNA-A cũng có có thể gây bệnh trên cà chua. Chính vì vậy, chúng tôi tiến hành lặp lại các thí nghiệm nhằm nghiên cứu chính xác tính gây bệnh của chỉ DNA-A của PepYLCVNV trên cà chua bởi vì DNA-A của virus này đã được phát hiện trên ruộng trồng cà chua ở gần ruộng trồng ớt đã, nơi đã phát hiện ra virus này. Ngoài ra, chúng tôi cũng nghiên cứu tính gây bệnh này trên cây ớt, thuốc lá và trên cây họ ageratum (một loài cây ký chủ phụ phổ biến đối với begomovirus ngoài tự nhiên). Thí nghiệm 1: Lây nhiễm trên dòng cà chua Hồng Lan (T20). Chúng tôi tiến hành lặp lại 4 lần, triệu chứng mỗi lần lây được theo dõi sau 1, 2, 3, 4 tuần sau khi lây. Sau một tháng lây nhiễm, trong cả 4 lần thực hiện lây không có cây nào biểu hiện triệu chứng nhiễm bệnh. Để kiểm tra khả năng nhiễm ẩn (cây nhiễm virus nhưng không biểu hiện triệu chứng), sau 50 ngày lây nhiễm chúng tôi tiến hành PCR để kiểm tra sự có mặt DNA-A của PepYLCVNV trên các cây lây sử dụng mồi đặc hiệu VNP93-A-F1/R1. Bảng 4.4. Tính gây bệnh của PepYLCV khi lây nhiễm chỉ DNA-A giống cà chua Hồng Lan (T20) STT Ngày lây nhiễm Số cây lây Số cây có triệu chứng Số cây PCR dương/ số cây kiểm tra 1 8/3/2014 15 0 3/5 2 12/4/2014 15 0 5/5 3 24/4/2014 12 0 2/5 4 10/5/2014 12 0 4/5 Hình 4.4. PCR phát hiện DNA-A của PepYLCVNV trên cà chua Hồng Lan (T20). Từ trái qua phải tương ứng. Kết quả cho thấy rằng qua 4 lần thí nghiệm chúng tôi không nhận thấy triệu chứng trên các cây lây nhiễm tuy nhiên khi kiểm tra bằng PCR thì vẫn thấy sự có mặt của virus chứng tỏ được tính hiệu quả của cấu trúc xâm nhiễm=> câu hỏi vì sao. Thí nghiệm 2: Lây nhiễm trên ớt: Chúng tôi tiến hành thí nghiệm này trên giống ớt mẫn cảm Hiểm Lai F1-207. Tiến hành lặp lại 3 lần, theo dõi tuần 1, 2, 3, 4 sau lây. Quan sát tại tuần 4 sau khi tiêm cho thấy, cả 3 lần tiêm không có cây nào biêu hiện triệu chứng, sau 4 tuần lây nhiễm, chúng tôi tiến hành PCR để kiểm tra sự có mặt DNA-A của PepYLCVNV trên các cây lây sử dụng mồi đặc hiệu VNP93-A-F1/R1 (Bảng 5, hình 4.5). Bảng 4.5. Tính gây bệnh của PepYLCV khi lây nhiễm chỉ DNA-A giống ớt Hiểm Lai F1-207 STT Ngày lây nhiễm Số cây lây Số cây có triệu chứng Số cây PCR dương/ số cây kiểm tra 1 12/4/2014 15 0 2 24/4/2014 12 0 3 10/5/2014 12 0 Ghi chú: Phản ứng PCR dương (+); Phản ứng PCR âm (-); ĐC: Đối chứng Hình 4.5. PCR phát hiện DNA-A của PepYLCVNV trên ớt Hiểm Lai F1-207. Từ trái qua phải tương ứng. Thí nghiệm 3: Lây nhiễn trên cây chỉ thị: Trong thí nghiệm này chúng tôi tiến hành lây nhiễn trên 3 giống thuốc lá (N. benthamaiana, N. tabacum cv. Samsun, N. tabacum cv. K326), thuốc lào N.Glutinosa và hoa ngủ sắc (Ageratum conyzoides). Tiến hành lặp lại 3 lần, triệu chứng được theo dõi sau 1, 2, 3, 4 tuần sau lây đồng thời các cây lây nhiễm được kiểm tra lại bằng PCR sau 4 tuần lây nhiễm. Kết quả được trình bày ở bảng 4.6 và hình 4.6 Bảng 4.6. Tính gây bệnh của PepYLCV khi lây nhiễm chỉ DNA-A trên cây chỉ thị. Cây Lần lây nhiễn thứ 1 Lần lây nhiễn thứ 2 Lần lây nhiễn thứ 3 Triệu chứng PCR (+) Triệu chứng PCR (+) Triệu chứng PCR (+) Nicotiana benthamiana 0/6 6/6 0/6 3/6 0/6 4/6 N. tabacum cv. K326 0/6 0/6 0/6 0/6 0/6 0/6 N. tabacum cv. Samsun 0/6 0/6 0/6 0/6 0/6 0/6 N. glutinosa 0/6 0/6 0/6 0/6 0/6 0/6 Ageratum conyzoides 0/6 0/6 0/6 0/6 0/6 0/6 Ghi chú: Phản ứng PCR dương (+); Phản ứng PCR âm (-); ĐC: Đối chứng Hình 4.6. PCR phát hiện DNA-A của PepYLCVNV trên cây Nicotiana benthamiana (lây nhiễm lần 1) Mà Cây 1à Cây 2à Cây 3à Cây 4à Cây 5à Cây 6(ladder 1kb) Kết quả: ???? Kết luận chung: Qua 3 thí nghiệm lây nhiễm phân tử DNA-A trên ớt, cà chua và cây chỉ thị, chúng tôi không nhận thấy triệu chứng trên các cây lây nhiễm tuy nhiên khi kiểm tra bằng PCR thì vẫn thấy sự có mặt của virus. Điều đó chứng tỏ tính hiệu quả của cấu trúc xâm nhiễm. Giả thuyết, một mình phân tử DNA-A không thể gây bệnh được mặc dù vẫn có quá trình tái sinh của phân tử DNA-A trong cây, có thể đối với virus này thì cần sự có mặt của cả 2 phân tử DNA-A và DNA-B mới có thể hình thành được triệu chứng. Chính vì thế mà chúng tối tiến hành thí nghiệm tiếp theo liên quan đến tính gây bệnh của PepYLCVV bằng cách lây nhiễm đồng thời DNA-A và DNA-B. Tính gây bệnh của cả DNA-A & DNA-B (lây nhiễm bằng agroinoculation) Giống như kiểm tra tính gây bệnh trên phân tử DNA-A, chúng tôi tiến hành kiểm tra tính gây bệnh của cả DNA-A và DNA-B với 3 thí nghiệm 1, 2, 3 lần lượt trên cây cà chua, cây ớt và cây chỉ thị, chỉ khác khi kiểm tra PCR ngoài sử dụng mồi đặc hiệu VNP93-A-F1/A-R1, chúng tôi còn sử dụng thêm mồi VNP93-B-F1/B-R1. Thí nghiệm 1: Lây nhiễm trên dòng cà chua Hồng Lan (T20). Tiến hành lặp lại 4 lần, triệu chứng mỗi lần lây được theo dõi sau 1, 2, 3, 4 tuần sau khi lây lây đồng thời các cây lây nhiễm sau 4 tuần lây được kiểm tra lại bằng PCR. Kết quả được trình bày ở bảng 4.7 và hình 4.7. Bảng 4.7. Tính gây bệnh của PepYLCV khi lây nhiễm của cả DNA-A và DNA-B trên giống cà chua Hồng Lan (T20) STT Ngày lây nhiễm Số cây lây Số cây có triệu chứng Số cây PCR dương/ số cây kiểm tra DNA-A DNA-B 1 8/3/2014 15 0 2 12/4/2014 15 0 3 24/4/2014 12 0 4 10/5/2014 12 0 Ghi chú: Phản ứng PCR dương (+); Phản ứng PCR âm (-); ĐC: Đối chứng Hình 4.7. PCR phát hiện DNA-A và DNA-B của PepYLCVNV trên cà chua Hồng Lan (T20) . Từ trái qua phải tương ứng. Thí nghiệm 2: Lây nhiễm trên ớt: Lây trên giống ớt mẫn cảm Hiểm Lai F1-207. Tiến hành lặp lại 3 lần, theo dõi tuần 1, 2, 3, 4 sau lây lây đồng thời các cây lây nhiễm được kiểm tra lại bằng PCR sau 4 tuần lây nhiễm. Kết quả được trình bày ở bảng 5. Bảng 4.8. Tính gây bệnh của PepYLCV khi lây nhiễm của cả DNA-A và DNA-B trên giống ớt Hiểm Lai F1-207 STT Ngày lây nhiễm Số cây lây Số cây có triệu chứng Số cây PCR dương/ số cây kiểm tra DNA-A DNA-B 1 12/4/2014 15 0 2 24/4/2014 12 0 3 10/5/2014 12 0 Ghi chú: PCR (+): Phản ứng PCR dương. Hình 4.8. PCR phát hiện DNA-A và DNA-B của PepYLCVNV trên ớt Hiểm Lai F1-207 . Từ trái qua phải tương ứng. Thí nghiệm 3: Lây nhiễm trên cây 3 giống thuốc lá (N. benthamaiana, N. tabacum cv. Samsun, N. tabacum cv. K326), thuốc lào N.Glutinosa và hoa ngủ sắc (Ageratum conyzoides). Tiến hành lặp lại 3 lần, triệu chứng được theo dõi sau 1, 2, 3, 4 tuần sau lây đồng thời sau 4 tuần lây nhiễm, chúng tôi tiến hành PCR để kiểm tra sự có mặt DNA-A và DNA-B của PepYLCVNV trên các cây lây sử dụng cặp mồi VNP93-A-F1/R1, VNP93-B-F1/R1. Kết quả được trình bày ở bảng 4.9, hình 4.9 Bảng 4.9. Tính gây bệnh của PepYLCV khi lây nhiễm của cả DNA-A và DNA-B trên cây chỉ thị. Cây Lần lây nhiễn thứ 1 Lần lây nhiễn thứ 2 Lần lây nhiễn thứ 3 Triệu chứng PCR (+) Triệu chứng PCR (+) Triệu chứng PCR (+) DNA-A DNA-B DNA-A DNA-B DNA-A DNA-B Nicotiana benthamiana 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 N. tabacum cv. K326 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 N. tabacum cv. Samsun 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 N. glutinosa 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 Ageratum conyzoides 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 Ghi chú: Phản ứng PCR dương (+); Phản ứng PCR âm (-); ĐC: Đối chứng Hình 4.9. PCR phát hiện DNA-A và DNA-B của PepYLCVNV trên các cây chỉ thị . Từ trái qua phải tương ứng. Kết quả lây nhiễm trên cũng gợi ý là agroinoculation có thể phù hợp để đánh giá tính gây bệnh nhưng không phù hợp để đánh giá tính kháng khi tỷ lệ nhiễm cao là yêu cầu bắt buộc. Kết luận Như vậy, từ 2 thí nghiệm đánh giá tính gây bệnh của chỉ phân tử DNA-A và của cả phân tử DNA-A và DNA-B. Chúng tôi nhận thấy rằng, việc đánh giá tính gây bệnh trên ớt bằng agroinoculation chưa đem lại hiệu quả do không quan sát thấy triệu chứng nhưng khi chúng tôi tiến hành kiểm tra PCR thì đều phản ứng (+) chứng tỏ sự tái sinh của virus vẫn xảy ra. Nguyên nhân của việc không hình thành triệu chứng có thể do: Thí nghiệm tiến hành trong môi trường không thích hợp. Giống cây có khả năng kháng bệnh. Clone có thể vỡ khung dẫn đến không tương tác nên cây không biểu hiện triệu chứng mặc dù trong cây virus vẫn tái sinh. Đánh giá tính gây bệnh của PepYLCVNV bằng lây nhiễm nhân tạo dùng bọ phấn Do PeYLCVV được phát hiện đầu tiên ở cây cà chua và ớt tại Đà Nẵng, đồng thời gần đây chúng tôi phát hiện thấy virus này trên ruộng ớt và cà tím tại Đồng Tháp. Vậy một câu hỏi đặt ra là liệu nguồn bệnh PepYLCVNV từ trên cà chua có lây sang được cây ớt hay không và ngược lại, và liệu PepYLCVNV có lan truyền nhờ bọ phấn nhờ các begomovirus khác. Với những mục đích đó, chúng tôi đã tiến hành thí nghiệm thử khả năng lan truyền của PepYLCVNV trên cây ớt và cà tím bằng côn trùng môi giới là bọ phấn (B. tabaci) trên hai nguồn bệnh khác nhau trên cây cà tím và cây ớt, sau khi lây 2 ngày tất cả cây thí nghiệm được xử lý bằng thuốc trừ côn trùng chích hút và 20 ngày sau lây tiến hành thu mẫu lá đem kiểm tra bằng phản ứng PCR. Nguồn bệnh chúng tôi sử dụng trong thí nghiệm là cây cà tím và cây ớt nhiễm PepYLCVNV, được chạy PCR trước khi lây nhiễm, để đảm bảo rằng cây cà tím và cây ớt dây nguồn chắc chắn nhiễm PepYLCVNV. Kết quả thu được thể hiện ở bảng 4.10 và 4.11. Hình 4.10. Kết quả điện di chạy PCR trên cà tím với mồi VNP93-A-F1/R1, VNP93-B-F1/R1 M à VNP1500 à VNP1501 đối chứng âm à VNP1500-1 à VNP1500-2 à VNP1500-3 à VNP1500 Hình 4.11. Kết quả điện di chạy PCR trên ớt với mồi VNP93-A-F1/R1, VNP93-B-F1/R1 M à VNP1500 à VNP1500 à VNP1500 à VNP1500 Lây nhiễm PepYLCVNV bằng cây cà tím nguồn bệnh Bảng 4.10. Kết quả lây nhiễm PepYLCV bằng bọ phấn trên cây cà tím nguồn bệnh STT Cây thí nghiệm Số cây lây Số cây có triệu chứng Tỷ lệ bệnh (%) Triệu chứng sau lây (4 tuần) PCR DNA-A DNA-B 1 Cà chua T20 10 10 100 Xoăn vàng ngọn + + 2 Cà tím 10 10 100 Khảm vàng + + 3 Ớt (hiểm lai F1) 10 10 100 Khảm nhăn + + Ghi chú: Phản ứng PCR dương (+); Phản ứng PCR âm (-); ĐC: Đối chứng Lây nhiễm PepYLCVNV bằng cây ớt nguồn bệnh Bảng 4.11. Kết quả lây nhiễm PepYLCV bằng bọ phấn trên cây ớt nguồn bệnh STT Cây thí nghiệm Số cây lây Số cây có triệu chứng Tỷ lệ bệnh (%) Triệu chứng sau lây (4 tuần) PCR DNA-A DNA-B 1 Cà chua T20 10 10 100 Xoăn vàng ngọn + - 2 Cà tím 10 0 0 Không có triệu chứng - - 3 Ớt (hiểm lai F1) 10 10 100 Khảm nhăn + - Ghi chú : Phản ứng PCR dương (+) ; Phản ứng PCR âm (-) ; ĐC : Đối chứng Như vậy, qua 2 thí nghiệm trên chúng tôi nhận thấy rằng đối với virus trên cây ớt ở Cao Lãnh-Đồng Tháp có khả năng lây nhiễm trên cà chua nhưng không có khả năng gây bệnh trên cà tím, ngược lại đối với begomovirus gây bệnh trên cà tím ở Thanh Bình-Đồng Tháp (triệu chứng khảm vàng điển hình) lại hoàn toàn có thể lây nhiễm sang ớt và cà chua. Dường như, 2 begomovirus gây bệnh trên cà tím và ớt thu được tại Đồng Tháp là 2 loài khác nhau. Đánh giá tính kháng của PepYLCVNV trên tập đoàn giống ớt của AVRDC Đánh giá dựa vào cấp bệnh Mức độ biểu hiện triệu chứng cũng là tiêu chí quan trọng đánh giá tính kháng. Chúng tôi đánh giá dựa trên số liệu đánh giá được từ 2 lần điều tra ngày 6/5 và 11/6 năm 2014. Kết quả được trình bày ở Bảng 4.10 và Hình 4.13. Bảng 4.12. Cấp bệnh xoăn vàng lá của các giống ớt AVRDC STT Giống Ngày 6/5/2014 Ngày 21/5/2014 n Số cây bị bệnh Cấp bệnh (TB) Cấp bệnh (SE) n Số cây bị bệnh Cấp bệnh (TB) Cấp bệnh (SE) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Chú thích: n : tổng số cây điều tra; TB : trung bình; SE (standard eror) : sai số chuẩn ; (-) không tính được SE, S : nhiễm ; R : kháng Nhận xét: ???? Thiết kế cấu trúc xâm nhiễm của PepYLVNV Mục đích và phương pháp Việc lây nhiễm bằng Agroinoculation trên cà chua, ớt, và cây chỉ thị không biểu hiện triệu chứng nhưng kiểm tra PCR đều mang phản ứng PCR dương (+). Cùng với đó chúng tôi sử dụng cây cà tím, ớt nguồn mang từ Đà Nẵng về đem lây cho ớt, cà chua, cà tím bằng bọ phấn đều xuất hiện biểu hiện bệnh. Điều đó dẫn tới giải thuyết: clone có thể vỡ khung dẫn đến không biểu hiện được triệu chứng mặc dù trong cây virus vẫn tái sinh. Chính vì vậy chúng tôi tiến hành xây dựng lại cấu trúc xân nhiễm để đánh giá chính xác khả năng gây bệnh, đặc trưng sinh học của virus này. Mục tiêu của phần nghiên cứu này là ứng dụng kỹ thuật RCA (Rolling circle amplification) để phân lập và xây dựng cấu trúc xâm nhiễm của các phân tử DNA-A và DNA-B để phục vụ việc đánh giá tính gây bệnh, đặc trưng sinh học cũng như sẽ dùng cấu trúc xâm nhiễm này để giải trình tự toàn bộ bộ gen virus để đánh giá đặc trưng phân tử của virus này. Cấu trúc xâm nhiễm bao gồm bộ gen virus DNA-A,DNA-B được thiết kế chứa 2 stem-loop để phục vụ việc tái sinh bộ gen hoàn chỉnh của virus và được nối vào 1 vị trí nằm giữa bờ trái và bờ phải của 1 vector nhị nguyên. Sau đó được chuyển vào E.coli để nhân dòng là chọn lọc cấu trúc của DNA-A và DNA-B và tiếp theo đó cấu trúc xâm nhiễm sẽ được biến nạp vào tế bào vi khuẩn A. Tumerfaciens để tiến hành đánh giá tính gây bệnh sử dụng kỹ thuật Agroinoculation. Trong nghiên cứu này, chúng tôi tiến hành nhân bộ gen DNA virus dưới dạng các multimer bằng kỹ thuật RCA. Sản phẩm RCA sau đó được cắt không triệt để bằng enzyme cắt giới hạn để thu dạng dimer của phân tử DNA. Các phân tử dimer này, có kích thước ~ 5,4 kb, được nối vào vector nhị nguyên pCAMBIA-2300. Cuối cùng chuyển vector tái tổ hợp này vào vi khuẩn E.coli và vi khuẩn A. Tumerfacien. Hình 4.12. Sơ đồ các bước xây dựng cấu trúc xâm nhiễm của PepYLCVNV sử dụng kỹ thuật RCA Bảng 4.12. Tóm tắt các bước xây dựng cấu trúc xâm nhiễm Bước chuẩn bị Quá trình chuẩn bị Chuẩn bị vector pCAMBIA2300 Biến nạp pCAMBIA2300 vào E.coli XL1-Blue sau đó minipreps thu nguồn pCAMBIA2300 (kiểm tra lại bằng mồi đặc hiệu vector) Mở vòng vector bằng BamHI Desphosphoryl pCAMBIA2300 bằng Alkaline photphase và tinh sạch Phản ứng RCA Phản ứng RCA sử dụng exo-hexamer primer và Phi 29 polymerase Thu dimer của bộ gen PepYLCVNV Cắt không hoàn toàn sản phẩm RCA bằng enzyme BamHI sau đó điện di,thôi gel thu sản phẩm kích thước 5,4kb Cấu trúc xâm nhiễm của PepYLCVNV Nối dimer thu được với vector pCAMBIA đã mở vòng và dephosphoryl hóa Biến nạp vào E.coli XL1-Blue Chọn dòng mang cấu trúc xâm nhiễm của DNA-A, DNA-B Biến nạp cấu trúc xâm nhiễm vào Agrobacterium để tiến hành Agroinoculation và giải trình tự để đánh giá đặc trưng phân tử Chuẩn bị vector pCAMBIA2300 Vector nhị nguyên được sử dụng để làm cấu trúc xâm nhiễm là vector pCAMBIA2300 được tạo ra bởi viện CAMBIA.pCAMBIA-2300 là vector cho chuyển gen thực vật và được sử dụng tốt trong thí nghiệm agroinoculation. Hình 4.13. Sơ đồ vector pCAMBIA2300 Vector pCAMBIA2300 dạng khô được bảo quản ở tủ -80 oC được hòa loãng với nước và biến nạp vào E.coli chủng XL1-Blue sử dụng phương pháp sốc nhiệt và được cấy trải trên môi trường LB với tetracyline và kanamycine để chọc lọc các dòng mang cấu trúc xâm nhiễm. Sau khi ủ 18h ở 37oC thì có 200 khuẩn lạc đơn mọc trên môi trường LB với đặc điểm đặc trưng của E.coli ( màu trắng sữa, có viền bao quanh, bề mặt trơn). Một số khuẩn lạc đơn được chuyển qua nuôi lắc trong ống nghiệm, mỗi ống nghiệm có 5ml môi trường LB lỏng chứa tetracyline và kanamycine, nuôi lắc 200 rpm. Sau đó plasmid sẽ được tinh chiết bằng Purelink quick plasmid miniprep kit (Invitrogen), một lượng nhỏ sản phẩm minipreps sẽ được kiểm tra bằng PCR sử dụng cặp mồi đặc hiệu của vector pCAMBIA2300 là mồi pCAMseqF1 và pCAMseqR. Phản ứng PCR được thực hiện với điều kiện sau: khởi đầu biến tính ở 940C trong 4 phút; tiếp theo là 35 chu trình PCR (biến tính ở 940C trong 40 giây, gắn mồi ở 500C trong 35 giây và tổng hợp sợi ở 720C trong 1 phút 30 giây). Phản ứng được kết thúc với 5 phút ở 720C.Sau đó điện di kiểm tra sản phẩm, kích thước sản phẩm PCR ~ 1,4kb, chứng tỏ đã thành công trong việc chuẩn bị vector pCAMBIA2300 để làm cấu trúc xâm nhiễm của PepYLCVNV. Hình 4.14.Điện di sản phẩm PCR kiểm tra plasmid sử dụng cặp mồi pCAMseqF1/R M: Ladder 1kb, 1-2-3-4 lần lượt plasmid được tinh chiết từ 3 clone bất kỳ sau khi biến nạp vector pCAMBIA2300 Vector pCAMBIA2300 sau khi được tinh chiết và kiểm tra sẽ được mở vòng bằng enzyme Bam HI sau đó desphosphoryl hóa bằng alkaline phosphase và được tinh sạch bằng Purelink PCR purification kit (Invitrogen) (Hình 4.15) Hình 4.15. Điện di sản phẩm khi mở vòng pCAMBIA 2300 bằng BamHI Phản ứng RCA để nhân dòng toàn bộ bộ gen PepYLCVNV Mẫu VNP1500 thu được tại TTBCNĐ-ĐHNNHN được chọn để nhân dòng toàn bộ bộ gen của PepYLCVNV bằng phản ứng RCA.Mẫu này là mẫu ớt, giống Hiểm Lai F1-207, được gieo tại trung tâm trồng chậu 27/2 đã được lây nhiễm bằng bọ phấn từ 5 cây ớt bị bệnh xoăn vàng lá do Đức Anh – CNSH54 thu thập tại Cao lãnh-Đồng Tháp. 5 cây ớt đã kiểm tra PCR đều nhiểm những chỉ phản ứng PCR dương với mối đặc hiệu PepYLV DNA-A. Điều đó đặt ra 2 giả thuyết: Chỉ có DNA-A DNA-B của virus khác Chúng tôi tiến hành phản ứng RCA sử dụng 2 phương pháp chiết DNA: Phương pháp CTAB và phương pháp chiết DNA sử dụng kit chuyện dụng nhằm tăng khả năng thành công khi xử lý sản phẩm RCA bằng Bam HI Bảng 4.13. Hiệu quả xử lý sản phẩm RCA với các phương pháp chiết khác nhau STT Mẫu Phương pháp chiết Cắt hoàn toàn sản phẩm RCA bằng BamHI 1 VNP1500 CTAB ~3kb,2kb 2 VNP1500 AccuPrep GMO(Plant) Genomic DNA Extraction Kit (Bioneer) ~3kb,2kb Chúng tôi nhận thất sử dụng phương pháp chiết sử dụng Kit Temphiliph hiệu quả tốt hơn so với phương pháp chiết CTAB. Chính vì vậy, chúng tôi quyết định chọn phương pháp chiết DNA bằng Kit Temphilip để làm khuôn cho phản ứng RCA.Mẫu được chọn là mẫu ớt thu tại TTBCNĐ-ĐHNNHN được lây nhiễm bằng bọ phấn từ 5 cây ớt với những triệu chứng điển hình của PepYLCV đã được kiểm tra lại bằng phản ứng PCR sử dụng cặp mồi mới thiết kế là mồi đặc hiệu phát hiện PepYLCV là VNP93-A-F1/R1 và VNP93-B-F1/R1 Hình 4.16. PCR kiểm tra mẫu VNP1500 chiết bằng CTAB, Kit Tephiliph DNA từ mẫu ớt VNP1500 sẽ được dùng làm khuôn cho phản ứng RCA.Phản ứng RCA sẽ nhân toàn bộ bộ gen của các begomovirus theo cơ chế vòng lăn tương tự quá trình tái sinh của virus ngoài tự nhiên thành dạng multimer nhờ enzyme Phi 29 polymerase và mồi exo-random hexamer. Tối ưu hóa điều kiện cho phản ứng cắt không hoàn toàn sản phẩm RCA Sau khi thực hiện phản ứng RCA,chúng tôi xử lý sản phẩm RCA bằng cách cắt hoàn toàn bằng enzyme Bam HI 10 u/µl để chắc chắn rằng phản ứng RCA đã nhân được bộ gen của virus.Thành phẩn của phản ứng cắt triệt để sản phẩm RCA bao gồm 1 µl sản phẩm RCA,1 µl Bam HI 10 u/µl,1µl 10 X React3, 7 µl nước cất invitro sau đó được ủ ở 37oC trong 1h. VNP1500 3kb Hình 4.17. Xử lý sản phẩm RCA mẫu VNP1500 bằng cách cắt hoàn toàn với enzyme BamHI 10 u/µl VNP1500àVNP1500à Marker (ladder: 1kb) Mục đích chính của việc xử lý sản phẩm RCA là thu được dimer, và để thu được dimer chúng tôi tiến hành phản ứng cắt với việc thay đổi thời gian, nồng độ enzyme và nhiệt độ.Chúng tôi tiến hành một loạt các thí nghiệm với các điều kiện cắt khác nhau để xác định điều kiện cắt tốt nhất nhằm thu được sản phẩm có kích thước ~ 5,4 kb (dimer). Bảng 4.14. Tối ưu hóa điều kiện cho phản ứng cắt không hoàn toàn sản phẩm RCA của PepYLCV CT Nồng độ enzyme Nhiệt độ cắt (oC) Thơi gian cắt (phút) Bất hoạt Sản phẩm cắt 1 10 u/µl 37 5 80oC/20’ Monomer và đoạn ngắn hơn 3kb 2 0.5 u/µl 37 3 80oC/20’ Trimer, dimer, monomer 3 0.2 u/µl 37 3 80oC/20’ Trimer, dimer, monomer 4 0.1 u/µl 37 25 80oC/20’ Trimer, dimer, monomer 5 0.05u/µl 37 15 VNP1500 80oC/20’ Không cắt 5kb 3kb Hình 4.18. Xử lý sản phẩm RCA mẫu VNP1500 bằng cách cắt không hoàn toàn với enzyme BamHI 0.2 u/µl. MarkeràVNP1500àVNP1500 (ladder: 1kb) Như vậy chúng tôi đã chọn được nồng độ enzyme sử dụng tốt nhất để cắt không hoàn toàn sản phẩm RCA ở nồng độ 0.2 u/µl, nhiệt độ tối ưu cho phản ứng cắt là 37oC trong khoảng 3 phút để thu được dimer (5kb) cho việc thiết kế cấu trúc xâm nhiễm của begomovirus. .Biến nạp cấu trúc xâm nhiễm vào E.coli Sau khi tối ưu hóa điều kiện cắt không hoàn toàn sản phẩm RCA để thu được dimer genome PepYLCV, băng 5kb được cắt từ gel agarose và được tinh chiết bằng Accuprep Gel purification kit (Bioneer).Sản phẩm dimer được nối với vector pCAMBIA2300 đã được mở vòng bằng Bam HI và được desphosphoryl hóa bằng enzyme T4 Ligase (Fermentas) để hình thành cấu trúc xâm nhiễm.Sau đó sản phẩm nối sẽ được biến nạp vào E.coli chủng XL1-Blue khả biến. Trong quá trình biến nạp chúng tôi thu được 20 clone. Sau đó chúng tôi tiến hành kiểm tra liệu đã có dimer genome của virus được nối vào trong vector hay chưa. Có 2 phương pháp để kiểm tra đó là: Phản ứng PCR với cặp mồi đặc hiệu VNP93-A-F1/R1 (mồi A) hoặc là phản ứng cắt kiểm tra sản phẩm nối sử dụng enzyme cắt BamHI. Tất cả khuẩn lạc đơn sẽ được nuôi lắc 200 rpm trong 5ml LB lỏng cộng với kanamycine và tetracycline.Sau đó tinh chiết plasmid bằng phương pháp miniprep (Sambrook, Fritsch et al., 1989).Sau khi thu được plasmid chúng tôi tiến hành kiểm tra cả 20 clones bằng cách cắt bằng enzyme Bam HI để chắc chắn rằng có sản phẩm nối trong vector pCAMBIA2300. Hình 4.19. Kết quả biến nạp cấu trúc xâm nhiễm PepYLCV vào E.coli . Hình 4.20. Điện di sản phẩm cắt các clone bằng BamHI Trong 20 clones thu được, chỉ có 3 clone mang sản phẩm nối là dimer của virus gồm: clone 5-1, clone 5-5 và clone 5-20. Chúng tôi tiến hành kiểm tra lại bằng phản ứng PCR 3 clones này sử dụng cặp mồi VNP93-A-F1/R1 (mồi A). Hình 4.21. Điện di kiểm tra PCR Kết quả cho thấy có 2 clone 5-1 và clone 5-4 là dương với mồi VNP93-A-F1/R1 còn clone 5-8 thì không, . Điều đó cho thấy 2 clones 5-1 và 5-5 mang dimer phân tử DNA-A của virus PepYLCVNV, còn clone 5-20 có 2 khả năng: là dimer của phân tử DNA-A, cũng có thể là dimer của phân tử DNA-B (của 1 loài virus khác). Chúng tôi chọn 2 clone 5-1 và clone 5-20 gửi đến Macrogen-Korea để giải trình tự nhằm định danh chính xác loài begomovirus này. Giải trình tự bộ gen của mẫu VNP1500 Sau khi có kết quả chúng tôi tiến hành biên tập bằng phần mềm Seqman (DNAstar 7.1-Lasergen) để loại bỏ những trình tự nhiễu xấu và những trình tự trùng với vector. Kết quả giải trình tự được thể hiện ở bảng 4.15. Bảng 4.15. Kết quả giải trình tự 2 dòng plasmid mang cấu trúc xâm nhiễm của virus mẫu VNP1500 STT Mã giải trình tự Dòng plasmid Mồi giải trình tự Kích thước đoạn đọc được (nucleotide) 1 163DZAB045 VNP1500-1 (A) pCambia SeqF 572 2 163DZAB046 VNP1500-1 (A) pCambia SeqR 148 3 163DZAB047 VNP1500-1 (A) VNP93-A-F 976 4 163DZAB048 VNP1500-1 (A) VNP93-A-R 920 5 163DZAB049 VNP1500-1 (A) VNP93-A-F1 871 6 163DZAB050 VNP1500-1 (A) VNP93-A-R1 Nhiễu 7 163DZAB051 VNP1500-20 pCambia SeqF 722 8 163DZAB052 VNP1500-20 pCambia SeqR 680 Sau khi lắp ráp bằng phần mềm Seqman, chúng tôi nhận được trình tự phân tử DNA-A và DNA-B như sau: >VNP1500-1, 1697 nts ATCTATTTCTATGATTCGGTTCAAATTAATAAATATTGAATTTTATTATATCCGAAAGATGAGCATCAATTGTGCCCTCAAGTACATTGTACAATACATGTCTAATTGCCCTAATAACGTTGTTGATACTAATAACTCCTAAATGGTCTAAATACTTTATACATTGGTATCTAAATACTCTTAAGAAACGCGAGGTCTGAGGACGTAAACGAGTCCAGATTTGGCAGATTAGATAGCATTGGTGTAGTCCCAACGCTTTCCTCAGGTTGTAGTTGAACTGGATCTGCACTGTGATCATGTCGTGGTTCATCATGAATGGTCTCTCGCGGTGGTGGGTTATGTTGAAATAGAGGGGATTGTTGACCGTCCAGATATACACGCCATTCTCTGCCTGAGCTGCAGTGATGCGTTCCCCTGTGCGTGAATCCATGGTTGTGGCAACCTAGAGCGACGAAGTACGAACAACCACAAGGGAGATCAATTCTTCTCCTTCTATTGGTCTTCTTGGCGATTCGGTGTTGCACCTTGATTGGTACCTGAGTAGAGTGGGCCTTGGAGGGTGACGAAGATTGCATTTTTTAAAGCCCAATGTTTAAGTGCGGTGTTCTTTTCCTCTTCCAAGAACTCTTTATAGCTGGAATGTGGTCCTGGATTGCAGAGGAAGATAGTGGGAATCCCGCCTTTAATTTGAACTGGTTTCCCGTACTTGGTGTTGCTTTGCCAGTCTCTTTGGGCCCCCATGAACTCTTTAAAGTGCTTTAGATAATGCGGATCGACGTCATCAATGACGTTATACCAAGCAGCATTATTGAACACTTTAGGACTTAAGTCTAAATGCCCACATAAGTAGTTATGTGGGCCCAATGACCTGGCCCACATTGTCTTCCCTGTACGACTATCGCCCTCTAACACAATGCTTATCGGTCTTAATGGCCGCGCAGCGGCACTAACAACGTTTCCGGCAACCCATTCATCAAGTTCCTCGGGGACTTGGTCAAAAGAAGAAGACAAGAAAGGACAAACAAAAACCTCTAAAGGAGGTGCAAAAATCCTATCTAAATTACTATGTAAATTATGAAACTGTAAAACAAAATCTTTGGGGGCCTTCTCCTTTAATATATTGAGGGCCTCTGCTTGACCTGAATTGATTGCCTCGGCATATGCGTCGTTGGCAGATCGGCAACCTCCTCTAGCTGATCTGCCATCGATCTGGAAAACTCCATGATCAAGCACGTCTCCGTCTTTCTCCATGTATGCTTTAACATCTGACGAGCTCTTAGCTCCCTGAATGTTCGGATGGAAATGTGCTGACCTGGTTGGGGATCTGAGGTCGAAGAACCTTTGATTTTTGCATTGGAATTTACCTTCGAATTGGATGAGGACATGCAAGTGAGGAGTCCCATCTTCGTGCAATTCCCTGCAAATCCTGATAAACAGTTTATTTGTTGGTGTTTCTATGGCTTGAATTTGGGAAAGTGCCTCTTCTTTGGTGAGAGAGCAGTGTGGGTATGTGAGGAAATAGTTTTTAGCATTTATTCTGAATTTGCTTGGGGGAGCCATTGACCGGTCAATCGGTGTCTCTCAACTTGGGCTATGTAATTGGTGTCTGGGGTCTTATTTATATGGAGACCCTAAATGGCAATATTGTAATTTCTTAAAGAAATTTAAATTCCAAAAGCGGCCATCCGTATAATATT >VNP1500-20, 1396 nts ACCGGATGGCCGCGATTTTTTTTTTACGTGGTCCCCGCACGCGTTTCTGACATTTGTGTCCATTCGATCAATCCCACCCATTGAAACTGAACACGTGTTACCATCTTAAGTCAGGGATGTTTCCACGTCTGTTTTCTATATATTGGTCCTATTCATCTCCTCTCTCATTTGTAAATAAAAATGAGAGTTCCAATCCGGAGGAATTCAGGCGTCAATTCTGATCGTCGTCCTTCCAATGGGTCAATCCACCGGTGGAACTACCCATATTCCAACTATTTTGGGAGGAGGATTGGCAACCGTGTATACGGCATGCCATTCGGAAACCAACAAGTGCAACGACGTGAGTTTAAGCAAACTCAACGTCTTACCAAGTCTGCTGAGCAGGTTTCATGTAGGAGGAAGTCTATGAAGACGGTTGAGGAAATACACGATGGCACTGACTACTTGCTGTGCAGTAACATGTCTAAGGTGTCGTATATTAGCTACCCGCCTCTATCCGGCACTGAATATGGTAGTAGAGCTGAGTCCTATATCAAAGTCTTGGGAGTCACTGTATCTGGGTCTGCTGTGCTGAAGCAGACGGGCATGCGTGAAGCAGATGGGTCTCAAGGAATTCATGGGATATTTACTACAGTACTTGTTCGTGACAAGAGACCATGTCAGTTCTCTGCCGTGGATCCGATCATCCCATTTGCGGAGCTGTTTGGACAAGAGAAGAGAGCATGCTCCTCATTACGTGTTAGAGATTCTTATAAGAATCGATTTAGTGTTGTCTACCAGAAGAAGCATGTAGTAAATAGTGCTCTATCAACACATGTATTTAGGTATAATTTTAATGTGAAATTCTCTAGATTTCCTTTCTGGGTGTCTTTCAAAGACACCTCCAACGCAGAGCCTACTGGGCGATATTCTAATGTGTCGAAGAACGCATTGGTTGTGTACTATGTTTGGCTATGTGATTCAAATGTAACAGCCGAAGTGCACGTGCAATATGATTTGAACTACATTGGATAAATAAAATCATATTTTTTTTACATTCGAGGAGACATTACTCCCCTCCATACATAGCTCAACAGTTTTTTTAATAATATTAATTACATCGTCATTTACTTTGTTGCTACCTGCAACAACTTCCGACGCCGAAGGGCCTGGATCTAGGGTTCCATCTTGCAGCCGATGTAAATGTCTATATGGGTGCTCCTCTATGTCGTTGTTCTCCACTGTGCTGGCTGAAGCCCAAGTATGCCCCTGTGGAATGGCATTTGTAGTGTATCTGGAAGACTGTGACCTCATGTGTGTTAGGGCTTGTACTGGTTTTCTTGATACAGTTGATTGAGGCACATGCCAGAAATCTATGTGGTTCATGTTATACGCCTTTGATAGTATTTCAATCTTA Kết quả giải trình tự chưa thu được đầy đủ phân tử DNA-A của mẫu virus VNP1500. Phân tử DNA-A của mẫu virus còn thiếu khảng 1000 nts (Hình A). Đối với plasmid VNP1500-20, trước khi giải trình tự, chúng tôi vẫn chưa rõ liệu đây là DNA-A hay là DNA-B (của một loài khác) mặc dù đã được dự đoán là DNA-B (phần ...). Đoạn trình tự virus thu được của plasmid này chỉ gồm 2 đoạn là 722 và 680 nts (tính từ 2 phía của vị trí cắt bằng enzyme BamHI). Hình 4.22. Các đoạn trình tự của dòng plasmid VNP1500 – 1 (DNA-A) được lắp ráp bằng phần mềm SeqMan (DNASTAR) Xác định danh tính virus dựa trên trình tự sẵn có Tìm kiếm Blast Các trình tự thu được, bao gồm đoạn dài 1697 nts của plasmid VNP1500-1 và đoạn dài 1396 nts của plasmid VNP1500-20, đã được sử dụng để xác định danh tính virus dùng phần mềm tìm kiếm trực tuyến Blast. Tìm kiếm này cũng đồng thời xác định bản chất là DNA-A hay DNA-B của plasmid VNP1500-20. Kết quả tìm kiếm được trình bày ở Bảng 4.16 . Kết quả tìm kiếm trực tuyến cho thấy DNA-A của mẫu virus VNP1500 gần gũi nhất với DNA-A của Pepper leaf curl (Malaysia) virus (mức đồng nhất trình tự là 88 %). Kết quả tìm kiếm trực tuyến cho thấy đoạn trình tự virus của plasmid VNP1500-20 là DNA-B và gần gũi nhất với DNA-B của Tomato yellow leaf curl Kanchanaburi virus với mức đồng nhất trình tự 89% (bảng 4.16). Các mức đồng nhất trình tự ở trên khá thấp và chưa đủ để kết luận danh tính virus. Bảng 4.16. Kết quả tìm kiếm virus gần gũi nhất trên Ngân hàng gen (Genbank) dùng trình tự thu được của mẫu virus VNP1500 Plasmid giải trình tự Virus gần gũi nhất trên Ngân hàng gen* Tên virus (nguồn gốc), loại phân tử của bộ gen Mã Ngân hàng gen Phần trăm đoạn so sánh (%) Mức đồng nhất trình tự (%0 VNP1500-1 (DNA-A) Pepper leaf curl Malaysia virus (Malaysia), DNA-A AF414287 100 88 Erectites yellow mosaic virus (Việt Nam), DNA-A DQ641698 97 89 Pepper leaf curl virus (Thái Lan), DNA-A AF134484 100 97 VNP1500-20 Tomato yellow leaf curl Kanchanaburi virus (Thái Lan, isolate E4), DNA-B KF446664 93 89 Tomato yellow leaf curl Kanchanaburi virus (Thái Lan, isolate P4), DNA-B KF446672 93 89 Tomato yellow leaf curl Kanchanaburi virus (Thái Lan, isolate P3), DNA-B KF446670 93 89 * Chỉ trình bày 3 virus gần gũi nhất dung phần mềm tìm kiếm trực tuyến BLAST tại NCBI So sánh trình tự với PepYLCVNV Do DNA-A của mẫu virus VNP1500 luôn có phản ứng PCR dương tính với mồi đặc hiệu của PepYLCVNV. Bộ gen của virus này vẫn chưa được gửi trên Ngân hàng gen nên chúng tôi đã tiến hành so sánh trình tự của mẫu virus VNP1500 với PepYLCVNV (VNP93). Trình tự của các virus gần gũi trên Ngân hàng gen như: PepLCV, TYLCKaV và ErYV cũng được sử dụng trong phân tích. Kết quả so sánh được trình bày ở bảng 4.17. Kết quả so sánh cho thấy cả 2 phân tử DNA-A và DNA-B của mẫu VNP1500 đều có mức đồng nhất trình tự rất cao (>90%) đối với virus PeYLCVNV (mẫu VNP93). Mặc dù danh tính chính xác của virus chỉ có thể được xác định dựa trên trình tự toàn bộ bộ gen nhưng mức đồng nhất cao ở trên cho thấy mẫu VNP1500 chính là PepYLCVNV. Kết quả này cho thấy PepLCVNV có phân bố khá rộng, ít nhất ở các tỉnh miền Trung và miền nam nước ta. Bảng 4.17. So sánh đoạn trình tự thu được của mẫu virus VNP1500 với PepYLCVNV (VNP93) và các gần gũi nhất trên Ngân hàng gen Loại phân tử genome Virus so sánh Mức đồng nhất trình tự (%)* VNP1500-1 VNP1500-20 DNA-A PepYLCVNV (VNP93, Việt nam, DNA-A) 90.9 PepLCV (AF414287, Malaysia, DNA-A) 87.8 PepLCV (AF134484, Thái Lan, DNA-A) 86.3 EYMV (DQ641698, Việt Nam, DNA-A) 86.9 TYLCKaV (AF511529, Thai Lan, DNA-A) 71.7 DNA-B PepYLCVNV (VNP93, Việt nam, DNA-B) 92.5 TYLCKaV (AF511528, Thái Lan, DNA-B) 86.6 * Chỉ tính trên đoạn trình tự thu được của mẫu VNP1500 (1697 nts của plasmid VNP1500-1 và 1396 nts của plasmid VNP1500-20) Kết quả kiểm tra một số loại virus gây hại trên ớt thu thập tại miền Bắc và miền Trung giai đoạn 2012-2013 Kiểm tra virus gây hại thu thập ngoài đồng từ các địa điểm điều tra giai đoạn 2012-2013 bằng phương pháp ELISA Nhằm xác định nguyên nhân gây bệnh do virus gây hại trên ớt , chúng tôi tiến hành thu thập mẫu bệnh có triệu chứng điển hình được thu thập từ các địa điểm điều tra. Mẫu bệnh thu được làm khô và bảo quản bằng silicagel. Để kiểm tra các mẫu có triệu chứng thu được, chúng tôi tiến hành kiểm tra bằng phản ứng ELISA trực tiếp (DAS – ELISA). Nguồn kháng huyết thanh sử dụng là kháng huyết thanh Chilli Veinal mottle Virus (ChiVMV), đây là potyvirus phổ biến trên ớt tại Việt Nam. Tổng số 28 mẫu có triệu chứng virus thu thập được trong quá trình điều tra ngoài đồng ruộng đã được kiểm tra ELISA, trong đó các mẫu được kết luận là dương tính khi có trị số ELISA lớn gấp đôi trị số ELISA của đối chúng âm (cây khỏe). Kết quả được thể hiện ở bảng 4.1, hình 4.1.1. Kết quả bảng 4.1 và hình 4.32 và hình 4.33 cho thấy: Kết quả kiểm tra cho thấy có 12/28 mẫu bị nhiễm ChiVMV (chiếm 54.55%). Điều đó, cho thấy chủng ChiVMV là virus quan trọng đối với cây ớt tại Việt Nam. Bảng 4.18. Kết quả kiểm tra ELISA các mẫu ớt thu được tại Việt Nam giai đoạn 2012-2013 STT Ký hiệu Triệu chứng Địa điểm ChiVMV OD KL 1 VNP96 Cuốn lá, khảm Túy Loan-Đà Nẵng 0.874 + 2 VNP120 Khảm Thái Bình 2.717 + 3 VNP179 Cuốn lá, khảm Cam Lộ-Quảng Trị 0.156 – 4 VNP192 Khảm Cam Đường-Lào Cai 0.162 – 5 VNP217 Khảm Cò Nòi-Sơn La 0.244 + 6 VNP237 Cuốn lá,khảm Cổ Phúc-Yên Bái 0.146 – 7 VNP251 Cuốn lá,khảm Chiềng Sinh-Sơn La 0.923 + 8 VNP291 Khảm vàng, lá nhỏ Vĩnh Tường-Vĩnh Phúc 1.642 + 9 VNP300 Xoăn vàng lá Sóc Sơn-Hà Nội 0.150 – 10 VNP306 Khảm vàng Yên Thế-Bắc Giang 0.180 – 11 VNP313 Khảm vàng Châu Thành-An Giang 0.161 – 12 VNP453 Khảm vàng Vĩnh Bảo-Hải Phòng 2.174 + 13 VNP535 Khảm Hòa An-Cao Bằng 0.144 – 14 VNP558 Khảm vàng Chợ Mới-Bắc Kạn 0.158 – 15 VNP626 Khảm Túy Loan-Đà Nẵng 0.151 – 16 VNP632 Khảm vàng Túy Loan-Đà Nẵng 0.623 + 17 VNP634 Khảm vàng Điện Bàn-Quảng Nam 0.673 + 18 VNP649 Khảm vàng Phù Cát-Bình Định 1.058 + 19 VNP683 Khảm Thanh Bình-Đồng Tháp 2.160 + 20 VNP706 Khảm vàng Châu Thành-An Giang 1.844 + 21 VNP716 Khảm Yên Thế-Bắc Giang >3 + 22 VNP785 Khảm Bình Thủy-Cần Thơ 0.145 – 23 Đối chứng (–) Không bị bệnh TTBCNĐ- ĐHNNHN 0.162 – 24 Đối chứng (–) Không bị bệnh TTBCNĐ- ĐHNNHN 0.160 – 25 Đối chứng (–) Không bị bệnh TTBCNĐ- ĐHNNHN 0.172 – 26 Đối chứng (+) Khảm vàng, lá nhỏ TTBCNĐ- ĐHNNHN >3 + 27 Đối chứng (+) Khảm vàng, lá nhỏ TTBCNĐ- ĐHNNHN >3 + 28 Đối chứng (+) Khảm vàng, lá nhỏ TTBCNĐ- ĐHNNHN >3 + Số mẫu + 12 Tỷ lệ mẫu + 54.55% Ghi chú: OD: Mật độ quang học đo bước sóng 405 nm; KL: Kết luận; ( -) : Cây không nhiễm bệnh; (+): Cây nhiễm bệnh 2 × trị số trung bình giá trị ở giếng đối chứng âm + độ lệch chuẩn=0.178 Hình 4.22. Kết quả ELISA phát hiện ChiVMV Kiểm tra virus gây hại thu thập ngoài đồng từ các địa điểm điều tra giai đoạn 2012-2013 bằng phản ứng PCR Kết quả kiểm tra ELISA cho thấy, nhiều mẫu với triệu chứng rất điển hình như khảm vàng toàn bộ diện tích lá, cuốn lá, biến dạng lá lại không dương với virus ChiVMV. Chính vì thế chúng tôi nghi ngờ các mẫu trên có thể nhiễm begomovirus. Vì vậy, chúng tôi chọn một số mẫu âm với virus ChiVMV, cùng với một số mẫu nghi ngờ nhiễm begomovirus đã thu thập được để kiểm tra PCR. Tất cả các mẫu đều được chiết DNA tổng số bằng CTAB và phản ứng PCR sử dụng cặp mồi chung BegoA – For1/BegoA – Rev1. Kết quả được trình bày trong bảng (4.2) và hình 4.1.2. Kết quả kiểm tra cho thấy, trong 12 mẫu kiểm tra đã phát hiện thấy 8 mẫu phản ứng PCR dương (+), tức là cây nhiễm bệnh, chiếm tỷ lệ 66,67%. Các mẫu có phản ứng dương với cặp mồi chung BegoA – For1/BegoA – Rev1 tạo các băng đơn trên bản gel, trùng kích thước sản phẩm băng điện di mong muốn là ~1.2 kb, mẫu đối chứng dương có phản ứng. Như vậy, kết quả kiểm tra đã xác nhận sự có mặt của begomovirus trong 12 mẫu ớt kiểm tra. Bảng 4.19. Kết quả kiểm tra các mẫu ớt bằng PCR sử dụng cặp mồi BegoA – For1 và BegoA – Rev1 STT Mẫu Triệu chứng Địa điểm Kết quả PCR 1 VNP4 Cuốn lá, khảm FAVRI + 2 VNP179 Khảm vàng Cam Lộ – Quảng Trị + 3 VNP192 Khảm Cam đường – Lào Cai – 4 VNP234 Khảm Cổ Phúc – Yên Bái – 5 VNP246 Xoăn lá Chiềng Sinh – Sơn La + 6 VNP300 Khảm vàng Sóc Sơn – Hà Nội – 7 VNP306 Khảm Yên Thế – Bắc Giang + 8 VNP456 Sáng gân Quỳnh Phụ – Thái Bình – 9 VNP459 Sáng gân từ cuống Quỳnh Phụ – Thái Bình – 10 VNP535 Khảm Hòa An – Cao Bằng – 11 VNP558 Khảm nhăn Chợ Mới – Bắc Kạn – 12 VNP961 Khảm, biến vàng An dương – Hải Phòng – Số mẫu dương/tổng số mẫu thử 8/12 Tỷ lệ(%) 66,67 Ghi chú: (+) Cây nhiễm virus, (–) Cây không nhiễm virus Hình 4.23. Triệu chứng của Begomovirus gây hại trên ớt tại Đà Nẵng Hình 4.24. Kiểm tra PCR các mẫu ớt bằng cặp mồi cặp mồi BegoA – For1 và BegoA – Rev1 MarkeràH2OàVNP4àVNP179àVNP192àVNP234àVNP246àVNP300à VNP306àVNP456àVNP459àVNP538àVNP558àVNP9611 (ladder: 1kb) Từ kết quả trên, chúng tôi nhận thấy 2 mẫu bệnh ở miền Bắc phản ứng PCR dương: VNP246 và VNP306. Vì begomovirus chưa từng xuất hiện tại miền Bắc, do đó chúng tôi tiến hành kiểm tra PCR trên 2 mẫu này thêm 1 lần nữa. Kết quả trình bày bảng (4.3) và hình 4.1.3. Bảng 4.20. Kết quả kiểm tra 2 mẫu ớt bằng PCR sử dụng cặp mồi BegoA – For1 và BegoA – Rev1 STT Mẫu Triệu chứng Địa điểm Kết quả PCR 1 VNP246 Xoăn lá Chiềng Sinh – Sơn La – 2 VNP306 Khảm Yên Thế – Bắc Giang + Số mẫu dương/tổng số mẫu thử 1/2 Tỷ lệ(%) 50 Ghi chú: (+) Cây nhiễm virus, (–) Cây không nhiễm virus . Hình 4.24. Kiểm tra PCR 2 mẫu ớt thu ở miền Bắc bằng cặp mồi cặp mồi BegoA – For1 và BegoA – Rev1 MarkeràH2OàVNP4àVNP179 (ladder: 1kb) KẾT LUẬN VÀ ĐỀ NGHỊ Kết luận Đã phục hồi 2 dòng vi khuẩn A. tumerfaciens mang cấu trúc xâm nhiễm của PepYLCVNV là AT-VNP93-5-4-11 và AT-VNP93-5-8-1. Đã lây nhiễm PepYLCVNV bằng agroinoculation trên các giống: cà chua Hồng Lan (T20), ớt Hiểm Lai F1-207, và các cây chỉ thị. Đã lây nhiễm PepYLCVNV bằng bọ phấn (B. tabaci) trên các giống: cà chua Hồng Lan (T20), cà tím GS505, ớt Hiểm lai F1-207. Kết quả cho thấy giống thí nghiệm đều biểu hiện triệu chứng bệnh với tỷ lệ 100% nhiễm bệnh khi lây nhiễm bằng bọ phấn. Xây dựng thành công cấu trúc xâm nhiễm của PepYLCVNV bằng kỹ thuật RCA (rolling circle amplification). Đã giải trình tự toàn bộ bộ gen gồm 2 thành phần DNA-A và DNA-B của mẫu virus gây bệnh trên cây ớt thu tại Đồng Tháp (mẫu VNP1500). Đã kiểm tra PCR với cặp mồi chung để phát hiện begomovirus trên các mẫu ớt thu thập tại miền Bắc và miền Nam Việt Nam. Kết quả cho thấy có 2/12 (16.7%) mẫu ớt thu tại miền Bắc và 6/12 (50%) mẫu ớt thu tại miền Trung nhiễm begomovirus. Kiến nghị Tiếp tục tối ưu hóa phương pháp lây nhiễm nhân tạo sử dụng vi khuẩn Agrobacterium tumerfaciens (Agroinoculation) đối với PepYLCVNV nhằm đánh giá được tính gây bệnh của PepYLCVNV. Sử dụng cấu trúc xâm nhiễm PepYLCVNV mới thiết kế để đánh giá tính gây bệnh của PepYLCVNV. Đánh giá tính gây bệnh của begomovirus gây bệnh trên ớt bằng kỹ thuật Agroinoculation. Tiếp tục đánh gia đa dạng của begomovirus trên ớt tại Việt Nam. Lần đầu tiên phát hiện virus begomovirus trên ớt ở miền Bắc nên cần kiểm tra lại. TÀI LIỆU THAM KHẢO TÀI LIỆU TIẾNG VIỆT Hà Viết Cường (2010), Công nghệ sinh học trong bệnh cây. Hà Viết Cường (2012), Virus thực vật, Phytoplasma và Viroid . NXB Đại học Nông nghiệp. Vũ Triệu Mân (2003), Chẩn đoán nhanh bệnh hại thực vật, NXB Nông Nghiệp. Vũ Triệu Mân – Lê Lương Tề chủ biên (2001). Giáo trình Bệnh cây Nông Nghiệp. NXB Nông Nghiệp. Lê Lương Tề, Vũ Triệu Mân (1999), Bệnh vi khuẩn và virus hại cây trồng. NXB Giáo dục, Hà Nội. Nguyễn Thị Hà Uyên (2012). Xác định và đánh giá khả năng gây bệnh của một số begomovirus trên cây cà chua bằng phương pháp lây nhiễm nhân tạo dùng vi khuẩn Agrobacterium tumerfaciens TÀI LIỆU TIẾNG ANH. (1990). "High efficiency transformation of Escherichia coli with plasmids." Gene 96(1): 23-28. Briddon (2003). "Cotton leaf curl disease, a multicomponent begomovirus complex." Molecular Plant Pathology 4(6): 427-434. Doyle (1987). "A rapid DNA isolation procedure for small quantities of fresh leaf tissue." Phytochem bull 19: 11-15. Fauquet and Stanley (2005). "Revising the way we conceive and name viruses below the species level: a review of geminivirus taxonomy calls for new standardized isolate descriptors." Archives of virology 150(10): 2151-2179. Fauquet, et al. (2008). "Geminivirus strain demarcation and nomenclature." Archives of virology 153(4): 783-821. Ferreira, et al. (2008). "One-step cloning approach for construction of agroinfectious begomovirus clones." Journal of virological methods 147(2): 351-354. Fujii, et al. (2006). "Error-prone rolling circle amplification: the simplest random mutagenesis protocol." Nature protocols 1(5): 2493-2497. Gafni and Yedidya (2003). "Tomato yellow leaf curl virus, the intracellular dynamics of a plant DNA virus." Molecular plant pathology 4(1): 9-15. Ghanim and Czosnek (2000). "Tomato yellow leaf curl geminivirus (TYLCV-Is) is transmitted among whiteflies (Bemisia tabaci) in a sex-related manner." Journal of Virology 74(10): 4738-4745. Green (1991). Characteristics and control of viruses infecting peppers: a literature review, Asian Vegetable Research and Development Center. Green and Kim (1991). Characteristics and control of viruses infecting peppers: a literature review, Asian Vegetable Research and Development Center. Green, et al. (2001). "Molecular characterization of begomoviruses associated with leafcurl diseases of tomato in Bangladesh, Laos, Malaysia, Myanmar, and Vietnam." Plant Disease 85(12): 1286-1286. Gutierrez, et al. (2004). "Geminivirus DNA replication and cell cycle interactions." Veterinary microbiology 98(2): 111-119. Ha (2007). "Detection and identification of potyviruses and geminiviruses in Vietnam." Ha (2008). "Molecular characterization of begomoviruses and DNA satellites from Vietnam: additional evidence that the New World geminiviruses were present in the Old World prior to continental separation." Journal of General Virology 89(1): 312-326. Ha, et al. (2008). "Molecular characterization of begomoviruses and DNA satellites from Vietnam: additional evidence that the New World geminiviruses were present in the Old World prior to continental separation." Journal of General Virology 89(1): 312-326. Haible, D., et al. (2006). "Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses." Journal of virological methods 135(1): 9-16. Harrison and Robinson (2005). "Another quarter century of great progress in understanding the biological properties of plant viruses." Annals of applied biology 146(1): 15-37. Hartz, T., et al. (1997). Processing tomato production in California, UCANR Publications. Hofgen and Willmitzer (1988). "Storage of competent cells for Agrobacterium transformation." Nucleic Acids Research 16(20): 9877-9877. Inoue-Nagata, et al. (2004). "A simple method for cloning the complete begomovirus genome using the bacteriophage φ29 DNA polymerase." Journal of virological methods 116(2): 209-211. Kheyr-Pour, et al. (1991). "Tomato yellow leaf curl virus from sardinia is a whitefly-transmitted monoparatite geminivirus." Nucleic Acids Research 19(24): 6763-6769. Knierim and Maiss (2007). "Application of Phi29 DNA polymerase in identification and full-length clone inoculation of tomato yellow leaf curl Thailand virus and tobacco leaf curl Thailand virus." Archives of virology 152(5): 941-954. Moriones and Navas-Castillo (2000). "Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide." Virus Research 71(1): 123-134. Murugan and Uthamasamy (2001). "Dispersal behaviour of cotton whitefly Bemisia tabaci (Genn.) under cotton based gardenland agro ecosystem of Coimbatore, Tamil Nadu." MADRAS AGRICULTURAL JOURNAL 88(1/3): 1-6. Navot, N., et al. (1991). "Tomato yellow leaf curl virus: a whitefly-transmitted geminivirus with a single genomic component." Virology 185(1): 151-161. Padidam, et al. (1999). "Possible emergence of new geminiviruses by frequent recombination." Virology 265(2): 218-225. Picó, et al. (1996). "Viral diseases causing the greatest economic losses to the tomato crop. II. The Tomato yellow leaf curl virus—A review." Scientia Horticulturae 67(3): 151-196. Picó, B., et al. (1996). "Viral diseases causing the greatest economic losses to the tomato crop. II. The Tomato yellow leaf curl virus—a review." Scientia Horticulturae 67(3): 151-196. Rybicki (1994). "A phylogenetic and evolutionary justification for three genera of Geminiviridae." Archives of Virology 139(1-2): 49-77. Sambrook, et al. (1989). "Extraction and purification of plasmid DNA." Molecular cloning: a laboratory manual 1: 1.21-21.52. Wang, et al. (1993). "A simple method of preparing plant samples for PCR." Nucleic Acids Res 21(17): 4153-4154. Wang, T. C., et al. (1994). "Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic mice." Wu, et al. (2008). "A simplified method of constructing infectious clones of begomovirus employing limited restriction enzyme digestion of products of rolling circle amplification." Journal of virological methods 147(2): 355-359. Wyant, et al. (2011). "The genomes of four novel begomoviruses and a new Sida micrantha mosaic virus strain from Bolivian weeds." Archives of virology 156(2): 347-352. Zhang, et al. (2001). "Movement proteins (BC1 and BV1) of Abutilon mosaic geminivirus are cotransported in and between cells of sink but not of source leaves as detected by green fluorescent protein tagging." Virology 290(2): 249-260. CÁC TRANG WEB

Các file đính kèm theo tài liệu này:

  • docx1_hvd_kltn_2014_new_1_3653_2081721.docx
Luận văn liên quan