Luận văn Thiết lập hệ thống đánh giá tính kháng bệnh héo xanh của cây cà chua trồng trong dung dịch

LỜI CẢM ƠN Thành kính ghi ơn: Cha Mẹ và anh chị em trong gia đình đã tận tuỵ nuôi dạy con ăn học đến ngày hôm nay Chân thành cảm ơn: Ban giám hiệu trường Đại Học Nông Lâm Thành phố Hồ Chí Minh Ban Chủ nhiệm Bộ môn Công Nghệ Sinh Học Bộ môn Bảo Vệ Thực Vật Quý Thầy Cô Bộ môn Công Nghệ Sinh Học đã tận tình dạy dỗ và giúp tôi trong suốt thời gian học tập ở trường Trân trọng biết ơn: Thầy Lê Đình Đôn đã tận tình hướng dẫn tôi trong suốt quá trình thực tập và hoàn tất luận văn tốt nghiệp này Chân thành cảm ơn: Chị Phan Thị Thu Hiền và Phạm Thị Ninh Kiều đã giúp đễ tôi hoàn thành luận văn này. Tất cả các anh chị, các bạn trong và ngoài lớp đã tận tình giúp đễ và động viên tôi thực hiện đề tài này. TÓM TẮT Nội dung nghiên cứu Nội dung A: thiết lập hệ thống thủy canh trồng cà chua. - lựa chọn giá thể và môi trường dinh dưỡng thích hợp cho cây cà chua. Nội dung B: đánh giá tính kháng của cây cà chua trồng dung dịch với bệnh héo xanh do vi khuẩn Ralstonia solanacearum. - xác định các dòng vi khuẩn Ralstonia solanacearum bằng: + môi trường chọn lọc TZC. + Phương pháp PCR. - đánh giá tính kháng của cây cà chua trồng trong hệ thống thuỷ canh với bệnh héo xanh do Ralstonia solanacearum. Kết quả đạt được - Thiết lập được hệ thống thủy canh trồng cây cà chua. - Chọn lọc được môi trường dinh dưỡng thích hợp cho cây cà chua. - Vi khuẩn Ralstonia solanacearum cho phản ứng đặc hiệu với cặp primer PI-IS-F/PI-IS-R. là các dòng độc khi chọn lọc trên môi trường TZC. - chưa tìm được mật số vi khuẩn chủng bệnh thích hợp. MỤC LỤC Nội dung Trang Trang bìa i Trang tựa ii Lời cảm ta iii Tóm tắt iv Mục lục v Danh sách các bảng ix Danh sách các hình x Danh sách các từ viết tắt xi Chương 1: GIỚI THIỆU 1 1.1 Đặt vấn đề 1 1.2 Mục đích nghiên cứu 2 1.3 Nội dung nghiên cứu 2 Chương 2: TỔNG QUAN TÀI LIỆU 3 2.1 Khái quát về lịch sử thủy canh 3 2.2 Vai trò của các nguyên tố khoáng 3 2.2.1 Vai trò của các nguyên tố đa lượng 4 2.2.1.1 Nitơ 4 2.2.1.2 Phospho 4 2.2.1.3 Kali 5 2.2.1.4 Magiê 5 2.2.1.5 Canxi 6 2.2.2 Vai trò của các nguyên tố vi lượng 6 2.2.2.1 Sắt (Fe) 6 2.2.2.2. Đồng (Cu) 7 2.2.2.3 Kẽm (Zn ) 7 2.3 Ảnh hưởng của các điều kiện bên ngoài đến sự hút chất dinh dưỡng của hệ rễ trong hệ thống thuỷ canh 7 2.3.1 Ánh sáng 7 2.3.2 Nồng độ CO2 7 2.3.3 Nhiệt độ 8 2.3.4 Nước 8 2.3.5 Độ dẫn điện và pH 8 2.3.6 Sự phát triển của tảo trong hệ thống thuỷ canh 9 2.4 Bệnh và quản lý bệnh trong hệ thống thuỷ canh 9 2.4.1 Các bệnh thường gặp trong trồng thuỷ canh 9 2.4.2 Quản lý bệnh trong trồng thuỷ canh 10 2.4.2.1 Quản lý bệnh trước khi có bệnh sảy ra 10 2.4.2.1 Quản lý bệnh khi có bệnh sảy ra 11 2.5 Một số phương pháp trồng thuỷ canh và tình hình trồng thủy canh 12 2.5.1 Một số phương pháp trồng thủy canh 12 2.5.1.1 Hệ thống thủy canh không hồi lưu 12 2.5.1.2 Hệ thống thuỷ hồi lưu 12 2.5.1.3 Hệ thống khí canh 12 2.5.2 Tình hình thuỷ canh ở Vịêt Nam 12 2.6 Các kỷ thuật chẩn đoán bệnh héo xanh 13 2.6.1 Phương pháp nuôi cấy trên môi trường nhân tạo 13 2.6.2 Phương pháp huyết thanh 13 2.6.3 Phương pháp chủng trên ký chủ 13 2.6.4 Phương pháp lai phân tử 13 2.6.5 Phương pháp PCR ( polymerase Chain Reaction) 14 2.7 Tình hình nghiên cứu bệnh héo xanh do vi khuẩn R. solanacearum 14 Chương 3: VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 16 Nội dung A: Thiết lập hệ thống thuỷ canh trồng cà chua 16 3.1 Thời gian và địa điểm 16 3.1.1 Thời gian 16 3.1.2 Địa điểm 16 3.2 Vật liệu và phương pháp nguyên cứu 16 3.2.1 Vật liệu và dụng cụ 16 3.2.1.1 Vật liệu 16 3.2.1.2 Dụng cụ 16 3.2.2 Phương pháp nghiên cứu 16 3.2.2.1 Cách pha dung dịch dinh dưỡng 16 3.2.2.2 Thiết lập hệ thống trồng cây cà chua 19 3.2.2.3 Chỉ tiêu theo dõi 20 Nội dung B: Đánh giá tính kháng của cây cà chua trông trong dung dịch đối với R. solanacearum 20 3.3 Thời gian và địa điểm 20 3.3.1 Thời gian 20 3.3.2 Địa điểm 20 3.4 Vật liệu và phương pháp nghiên cứu 20 3.4.1 Vật liệu và dụng cụ 20 3.4.1.1 Vật liệu 20 3.4.1.2 Dụng cụ 21 3.4.2 Phương pháp nghiên cứu 22 3.4.2.1 Phương pháp lấy mẫu 22 3.4.2.2 Phân lập nuôi cấy và tồn trữ mẫu 22 3.4.2.3 Phương pháp xác định R. solanacearum bằng môi trường chọn lọc TZC 22 3.4.2.4 Phương pháp ly trích DNA tổng số 23 3.4.2.5 Phương pháp PCR 24 3.4.2.6 Đánh giá tính kháng của cây cà chua đối với R.solonacearum 25 3.4.2.7 Khả năng sinh trưởng và phát triển của R. solanacearum trong hệ thống thuỷ canh 26 Chương 4:KẾT QUẢ VÀ THẢO LUẬN 27 Nội dung A: Thiết lập hệ thống thuỷ canh trồng cà chua 27 4.1 Chọn lọc môi trường thích hợp cho cho cây cà chua trồng thuỷ canh 27 Nội Dung B: Đánh giá tính kháng của cây cà chua trồng trong dung dịch đối với R. solanacearum 32 4.2 Kết quả phân lập, tồn trữ mẫu 32 4.3Kết quả chọn lọc trên môi trường TZC 32 4.4 Kết quả kiểm tra bằng phương pháp PCR 34 4.5 Đánh giá tính kháng của cây cà chua đối với R.solonacearum. 35 4.6 xác định mật số vi khuẩn R. solanacearum trong hệ thống thuỷ canh 35 Chương 5: KẾT LUẬN VÀ ĐỀ NGHỊ 37 5.1 Kết luận 37 5.2 Đề nghị 38 Chương 6: TÀI LIỆU THAM KHẢO 39 6.1 Tiếng Việt 39 6.2 Tiếng nước ngoài 40 6.3 Internet 40 Chương 7: PHỤ LỤC 41 DANH SÁCH CÁC BẢNG Bảng Trang Bảng 3.1 Thành phần đa lượng trong môi trường A 16 Bảng 3.2 Thành phần vi lượng trong môi trường A 16 Bảng 3.3 Thành phần đa lượng trong môi trường B 17 Bảng 3.4 Thành phần vi lượng trong môi trường B 17 Bảng 3.5 Thành phần đa lượng trong môi trường C 18 Bảng 3.6 Thành phần vi lượng trong môi trường C 18 Bảng 3.7 Trình tự primers PI-IS-F và PI-IS-R 20 Bảng 3.8 Thành phần các chất trong phản ứng PCR 23 Bảng 4.1 Chiều cao cây cà chua sau 5 ngày trồng 27 Bảng 4.2 Chiều cao cây cà chua sau 10 ngày trồng 27 Bảng 4.3 Chiều cao cây cà chua sau 15 ngày trồng 28 Bảng 4.4 Chiều cao cây cà chua sau 20 ngày trồng 28 Bảng 4.5 Chiều cao cây cà chua sau 25 ngày trồng 29 Bảng 4.6 Chiều cao cây cà chua sau 30 ngày trồng 29 Bảng 4.7 Kết quả chọn lọc vi khuẩn trên môi trường TZC 32 Bảng 4.8 Kết quả xác định R.solonacearum bằng phương pháp PCR 33 Bảng 4.9 Mật số vi khuẩn có trong 1ml dung dịch dinh dưỡng 35 DANH SÁCH CÁC HÌNH Hình Trang Hình 4.1 Cà chua trồng trong dung dịch dinh dưỡng C sau 20 ngày 30 Hình 4.2 Cà chua trồng trong dung dịch dinh dưỡng C 31 Hình 4.3 Vi khuẩn R.solanacearum mọc trên môi trường TZC sau 4 ngày nuôi cấy ở 27oC 32 Hình 4.4 Kết quả điện di sản phẩm PCR trên gel agarose 1% 33 DANH SÁCH CÁC TỪ VIẾT TẮT Bp: base pair: CTAB: Cetyl Trimethyl Alammonium CFU: : Cloning Forming Unit dNTP: Nucleoside Triphosphate DNA: Deoxyribose Nucleic Acid H: hàng LB: Linia – Bertani LLL: lần lập lại mM: mili mol ml: mili lít NSC: ngày sau chủng PCR: Polymerase Chain Reaction PDA: Potato Dextrose Agar RNA: Ribonucleic Acid TAE: Trisglacial Acetic acid Ethylen diamine tetraacetic acid EDTA: Ethuylen diamine tetraacetic acid TTC: Triphenyl Tetrazolium Chloride TZC: Tetrazolium Chloride U: ( đơn vị hoạt tính) THIẾT LẬP HỆ THỐNG ĐÁNH GIÁ TÍNH KHÁNG BỆNH HÉO XANH CỦA CÂY CÀ CHUA TRỒNG TRONG DUNG DỊCH

pdf42 trang | Chia sẻ: lvcdongnoi | Ngày: 04/06/2013 | Lượt xem: 1674 | Lượt tải: 1download
Bạn đang xem nội dung tài liệu Luận văn Thiết lập hệ thống đánh giá tính kháng bệnh héo xanh của cây cà chua trồng trong dung dịch, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
ò keát tuûa do ñoù Fe khoâng di chuyeån vaøo maøng teá baøo, laù bò vaøng. Canxi laø chaát hoaït hoaù cho vaøi enzyme nhaát laø enzyme trong nhoùm ATPase. Thieáu Canxi reã nhaày nhuïa, söï haáp thu döôõng chaát bò trôû ngaïi, bieåu hieän thieáu ôû ngoïn choài. Caây non thì laù non bò xoaén. Bìa laù bò thöa vaø neáu thieáu traàm troïng thì seõ bò chaùy bìa laù. Thaân hay cuoán hoa, ñænh sinh tröôûng bò cheát. Canxi thöôøng söû duïng döôùi daïng CaCl2, Ca(NO3), CaSO4. 2.2.2 Vai troø cuûa caùc nguyeân toá vi löôïng 2.2.2.1 Saét (Fe) Coù vai troø keát hôïp vôùi protein ñaëc bieät taïo neân cô sôû cuûa Enzyme heä xitocro ( xitocrom, xitocromoxydase, xitocromperoxydase, catalase, peroxydase) xuùc taùc sinh toång hôïp dieäp luïc toá. Trong caây Fe töông ñoái keùm linh ñoäng. Thieáu Fe caây bò beänh uùa vaøng, caây khoâng söû duïng ñöôïc Fe laø do phaûn öùng kieàm, do taùc duïng töông hoã cuûa Fe vôùi acid phosphoric vaø nhöõng hôïp chaát khaùc, do bò keát tuûa döôùi aûnh höôûng cuûa vi khuaån. Thieáu nhieàu Fe laù seõ bò vaøng vaø bò chaùy xeùn ôû phaàn ngoïn vaø meùp laù. Thöôøng söû duïng Fe döôùi daïng chelat Fe hoaëc Na2EDTA hoaëc FeEDTA. - 7 - 2.2.2.2. Ñoàng (Cu) Laø thaønh phaàn caáu truùc cuûa nhieàu Enzyme, nhöõng Enzyme naøy seõ xuùc taùc cho phaûn öùng oxihoaù – khöû. Thieáu ñoàng, laù keùm phaùt trieån, laù coù maøu xanh ñaäm. Thieáu nhieàu thì bò cheát moät phaàn. Treân caây aên traùi laâu naêm, thieáu Cu, laù bò cheát dieäp luïc toá hoaëc caây bò cheát ngöôïc, CuSO4 ngaên ngöøa söï phaùt trieån cuûa vi sinh vaät trong nöôùc. Thöôøng söû duïng Cu döôùi daïng CuSO4.5H2O. 2.2.2.3 Keõm (Zn ) Lieân quan ñeán söï sinh toång hôïp vitamin B1, B2, B6, B12.coù taùc duïng toát ñeán sinh toång hôïp saéc toá carotenoid, tham gia vaøo thaønh phaàn carbonhydraza, moät vaøi phosphataza, enolaza vaø phaân giaûi polypeptit. Thuùc ñaåy söï vaän chuyeån caùc saûn phaåm quang hôïp töø laù ñeán caùc cô quan döï tröõ, taêng khaû naêng döï tröõ vaø ñoä ngaäm nöôùc cuûa moâ. Taêng quaù trình toång hôïp caùc chaát cao phaân töû nhö protein, acid nucleic. Thöôøng söû duïng Zn döôùi daïng ZnSO4.7H2O. 2.3 Aûnh höôûng cuûa caùc ñieàu kieän beân ngoaøi ñeán söï huùt chaát dinh döôõng cuûa heä reã trong heä thoáng thuyû canh 2.3.1 Aùnh saùng Trong quang hôïp caây haáp thuï naêng löôïng töø aùnh saùng maët trôøi. Quang hôïp döï tröû naêng löôïng döôùi daïng hoaù hoïc ñeå hoâ haáp dieãn ra vaø giaûi phoùng naêng löôïng cho moïi hoaït ñoäng cuûa teá baøo nhôø söï oxi hoaù caùc hôïp chaát höõu cô thaønh nhöõng hôïp chaát ñôn giaûn hôn. Neân aùnh saùng laø yeáu toá mang tính chìa khoaù cho söï phaùt trieån toát vaø naêng suaát cao cuûa caây troàng. 2.3.2 Noàng ñoä CO2 CO2 aûnh höôûng tröïc tieáp ñeán quaù trình quang hôïp cuûa caây, CO2 bình thöôøng beân ngoaøi khoaûng 300 ppm. Trong moâi tröôøng nghieâm ngaët, CO2 ít hôn neân caàn cung - 8 - caáp CO2 thuaàn khieát ñeå ñaït ñeán 1000 ppm ñeán 14000 ppm. Nhö vaäy seõ laøm taêng tính haáp thu nöôùc vaø chaát dinh döôõng cuûa caây. 2.3.3 nhieät ñoä Nhieät ñoä ngaøy vaø ñeâm aûnh höôûng ñeán söï khoûe maïnh cuûa caây, kích thöôùc laù, toác ñoä môû roäng laù vaø thôøi gian caây ra traùi. Nhieät ñoä ban ñeâm thaáp vaän toác phaùt trieån laù laø chaäm hôn vaø kích thöôùc laù trong caây non. Nhieät ñoä ban ngaøy vaø ban ñeâm neân ñieàu chænh caån thaän hôn. Nhieät ñoäø ban ñeâm thaáp hôn nhieät ñoä ban ngaøy khoaûng 5 0 C laø thích hôïp. Caây caø chua nhieät ñoä ban ngaøy thích hôïp laø khoaûng 21 – 260C vaø ban ñeâm laø 16 – 18,50C. Nhieät ñoä cao quaù hoaëc thaáp quaù laøm caây phaùt trieån baát thöôøng vaø naêng suaát giaûm. 2.3.4 Nöôùc Caây thieáu nöôùc thì heä reã seõ vöôn daøi vaø lôùn, cho caây nhoû vaø caây keùm phaùt trieån. Neáu quaù nhieàu nöôùc thì caây seõ bò ngaäp uùng vì khoâng ñuû löôïng oxy hoaø tan do ñoù caàn coù söï thoaùt hôi nöôùc thích hôïp trong moâi tröôøng thuyû canh nöôùc caøng tinh khieát caøng toát. Nöôùc hoaù kieàm hay nhieãm maën seõ laøm maát caân baèng dung dòch dinh döôõng. 2.3.5 ñoä daãn ñieän vaø pH Ñoä daãn ñieän (EC) dieãn taû toång noàng ñoä cuûa moät dung dòch dinh döôõng. Chæ soá EC cao thì söï haáp thu nöôùc cuûa caây dieãn ra nhanh hôn khoaùng chaát haäu quaû laø noàng ñoä dinh döôõng trong moâi tröôøng taêng cao seõ gaây ngoä ñoäc cho caây vì vaäy phaûi chaâm theâm nöôùc vaøo moâi tröôøng. Ngöôïc laïi chæ soá EC thaáp, caây seõ haáp thu khoaùng nhieàu hôn haáp thuï nöôùc vaø do ñoù caàn phaûi boå sung khoaùng vaøo moâi tröôøng. Theo Winsor vaø ctv (1979) thì giaù trò EC trong khoaûng 2 – 4 ms/cm laø thích hôïp cho caây troàng. Caây caø chua coøn nhoû coù theå söû duïng EC cao hôn trong ñieàu kieän aùnh saùng thaáp. Giaù trò EC phuï thuoäc vaøo nguoàn nöôùc. Ñoä tinh saïch cuûa nguoàn nöôùc, thoâng thöôøng nguoàn nöôùc coù chöùa haøm löôïng Calcium cao thì coù EC cao. - 9 - pH aûnh höôûng tröïc tieáp ñeán khaû naêng haáp thu chaát dinh döôõng cuûa caây. Neáu PH cao seõ giaûm khaû naêng haáp thuï Fe, Mn, Cu, Zn, P. Coøn pH quaù thaáp seõ laøm giaûm khaû naêng haáp thuï K, S, Ca, Mg. Vì vaäy moãi caây ñeàu coù moät khoaûng pH thích hôïp cho söï phaùt trieån. pH chung thích hôïp cho caây phaùt trieån laø 5,5 – 6,5. 2.3.6 Söï phaùt trieån cuûa taûo trong heä thoáng thuyû canh Trong heä thoáng thuyû canh thì taûo raát hay xuaát hieän ñaây laø nguyeân nhaân caïnh tranh chaát dinh döôõng cuûa caây vaø caû nguoàn oxygen. Traùi vôùi nhöõng suy nghó, thöôøng taûo khoâng gaây haïi cho caây troàng, ngoaïi tröø tröôøng hôïp hieám khi xaûy ra. Nhö khi bò toàn ñoïng nöôùc thì khi ñoù taûo laø nôi aån naáp cuûa beänh dòch vaø saâu boï Taûo caàn hai yeáu toá ñeå phaùt trieån maïnh laø oxy vaø aùnh saùng. Neáu moät trong hai yeáu toá khoâng toàn taïi thì taûo khoâng phaùt trieån ñöôïc. Vì vaäy phöông phaùp toát nhaát ñeå khoâng cho taûo moïc laø che nhöõng thuøng chöùa chaát dinh döôõng baèng naép ñaäy, lau saïch duïng cuï baèng clo loûng, hay caùc chaát saùt truøng thoâng thöôøng trong nhaø. 2.4 Beänh vaø quaûn lyù beänh trong heä thoáng thuyû canh Caùc caây troàng trong heä thoáng thuyû canh hay noâng nghieäp truyeàn thoáng ñeàu laø ñích löïa choïn cuûa caùc beänh vaø coân truøng gaây haïi bôõi vì caùc loaïi caây troàng naøy coù raát thaáp caùc ñoäc toá töï nhieân ñeå choáng laïi beänh vaø coân truøng. Trong troàng thuyû canh beänh vaø coân truøng gaây haïi vaãn laø moät vaán ñeà nghieâm troïng nhaát. Maët duø khoâng söû duïng ñaát, trong khi ñuùng nhieàu beänh vaø coân truøng coù nguoàn goác töø ñaát. Cuõng coù nhieàu beänh coù nguoàn goác töø nöôùc vaø khoâng khí. Nhöõng beänh naøy coù khi aûnh höôûng raát döõ doäi vôùi caây troàng thuyû canh. 2.4.1 Caùc beänh thöôøng gaëp trong troàng thuyû canh Caùc beänh thöôøng gaëp trong troàng thuyû canh cuõng laø caùc beänh thöôøng gaëp trong troàng ñaát truyeàn thoáng. Nguyeân nhaân gaây beänh thöôøng laø do naám, vi khuaån vaø virut. Caùc taùc nhaân naøy coù nguoàn goác töø ñaát, nöôùc vaø khoâng khí. - 10 - Caùc haït gioáng ôû giai ñoaïn naûy maàn thöôøng bò taán coâng vaø gieát cheát bôõi beänh cheát raïp, taùc nhaân gaây beänh thöôøng laø naám Pythium spp, Rhizoctonia spp, Pyranium spp Beänh thoái laù treân caây baép caûi thöôøng gaây ra bôõi naám Rhizoctonia solani, naám naøy raát öa ñieàu kieän moâi tröôøng aåm öôùt Caaâm1 vi khuaån gaây beänh heùo xanh, beänh thoái muïc, vaø beänh ñoám nguyeân nhaân thöôøng laø do caùc vi khuaån nhö Pseudomonas spp, Xanthomonas spp, vaø Eriwinia cuõng thöôøng xuaát hieän trong troàng thuyû canh. Theo Van Peer vaø Schippers (1989), keát luaän raèng vi khuaån Pseudomonas doøng ñoäc gaây öùc cheá söï sinh tröôûng cuûa caây coù theå phaùt trieån deã daøng treân heä thoáng thuyû canh. Theo Ho (1985), beänh thoái röõa cuûa caây baép caûi nguyeân nhaân bôõi Eriwinia carotovora, laø beänh ñaët bieät nguy hieåm thöôøng phaù huyû hoaøn toaøn ñaàu baép caûi vaø beänh taøn luïi vaø thoái ñen nguyeân nhaân bôõi Xanthomonas campestris thöôøng phaù huyû beï laù tröôûng thaønh vaø ñaàu baép caûi laø thöôøng xaûy ra trong heä thoáng thuyû canh. Theo Ho (1988), beänh heùo xanh nguyeân nhaân bôûi Pseudomonas solanacearum, laø moät beänh ñaëc bieät nghieâm troïng treân caây caø chua, thöôøng gieát cheát caây caø chua hoaøn toaøn moät caùch nhanh choùng trong caû troàng ñaát truyeàn thoáng vaø troàng thuyû canh. 2.4.2 Quaûn lyù beänh trong troàng thuyû canh Coù nhieàu caùch ñeå quaûn lyù beänh trong heä thoáng thuûy canh tuyø theo hoaøn caûnh maø chuùng ta duøng caùc phöông phaùp khaùc nhau. 2.4.2.1 Quaûn lyù beänh tröôùc khi coù beänh xaûy ra Choïn loïc haït gioáng: caùc haït gioáng ñöôïc choïn phaûi coù chaát löôïng toát, ñöôïc baûo quaûn toát, vaø ñöôïc söû lyù thích hôïp vôùi caùc thuoác dieät naám coù hieäu quaû tröôùc khi söû duïng. Thöôøng söû lyù haït baèng thuoác dieät naám thiram hoaëc captan vôùi tyû leä 3g treân 100g haït gioáng. - 11 - Quaûn lyù nguoàn nöôùc : nguoàn nöôùc söû duïng laø raát quan troïng, coù theå söû duïng nhieàu nguoàn nöôùc khaùc nhau tuy nhieân thöôøng söû duïng nguoàn nöôùc maùy ñaõ khöû chlorin, nguoàn nöôùc naøy thöôøng saïch khoâng coù vi khuaån gaây beänh. Khöû truøng caùc duïng cuï troàng trong heä thoáng thuûy canh: caùc duïng cuï naøy thöôøng bò nhieãm nhieàu maàm beänh khi söû duïng nhieàu laàn neáu khoâng ñöôïc veä sinh caån thaän vaø kyõ caøn tröôùc khi söû duïng thì coù theå noù cuõng laø moät nguyeân nhaân gaây beänh cho caây troàng trong heä thoáng thuyû canh. Caùc duïng cuï naøy thöôøng ñöôïc khöû truøng baèng formalin, methyl bromide, sodium hypochlorite. 2.4.2.1 Quaûn lyù beänh khi coù beänh xaûy ra Theo Vanachter vaø ctv (1983), coù theå kieåm soaùt toát beänh cheát reã cuûa caây troàng trong heä thoáng thuûy canh baèng Metalaxyl söû duïng trong khoaûng noàng ñoä 0 – 40 mg/l. Khi söû duïng vôùi noàng ñoä 10 mg/l söû duïng 3 laàn sau khoaûng thôøi gian laäp laïi laø 3 tuaàn vaø phaân tích traùi caø chua cho thaáy Metalaxyl coù trong quaû caø chua laø khoaûng 0,09 – 0,42 ppm (trung bình khoaûng 0,19 ppm) vôùi noàng ñoä naøy thì khoâng chöùng toû laø noù coù theå gaây ñoäc cho cô theå ngöôøi söû duïng hay khoâng. Theo Gold vaø Stanghhelien (1984), söû duïng Metalaxyl möùc 5 mg/l kieåm soaùt hieäu quaû pythium spp gaây cheát reã ôû caây deàn. Theo Rouchaud vaø ctv (1988), ghi nhaän furalaxyl ñaõ ñöôïc söû duïng roäng raõi nhö moät thuoác dieät naám cho caây caø chua troàng khoâng ñaát. Theo Ho (1988), thuoác dieät vi khuaån khoâng coù hieäu quaû trong vieäc kieåm soaùt caùc beänh vi khuaån. Theo Toyoda vaø ctv (1991 vaø 1997), Matsuda vaø ctv (1993), ñaõ choïn loïc ñöôïc moät soá chaát cho vieäc kieåm soaùt beänh vi khuaån ôû vuøng reã. Nhö 3 –(3 - Indolyl) butanoic acid coù khaû naêng ngaên chaën vi khuaån gaây beänh heùo xanh. - 12 - 2.5 Moät soá phöông phaùp troàng thuyû canh vaø tình hình troàng thuûy canh 2.5.1 Moät soá phöông phaùp troàng thuûy canh Coù nhieàu phöông phaùp duøng troàng thuûy canh nhöng hieän nay ngöôøi ta chuû yeáu söû duïng 3 heä thoáng thuûy canh. 2.5.1.1 Heä thoáng thuûy canh khoââng hoài löu Laø heä thoáng thuyû canh trong ñoù dung dòch ñöôïc ñaët trong moät hoäp xoáp hoaëc caùc vaät lieäu caùch nhieät, coù hoaëc khoâng coù söû dung heä thoáng suïc khí trong dung dòch. Heä thoáng naøy thích hôïp vôùi quy moâ hoä gia ñình, saûn xuaát nhoû, ôû nhöõng nöôùc keùm phaùt trieån vì chi phi ban ñaàu thaáp, deã söû duïng vaø tieän lôïi trong di chuyeån. ÔÛ Vieät Nam hieän nay ñang söû duïng heä thoáng naøy. 2.5.1.2 Heä thoáng thuyû canh hoài löu Heä thoáng naøy hoaït ñoäng theo cô cheá laø dung dòch chöùa trong caùc hoà chöùa vaø söû duïng bôm ñeå ñöa dung dòch ñi ñeán boä reã cuûa caây vaø sau ñoù bôm dung dòch dinh döôõng tuaàn hoaøn laïi hoà. Toác ñoä bôm vaø caùc thoâng soá khaùc nhö ñoä daãn ñieän (EC) vaø pH ñöïôc ñieàu chænh laò ôû hoà chöùa vaø sau ñoù tieáp tuïc bôm tuaàn hoaøn laïi. Phöông phaùp naøy coù hieäu quaû kinh teá cao hôn, nhöng ñoøi hoûi chi phí ñaàu tö ban ñaàu cao, phuø hôïp vôùi qui moâ saûn xuaát lôùn. 2.5.1.3 Heä thoáng khí canh Laø heä thoáng giuùp cho heä reã phaùt trieån toát hôn. Laø heä thoáng caûi tieán, reã caây khoâng tröïc tieáp nhuùng vaøo dung dòch dinh döôõng maø phaûi qua heä thoáng bôm phun ñònh kyø. Boä reã ñöôïc hoâ haáp toái ña. Heä thoáng naøy thích hôïp cho troàng rau vaø hoa thöông phaåm, coù theå troàng traùi vuï. Baát lôïi cuûa heä thoáng naøy laø phaûi coù ñieän lieân tuïc maùy bôm bò hö hoûng hay cuùp ñieän thì khoâng ñuû dung dòch dinh döôõng cung caáp cho caây. 2.5.2 Tình hình thuyû canh ôû Vòeât Nam Naêm 1993 Leâ Ñình Löông (GS – khoa sinh – ÑHQGHN) cuøng hôïp taùc vôùi toå chöùc R D ( Hoàng Koâng ), ñaõ nghieân cöùu vaø chuyeån giao coâng ngheä troàng thuyû canh. - 13 - Thaùng 10 naêm 1995 ñaõ phoå bieán ôû Haø Noäi, Thaønh Phoá Hoà Chí Minh, Coân Ñaûo, ôû caùc sôû coâng ngheä cuûa moät soá tænh thaønh, phaân vieän coâng ngheä sau thu hoaïch. Thieát keá vaø saûn xuaát vaät lieäu cho heä thoáng thuûy canh vaø troàng caùc loaïi caây khaùc nhau. Tuy nhieân kyõ thuaät thuûy canh naøy coøn raát môùi meû so vôùi taäp quaùn saûn xuaát cuûa noâng daân Vieät Nam, ñoàng thôøi ñaát ñai sau thu hoaïch caùc vuï chính coøn noâng nhaøn neân noâng daân saûn xuaát treân caùc vuøng ñaát ñoù cho neân ñeán hieän nay vieäc troàng thuûy canh caùc loaïi caây vaãn chöa ñöôïc phoå bieán vaø noù chæ thu heïp ôû möùc ñoä kinh teá hoä gia ñình, moät soá hoä saûn xuaát nhoû, chæ coù moät vaøi cô sôû saûn xuaát lôùn nhö coâng ty troàng rau saïch ôû Vónh Phuùc. Coøn laïi ôû caùc hoä töï troàng vaø tieâu thuï. 2.6 Caùc kyõ thuaät chaån ñoaùn beänh heùo xanh 2.6.1 Phöông phaùp nuoâi caáy treân moâi tröôøng nhaân taïo Ñaây laø phöông phaùp truyeàn thoáng ñöôïc söû duïng roäng raõi vì ñôn giaûn, ít toán keùm, tuy vaäy thôøi gian töông ñoái daøi. Treân moâi tröôøng thaïch, khoai taây, agar, peptone. Khuaån laïc coù daïng hình troøn, öôùt, maøu traéng kem. Treân moâi tröôøng TZC (Kelman, 1954) khuaån laïc coù rìa ngoaøi maøu traéng kem, ôû giöõa maøu hoàng. Treân moâi tröôøng TTC caùc khuaån laïc vi khuaån R. solanacearum thöôøng moïc sau 4 – 5 ngaøy nuoâi caáy trong khi ñoù caùc khuaån laïc khaùc thöôøng bò öùc cheá (Shurfleff, 1997). 2.6.2 Phöông phaùp huyeát thanh Phöông phaùp naøy khoâng ñoøi hoûi nhöõng trang thieát bò tinh vi, phöùc taïp, chi phí cuõng khoâng quaù cao maø chæ caàn moät trình ñoä thao taùc töông ñoái, tuy vaäy phöông phaùp naøy khoâng ñaët hieäu (Hoaøng Hoa Long, 2002). 2.6.3 Phöông phaùp chuûng treân kyù chuû Phöông phaùp naøy ñôn giaûn, ít toán keùm nhöng ñoøi hoûi toán nhieàu thôøi gian. 2.6.4 Phöông phaùp lai phaân töû Phöông phaùp naøy tính chính saùc cao tuy vaäy ñoøi hoûi trang thieát bò tinh vi, thao taùc hoaøn haûo, toán nhieàu chi phí. - 14 - 2.6.5 Phöông phaùp PCR ( polymerase Chain Reaction) PCR laø phaûn öùng toång hôïp daây chuyeàn nhôø emzyme polymerase coøn goïi laø kyõ thuaät taïo doøng DNA in vitro, phöông phaùp naøy cho pheùp khueách ñaïi soá löôïng lôùn moät ñoaïn DNA ñaëc tröng leân haøng trieäu laàn. PCR ñöôïc thöïc hieän döïa treân cô sôû phaûn öùng sinh toång hôïp DNA theo 3 trình töï. Bieán tính DNA sôïi ñoâi thaønh sôïi ñôn (denature). Phaûn öùng cuûa primer gaén vaøo ñaàu daây chuoãi maõ ñoái xöùng treân chuoãi maõ. Keùo daøi sôïi môùi nhôø primer (extension). Phaûn öùng naøy ñöôïc thöïc hieän nhôø polymerase vaø söï thay ñoåi chu kyø nhieät moät caùch hôïp lyù. Hieän nay phöông phaùp naøy ñöôïc xem nhö laø moät coâng cuï khaù höõu hieäu trong vieäc nghieân cöùu beänh caây. 2.7 Tình hình nghieân cöùu beänh heùo xanh do vi khuaån R. solanacearum Toyota vaø caùc coäng söï ñaõ khaûo saùt aûnh höôûng cuûa thuoác dieät naám 3 – (3 – indolyl) butanoic acid (IBA) leân vieäc kieåm soaùt beänh heùo xanh do vi khuaån Ralstonia solanacearum. Trong thí nghieäm nay oâng aáy ñaõ troàng caây caø chua trong heä thoáng thuyû canh hoài löu vôùi vaän toác doøng hoài löu laø 2l/s, moâi tröôøng dinh döôõng cuûa Yamazaki ñöôïc söû duïng, coù pH trong khoaûng 6.0 – 6.5, vaø EC 2.1 – 2.5ms/cm). Caây caø chua ñöôïc troàng trong heä thoáng naøy 14 ngaøy trong nhaø luôùi coù moâi tröôøng khieåm soaùt laø 28 o C. sau ñoù söû duïng vi khuaån Ralstonia solanacearum ôû daïng dòch huyeàn phuø ñeå chuûng beänh. phöông phaùp chuûng beänh theo Dogo vaø ctv (1997). Theo phöông phaùp naøy dòch huîeàn phuø ñöôïc pha ñeàu vôùi dung dòch dinh döôõng, maät soá cuoái cuøng laø 10 8 cfu/ml, vaø sau ñoù theâm vaøo hôïp chaát khaùng khuaån (IBA) vôùi noàng ñoä cuoái laø 10ug/ml, giöõ noàng ñoä ñoù suoát 2 tuaàn. Vaø theo doõi keát quaû. Cuõng Toyota vaø caùc coäng söï ñaõ nghieân cöùu söï toån thöông cuûa caùc gioáng caø chua thöông maïi troàng trong heä thoáng thuyû canh ñoái vôùi vi khuaån gaây beänh heùo xanh Ralstonia solanacearum. Trong thí nghieäm nay oâng aáy ñaõ troàng caây caø chua - 15 - trong heä thoáng thuûy canh hoài löu vôùi vaän toác doøng hoài löu laø 2l/s, moâi tröôøng dinh döôõng cuûa Yamazaki ñöôïc söû duïng, coù pH trong khoaûng 6.0 – 6.5, vaø EC khoaûng (2.1 – 2.5ms/cm). Caây caø chua ñöôïc troàng trong heä thoáng naøy 14 ngaøy trong nhaø luôùi coù moâi tröôøng kieåm soaùt laø 28 o C. Sau ñoù söû duïng vi khuaån Ralstonia solanacearum ôû daïng dòch huyeàn phuø ñeå chuûng beänh. Phöông phaùp chuûng beänh theo Dogo vaø ctv (1997). Theo phöông phaùp naøy Dòch huîeàn phuø ñöôïc pha ñeàu vôùi dung dòch dinh döôõng vôùi maät soá cuoái cuøng laø 10 8 cfu/ml. Caëp primer PI-IS-F/PI-IS-R ñöôïc thieát keá döïa treân chuoãi nucleotide ISI 405 ñaëc hieäu vôùi vi khuaån R. solanacearum thuoäc race 1. Caëp primer naøy ñöôïc duøng xaùc ñònh race cuûa vi khuaån R. solanacearum taïi Ñaøi Loan (Yung – An Lee, 2001). Theo Martin vaø French (1997), vi khuaån R. solanacearum gaây haïi treân caây caø chua, khoai taây, ôùt, caø tím, thuoác laù, göøng, ñaäu phuïng, caø phaùo Chuû yeáu thuoäc race 1. Theo Phaïm Ñaêng Minh,(2003) khi ñaùnh giaù tính ñoäc cuûa caùc doøng vi khuaån R. solanacearum treân kyù chuû caø chua, caø phaùo, caø tím, ôùt, thuoác laù, ñaäu phoäng töø 84 doøng vi khuaån keát quaû thu ñöôïc 57 doøng gaây ñoäc cho kyù chuû. Vaø baèng phöông phaùp PCR ñaõ xaùc ñònh coù 57 doøng cho saûn phaåm PCR döông tính trong 84 doøng ñoù. - 16 - CHÖÔNG 3 VAÄT LIEÄU VAØ PHÖÔNG PHAÙP NGHIEÂN CÖÙU Noäi dung A: Thieát laäp heä thoáng thuyû canh troàng caø chua 3.1 Thôøi gian vaø ñòa ñieåm 3.1.1 Thôøi gian Thí nghieäm ñöôïc thöïc hieän töø 04/2005 ñeán 08/2005. 3.1.2 Ñòa ñieåm Thí nghieäm ñöôïc tieán haønh ôû khu nhaø löôùi – Khoa noâng hoïc – tröôøng ÑH Noâng Laâm TP Hoà Chí Minh. 3.2 Vaät lieäu vaø phöông phaùp nghieân cöùu 3.2.1 Vaät lieäu vaø duïng cuï 3.2.1.1 Vaät lieäu Ñoái töôïng nghieân cöùu: 3 moâi tröôøng dinh döôõng Vaät lieäu nghieân cöùu: haït caø chua khoâng khaùng beänh heùo xanh. 3.2.1.2 Duïng cuï Söû duïng khay nhöïa coù kích thöôùc :daøi 65cm, roäng 40cm, cao 10cm, caùc taám xoáp cöùng coù kích thöôùc (daøi 35, roäng 30cm) coù loã (40 loã/taám). Moâi tröôøng giaù theå ñöôïc söû duïng laø khoái muùt coù kích thöôùc (2x2x2cm) thích hôïp vôùi caùc loã treân taám xoáp 3.2.2 Phöông phaùp nghieân cöùu 3.2.2.1 Caùch pha dung dòch dinh döôõng Nöôùc söû duïng trong pha dung dònh dinh döôõng laø nöôùc caát 1 laàn. Khoái löôïng vaø caùch pha cuûa caùc moâi tröôøng nhö sau :  Moâi tröôøng dinh döôõng A (cuûa Hoagland) Khoái löôïng caùc chaát ña löôïng pha cho 113,5 lít. - 17 - Baûng 2.1 Thaønh phaàn ña löôïng trong moâi tröôøng A Teân chaát Khoái löôïng (g) pha cho 113.5 lít KH2PO4 KNO3 Ca(NO3)2 MgSO4 14,1 56,7 85 42,5 Vì caùc nguyeân toá vi löôïng caàn vôùi soá löôïng raát nhoû caân raát khoù, neân pha dung dòch stock tröôùc roài sau ñoù söû duïng duïng dung dòch stock ñeå pha thaønh dung dòch dinh döôõng. Baûng 2.2 Thaønh phaàn vi löôïng trong moâi tröôøng A Teân chaát Soá löôïng (g) pha cho 4,54 lít stock Soá löôïng (lít) stock pha cho 113,5 lít H3BO3 MnCl2.4H2O ZnSO4.7H2O CuSO4. 5H2O FeSO4. 7H2O 28,35 14,17 28,35 14,17 42,5 0,28 O,28 0,07 0,07 0,28 Caùc nguyeân toá ña löôïng ñöôïc pha trong baèng nöôùc aám vaø pha theo thöù töï töø treân xuoáng cuûa baûng. Caùc nguyeân toá vi löông ñöôïc pha dung dòch Stock rieâng moãi chaát, sau ñoù laáy ra töø dung dòch naøy nhöõng theå tích dung dòch ñaõ cho treân baûng ñeå pha cho 113,5 lít  Moâi tröôøng dinh döôõng B Khoái löôïng caùc chaát ña löôïng pha cho 1 lít dung dòch. - 18 - Baûng 2.3 Thaønh phaàn ña löôïng trong moâi tröôøng B Teân chaát Khoái löôïng (g) pha cho 1 lít Ca(NO3)2 CaSO4 MgSO4 EDTA - Fe 0,246 O,272 0,18 0,43 Baûng 2.4 Thaønh phaàn vi löôïng trong moâi tröôøng B Teân chaát Khoái löôïng (g) pha cho 1 lít stock H3BO3 CuSO4. 5H2O EDTA – Fe MnSO4.H2O Mo7O24(NH4)6. 4H2O ZnSO4.7H2O 2,O8 0,28 5,6 5,98 0,25 3,37 Caùc nguyeân toá ña löôïng ñöôïc pha trong moät bình rieâng, caùc hoaù chaát ñöôïc cho vaøo theo thöù töï trong baûng töø treân xuoáng. Caùc nguyeân toá vi löôïng ñöôïc pha thaønh 1 lít dung dòch stock roài sau ñoù laáy ra 0,1 ml dung dòch Stock ñeå pha cho 1 lít dung dòch. Khi söû duïng thì pha chung laïi hai dung dòch naøy thaønh moät.  Moâi tröôøng dinh döôõng C Khoái löôïng caùc chaát ña löôïng pha cho 300 lít dung dòch - 19 - Baûng 2.5 Thaønh phaàn ña löôïng trong moâi tröôøng C Teân chaát Khoái löôïng (g) pha cho 300 lít KH2PO4 KNO3 Ca(NO3)2 MgSO4 52,680 193,938 265,050 121,680 Baûng 2.6 Thaønh phaàn vi löôïng trong moâi tröôøng C Teân chaát Khoái löôïng pha 1 lít Stock Fe FeSO4.7H2O EDTA MnSO4. 4H2O H3BO3 CuSO4. 5H2O ZnSO4.7H2O Na2MoO4. 2H2O CoSO4. 6H2O KI 0,05 g 25 g 35 g 4,065 g 2,864 g 0,400 g 0,900 g 0,126 g 0,100 g 0,500 g Sau khi pha stock ta laáy ra 300 ml dòch dung stock, pha cho 300 lít dung dòch dinh döôõng. 2.2.2.2 Thieát laäp heä thoáng troàng caây caø chua Öùng duïng phöông phaùp thuyû canh khoâng hoài löu ñeå thieát laäp heä thoáng naøy. Caùc haït caø chua ñöôïc laøm aåm vaø uû voâ truøng treân ñóa petri giöõ ôû nhieät ñoä phoøng. Khi haït naûy maàm khoaûng 2 – 5 mm ñem haït chuyeån vaøo nhöõng khoái muùt coù kích thöôùc 2×2×2 cm, coù khoeùt loã ôû giöõa ñeå boû haït caø chua vaøo. Sau ñoù ñem caùc khoái muùt ñoù boû vaøo trong caùc loã treân taám xoáp. Caùc dung dòch ñöôïc chuaån bò saün cho vaøo trong - 20 - caùc khay (moãi khay moät moâi tröôøng khaùc nhau), roài raùp hai taám xoáp vaøo trong moãi khay. Dung dòch trong khay phaûi ngaäp nöûa taám xoáp. Caùc khay ñöôïc ñeåû trong nhaø löôùi ôû nhieät ñoä thöôøng. 2.2.2.3 Chæ tieâu theo doõi - Theo doõi söï phaùt trieån cuûa caây caø chua treân 3 moâi tröôøng dinh döôõng khaùc nhau. - Ño chieàu cao cuûa caây caø chua sau khoaûng thôøi gian 5 ngaøy laäp laïi, sau khi troàng. Noäi dung B: ñaùnh giaù tính khaùng cuûa caây caø chua troàng trong dung dòch ñoái vôùi R. solanacearum. 2.3 Thôøi gian vaø ñòa ñieåm 2.3.1 Thôøi gian Ñeà taøi ñöôïc thöïc hieän töø 06/2005 ñeán 08/2005. 2.3.2 Ñòa ñieåm Nôi chuûng beänh: khu nhaø löôùi – Khoa Noâng hoïc – Tröôøng ñaïi hoïc Noâng Laâm TPHCM. Nôi phaân laäp vaø nuoâi caáy: phoøng thöïc taäp beänh caây – Boä moân Baûo Veä Thöïc Vaät - Tröôøng ñaïi hoïc Noâng Laâm TP Hoà Chí Minh. Nôi phaân tích: Trung taâm phaân tích thí nghieäm Hoaù Sinh Tröôøng ñaïi hoïc Noâng Laâm TP Hoà Chí Minh. 2.3 Vaät lieäu vaø phöông phaùp nghieân cöùu 2.3.1 Vaät lieäu duïng cuï 2.3.1.1 Vaät lieäu Ñoái töôïng nghieân cöùu: caây caø chua gioáng nhieãm troàng trong dung dòch thuyû canh trong noäi dung A. Vaät lieäu thí nghieäm: caùc doøng vi khuaån Ralstonia solanacearum: RST001, RST003, RST006, RSBog1, do Phaïm Ñaëng Minh (2003) phaân laäp. Vaø RSCc1, - 21 - RSCc2, RSCc3, RSCc4, do chuùng toâi phaân laäp ñöôïc treân caây kyù chuû caø chua troàng ôû Cuû Chi. Moâi tröôøng phaân laäp vaø nuoâi caáy - PDA ( potato, sucrose, agar). - TZC (peptone, Glucose, Casein hydrolysate, TZC, Agar). - LB ( Trytone, Yeast extract, sodium chloride). Caáu truùc caëp primer PI–IS- F / PI-IS-R, söû duïng trong nghieân cöùu naøy. Baûng 3.7 Trình töï primers PI-IS-F vaø PI-IS-R Primer Trình töï (5 / - 3 / ) Kích thöôùc ñoaïn DNA khueách ñaïi Nguoàn goác PI–IS- F PI-IS-R CGCAACGCTGGATGAACCC CAGACGATGCGAAGCCTGAC 1,070 bp 1,070 bp Yung-An Lee (Ñaøi Loan) Moät soà hoaù chaát, emzyme vaø dung dòch, söû duïng trong ly trích, phaûn öùng PCR vaø ñieän di. + TE 1X (pH =8) + SDS 10% ( Sodium Dodecyl Sulfate) + Taq polymerase (Bio – Rad) + Thang DNA (ladder) 1000bp (Bio – Rad) + Agarose (ultra pure DNA grade) 3.4.1.2 Duïng cuï Söû duïng caùc duïng cuï vaø trang thieát bò taïi phoøng thöïc taäp beänh caây – Boä moân baûo veä Thöïc Vaät, Trung taâm phaân tích Hoaù Sinh – Tröôøng Ñaïi Hoïc Noâng Laâm TP Hoà Chí Minh. - 22 - 3.4.2 Phöông phaùp nghieân cöùu 3.4.2.1 Phöông phaùp laáy maãu Choïn nhöõng vöôøn caây kyù chuû caø chua, vaø tieán haønh choïn nhöõng caây bò beänh ñieån hình, goùi laïi trong 2 -3 lôùp baùo, daùn nhaõn ghi roõ trieäu chöùng, nôi laáy maãu, hoï teân kyù chuû. 3.4.2.2 Phaân laäp nuoâi caáy vaø toàn tröõ maãu Maãu sau khi ñem veà, caét laáy 10 -15 cm ñoaïn thaân saùt reã, röûa saïch döôùi voøi nöôùc maùy, ngaâm trong coàn 70 0 khoaûng 10 phuùt, sau ñoù röûa laïi baèng nöôùc caát voâ truøng. Caét ñoaïn thaân treân thaønh nhöõng ñoaïn 5 – 10 cm ñaët vaøo oáng nghieäm chöùa khoaûng 5 ml nöôùc caát voâ truøng. Sau 3 – 5 phuùt, vôùt boû phaàn thaân treân, phaàn dòch tieát ra ôû beà maët veát caét goïi laø dòch thoâ. Dòch thoâ ñöôïc pha loaõng 1000 laàn vôùi nöôùc caát voâ truøng, laáy 300 ul dòch treân caáy vaøo moâi tröôøng PDA ñaõ chuaån bò saün, uû ôû nhieät ñoä 27 0 C . Sau khoaûng thôøi gian 12 giôø choïn ngaãu nhieân töøng khuaån laïc caáy treân moâi tröôøng TTC tieáp tuïc uû ôû nhieät ñoä 27 0 C. Sau 4 – 5 ngaøy tieán haønh choïn nhöõng khuaån laïc moïc sôùm (Tieáp tuïc nuoâi caáy treân moâi tröôøng LB laéc loûng (150 voøng/phuùt) ôû nhieät ñoä 27 0 C khoaûng 16 giôø. Laáy 850 ul dòch naøy cho vaøo eppendorf vaø 150 ul glycerol, troän ñeàu, caát giöõ maãu ôû -80 0 C. 3.4.2.3 Phöông phaùp xaùc ñònh Ralstonia solanacearum baèng moâi tröôøng choïn loïc TZC Moâi tröôøng TZC sau khi hoaø tan baèng nöôùc caát ñieàu chænh pH khoaûng 7,1 - 7, sau ñoù ñem voâ truøng ôû 121 0 C trong 15 phuùt. Caùc doøng vi khuaån R. solanacearum sau hai ngaøy nuoâi caáy treân moâi tröôøng LB loûng (2 ml), thu vi khuaån baèng caùch li taâm 3000 voøng/phuùt. Röûa 2 laàn baèng nöôùc caát voâ truøng. Hoøa tan vi khuaån vaøo 4 ml nöôùc caát voâ truøng laáy 10 ul cho vaøo ñóa petri coù moâi tröôøng TZC . Theo doõi trong voøng 3 – 5 ngaøy vaø ghi nhaän keát quaû. - 23 - 3.4.2.4 Phöông phaùp ly trích DNA toång soá Theo phöông phaùp cuûa Sambrook (1989), coù caûi tieán. Böôùc 1: Nhaân vi khuaån trong moâi tröôøng LB loûng khoaûng 16 giôø Böôùc 2: Thu vi khuaån baèng caùch ly taâm. Ñieàu kieän 6000 voøng, 5 phuùt, 4 0 C, boû heát phaàn dòch phía treân. Röûa vi khuaån 2 laàn baèng nöôùc caát voâ truøng Böôùc 3: Hoaø vi khuaån trong 567 ul dung dòch TE, 30ul dung dòch SDS 10%, sau ñoù uû ôû 37 0 C khoaûng 1 giôø. Böôùc 4: Cho theâm vaøo 100 ul dung dòch NaCl5M, hoaø laãn thaät kyõ. Böôùc 5: Theâm vaøo 80 ul dung dòch CTAB/ NaCl (khoaûng 1/10 theå tích). Pha troän thaät kyõ, uû ôû 65 0 C trong 10 phuùt. Böôùc 6: Theâm 780 ul dung dòch hoãn hôïp chloroform/isoamyl alcohol (24 : 1) hoøa thaät ñeàu, ly taâm 10 phuùt ôû 14000 voøng/ phuùt,4 0 C. Böôùc 7: Thu laáy dòch beân treân (dung dòch DNA) cho vaøo oáng ly taâm môùi. Böôùc 8: Chieát xuaát dung dòch DNA vôùi phenol/chloroform/isoamyl alcohol (25:24:1), cuøng theå tích vôùi dung dòch DNA. Hoøa laãn ñeàu, ly taâm 10 phuùt ôû 12000 voøng/phuùt, 4 0 C. Böôùc 9: Thu laáy dung dòch beân treân cho vaøo oáng ly taâm môùi. Keát tuûa DNA vôùi isopropanol, duøng khoaûng 0,6 theå tích cuûa dung dòch. Röûa keát tuûa vôùi ethanol 70%. Thu boû phaàn dòch beân treân giöõ laïi keát tuûa baèng caùch ly taâm. Laøm khoâ keát tuûa. Böôùc 10: Hoaø tan hoaøn toaøn DNA trong 100 ul TE. Cho theâm vaøo 1 ul dung dòch men RNAse, uû phaûn öùng ôû 37 0 C khoaûng 2 giôø. Böôùc 11: Chieát xuaát dung dòch DNA vôùi phenol/chloroform/isoamyl alcohol (25:24:1). Hoaø thaät ñeàu, ly taâm 10 phuùt ôû 12000 voøng/phuùt, 4 0 C. Böôùc 12: Thu phaàn dòch beân treân vaø chieát xuaát vôùi chloroform/isoamyl alcohol (24:1). Hoaø laãn kyõ, ly taâm 10 phuùt ôû 12000 voøng /phuùt,4 0 C. - 24 - Böôùc 13: Thu phaàn dung dòch DNA beân treân. Theâm dung dòch sodium acetate3M, pH = 5,0 vaø isopropanol. Uû 30 phuùt ôû nhieät ñoä -20 0 C, röûa keát tuûa vôùi ethanol 70%, thu keát tuûa, laøm khoâ. Böôùc 14: Hoaø tan keát tuûa trong 30 ul dung dòch TE. 3.4.2.5 Phöông phaùp PCR Phaûn öùng khueách ñaïi PCR ñöôïc thöïc hieän theo quy trình cuûa Holloway (1997), Coù caûi tieán. Theå tích phaûn öùng laø 25 ul. Thaønh phaàn cuûa phaûn öùng PCR duøng ñeå xaùc ñònh R. solanacearum. Baûng 3.8 Thaønh phaàn caùc chaát trong phaûn öùng PCR Thaønh phaàn Löôïng /phaûn öùng(ul) Noàng ñoä cuoái Nöôùc caát 10 mM dNTP / s 10 X PCR buffer MgCl2 Primer PS-IS-F Primer PS-IS-R Taq DNA polymerase (5u/ul) Template DNA Toång 18 0,5 2,5 1,5 1,1 1,2 0,2 2 25 - 200 Um 1X 1,5 uM 0,25 uM O,25 uM 0,5U - - Thieát laäp phaûn öùng theo chu trình nhòeât - Böôùc 1: 94 0 C 2phuùt; 1 chu kyø - Böôùc 2: 94 0 C 2 giaây, 50 0 C 10 giaây, 72 0 C 70 giaây, 35 chu kyø - Böôùc 3: 72 0 C 2 phuùt ; 1chu kyø - Böôùc 4: 4 0 C Kyû thuaät ñòeân di - Chuaån bò gel 1% (0,25 g agarose trong 25 ml dung dòch TAE 0,5 X ) - Söû duïng 5 ul saûn phaåm PCR ñeå kieåm tra keát quaû phaûn öùng - Chaïy ñieän di ôû 100 V, 250 mA, 30 phuùt - Nhuoäm gel vôùi ethidium bromide, 10 phuùt - 25 - - Söû duïng maùy agarose gel (treân phaàn meàn quatity one) (Bio – rad) ghi nhaän vaø ñaùnh giaù keát quaû. 3.2.2.6 Ñaùnh giaù tính khaùng cuûa caây caø chua ñoái vôùi R.solonacearum. Caùc doøng vi khuaån sau khi xaùc ñònh treân moâi tröôøng TZC vaø phöông phaùp PCR. Chuùng toâi ñaõ choïn 3 doøng vi khuaån laø RST001, RSCc2 vaø RSBog1, ñeå laøm thí nghieäm ñaùnh giaù tính khaùng cuûa caây caø chua troàng trong dung dòch. Caây caø chua troàng trong heä thoáng thuûy canh sau 14 ngaøy ñöôïc duøng ñeå chuûng beänh. Moät doøng vi khuaån chuûng trong moät heä thoáng thuyû canh rieâng vaø 3 laàn laäp cho moät doøng vi khuaån. Vaø moät heä thoáng thuyû canh duøng laøm ñoái chuùng khoâng truûng beänh. Phöông phaùp chuûng beänh theo Dogo vaø ctv(1997). Theo phöông phaùp naøy duøng vi khuaån ôû daïng huyeàn phuø cho vaøo dung dòch dinh döôõng vôùi maät soá cuoái cuøng laø 10 8 cfu/ml.ø Theo doõi keát quaû sau ñoù. Chæ tieâu theo doõi - Theo doõi sau bao nhieâu ngaøy thì xuaát hieän caây bò heùo xanh ñaàu tieân.(soá ngaøy). Theo doõi sau bao nhieâu ngaøy thì taát caû caùc caây bò heùo xanh.( soá ngaøy) - Theo doõi tyû leä cheát cuûa caây caø chua sau 14 ngaøy chuûng: TLC (%) = (A*100) /B Trong ñoù: TLC: tyû leä cheát A: soá caây cheát B: toång soá caây theo doõi 2.4.2.7 Khaû naêng sinh tröôûng vaø phaùt trieån cuûa Ralstonia solanacearum trong heä thoáng thuyû canh Caùc doøng vi khuaån R. solanacearum sau khi chuûng vaøo trong heä thoáng thuyû canh ñeå xaùc ñònh xem noù coù khaû naêng toàn taïi vaø phaùt trieån trong heä thoáng thuyû canh hay khoâng. Baèng caùch ñeám maät soá R. solanacearum sau khi chuûng vaø caùc ngaøy sau ñoù phöông phaùp ñeám maät soá vi khuaåntrong heä thoáng thuyû canh: + tieán haønh laáy 1ml dung dòch dinh döôõng thuûy canh cho vaøo eppendoff - 26 - ( moät doøng vi khuaån cho vaøo moät eppendoff ) + pha loaõng dung dòch vi khuaån ôû caùc möùc 10 3 , 10 4 , 10 5 , vôùi nöôùc voâ truøng, laéc ñeàu. + Nhoû 20ul dung dòch vi khuaån ôû moät möùc pha loaõng leân ñóa petri, vôùi 3 laàn laäp laïi cho moät möùc pha loaõng, 3 möùc pha loaõng / ñóa + Chôø dòch vi khuaån khoâ, cho ñóa petri vaøo tuû ñònh oân ôû 27 0 C. + Sau 1 ngaøy ñeám soá khuaån laïc moïc treân moâi tröôøng TZC, choïn möùc pha loaõng thích hôïp cho vieäc ñeám khuaån laïc. Tính maät soá vi khuaån CFU/ml. - 27 - CHÖÔNG4. KEÁT QUAÛ VAØ THAÛO LUAÄN Noäi dung A: thieát laäp heä thoáng thuyû canh troàng caø chua 4.1 Choïn loïc moâi tröôøng thích hôïp cho cho caây caø chua troàng thuyû canh Sau khi troàng thí nghieäm 3 loaïi moâi trröôøng treân heä thoáng thuyû canh naøy vaø theo doõi. keát quaû thu ñöôïc laø: Ñoái vôùi moâi tröôøng dinh döôõng A thì haït caø chua khoâng moïc ñöôïc maø bò thoái ñen. Theo chuùng toâi quan saùt ñöôïc thì trong dung dòch coù hieän töôïng bò keát tuûa sau moät thôøi gian (môùi pha khoâng coù hieän töôïng naøy). Vì vaäy, theo chuùng toâi thì coù theå caùc thaønh phaàn cuûa caùc nguyeân toá ña löôïng khoâng caân baèng neân daãn ñeán keát quaû naøy. Ñoái vôùi moâi tröôøng dinh döôõng B thì ban ñaàu haït moïc ñöôïc leân ñeán khoaûng 9 cm thì caây khoâng phaùt trieån nöõa, thaân caây nhoû, laù khoâng phaùt trieån, moãi caây chæ coù 4 laù. Theo chuùng toâi trong thaønh phaàn dinh döôõng cuûa moâi tröôøng naøy bò thieáu moät chaát naøo ñoù (coù theå laø phospho) laøm cho caây khoâng phaùt trieån ñöôïc. Ñoái vôí moâi tröôøng dinh döôõng C thì haït caø chua moïc leân ñöôïc vaø phaùt trieån toát nhaát trong 3 moâi tröôøng dinh döôõng. Keát quaû ño chieàu cao caây vôùi khoaûng caùch sau 5 ngaøy nhö sau. - 28 - Baûng 4.1 Keát quaû ño chieàu caây cao caø chua sau 5 ngaøy troàng Haøng Chieàu cao (cm) caây qua caùc laàn laäp laïi (LLL) LLL1 LLL2 LLL3 LLL4 LLL5 LLL6 LLL7 LLL8 TB H1 3,5 3 3,5 3,2 3,2 3 3 3,5 3,24 H2 2,5 3 3 3,5 2,5 2,5 2,5 3 2,81 H3 2,5 2,5 3,5 3,2 3 3,5 3 3,2 3,05 H4 3,5 3 2,5 2,5 3 3,5 3,2 3 3,02 H5 2,5 3 3 3,5 3,2 3,5 3 3,2 3,11 H6 3,5 3,5 3 2,5 3,2 3 3,5 3,2 3,17 H7 3 3 2,5 3,5 3,2 3,2 3 3,5 3,11 H8 2,5 3 3 3,5 3,2 3,5 3 3,5 3,15 H9 3, 2,5 3 3 3,5 3,5 3,2 3 3,46 H10 2,5 3,5 3 3 3,5 2,5 3 3 3 Baûng 4.2 Keát quaû ño chieàu caây cao caø chua sau 10 ngaøy troàng Haøng Chieàu cao (cm) caây qua caùc laàn laäp laïi (LLL) LLL1 LLL2 LLL3 LLL4 LLL5 LLL6 LLL7 LLL8 TB H1 5,5 5 5,5 5,5 5 5 5 5,5 5,25 H2 5 5 5 5,5 4,5 4,5 5 5 4,94 H3 4,5 5,5 5,5 5 5 6 5 5 5,25 H4 5,5 5 4,5 5 4,5 4 5 5 4,88 H5 4 5 5 5,5 5,5 5,5 4,5 5,5 5,06 H6 5,5 5,5 5,5 5,5 5 5,5 5 5 5,39 H7 5 5 4,5 5 5 5 5 5 4,94 H8 4,5 5,5 4,5 5 4 5,5 5 4,5 4,81 H9 4 5 5 4,5 4,5 5,5 5 4,5 4,69 H10 5 4,5 4 5 5 4,5 5 4,5 4,69 - 29 - Baûng 4.3 Keát quaû ño chieàu caây cao caø chua sau 15 ngaøy troàng Haøng Chieàu cao (cm) caây qua caùc laàn laäp laïi (LLL) LLL1 LLL2 LLL3 LLL4 LLL5 LLL6 LLL7 LLL8 TB H1 9 8 9,5 10 8 9 9 9,5 9 H2 9 8,5 9,5 8,5 8,5 8,5 9 9 8,82 H3 8 9,5 10 10 8 10 8,5 9,5 9,31 H4 8,5 7,5 7,5 9 8 9 8 9,5 8,37 H5 8 8 8 8 9 9,5 8 10 8,31 H6 10 9 9 9,5 9 9 9 8,5 8,125 H7 8,5 8 7,5 8 8 9 8,5 8,5 8,25 H8 8 9 8,5 9 8,5 9 8 8 8,5 H9 7,5 8,5 8,5 8 7,5 8 9 8 8,12 H10 8 8 8 9 9,5 8 8,5 8,5 8,18 Baûng 4.4 Keát quaû ño chieàu caây cao caø chua sau 20 ngaøy troàng Haøng Chieàu cao (cm) caây qua caùc laàn laäp laïi (LLL) LLL1 LLL2 LLL3 LLL4 LLL5 LLL6 LLL7 LLL8 TB H1 16 16 18 18,5 15 15 17 17 17,56 H2 17 17 18 17 18 16 16,5 18 17,06 H3 16 19 19 18,5 15,5 19 16 18 17,62 H4 17 15 16 18 17 18,5 18 19 17,31 H5 17 16,5 15 16 16,5 18 18 20 17,65 H6 19,5 18 16 17 17 17 17,5 17 17,37 H7 16,5 18 17 18 17 19 18 17 17,56 H8 17 18 18 17,5 18 17 18 17,5 17,62 H9 15 16 18 17,5 15,5 16 18 16,5 17,81 H10 16,5 16 18 18 19 18,5 18 18 17,75 - 30 - Baûng 4.5 Keát quaû ño chieàu caây cao caø chua sau 25 ngaøy troàng Haøng Chieàu cao (cm) caây qua caùc laàn laäp laïi (LLL) LLL1 LLL2 LLL3 LLL4 LLL5 LLL6 LLL7 LLL8 TB H1 25 26,5 27 27 24 25 26 26 25,81 H2 27 27 27 26,5 27 25 26 27,5 26,37 H3 26,5 28 27,5 28 24 29 25 27 26,78 H4 26,5 26 25 27 27 28 27 28 26,81 H5 28 28 24 24,5 25 27 27 29 26,56 H6 28,5 27 25 26 26 26,5 26 26 27 H7 26 27,5 25,5 26,5 26 28 27,5 26 26,65 H8 26,5 27 27 26 27 26 27 26 26,31 H9 25 26 27 26,5 24 26 27 25 25,81 H10 27 26 27,5 27 28,5 27 27 27 27 Baûng 4.6 Keát quaû ño chieàu caây cao caø chua sau 30 ngaøy troàng Haøng Chieàu cao (cm) caây qua caùc laàn laäp laïi (LLL) LLL1 LLL2 LLL3 LLL4 LLL5 LLL6 LLL7 LLL8 TB H1 37 38 39 39 34 34 37 38 37 H2 39,5 39 40 39 39,5 36 36 40 38,62 H3 38 40 39 40 35 42 36,5 39 38,68 H4 39 39 37 40 35 42 39,5 41 39,06 H5 40,5 40 34 35 36 39 39,5 42 38,25 H6 41 40 36,5 37 37 39 38,5 42 38,87 H7 39 40 36 38 37 38 40 39 38,4 H8 39 40 40 39 40 39,5 40 39 39,56 H9 35 37 39 38 35 37 39 36 36,75 H10 39 38,5 40 40 42 39 39 41 39,81 - 31 - Nhö vaäy, qua quaù trình choïn loïc caùc moâi tröôøng dinh döôõng ñeå troàng caây caø chua trong heä thoáng thuyû canh, chuùng toâi ñaõ choïn ñöôïc moâi tröôøng C (coù thaønh phaàn neâu ôû baûng 3.5 vaø baûng 3.6 ). Keát quaû ghi nhaän cuï theå ngoaøi nhaø löôùi cho thaáy caây phaùt trieån ñoàng ñeàu, maïnh khoeû khoâng coù daáu hieäu thieáu dinh döôõng. Tuy nhieân trong quaù trình troàng caø chua trong dung dòch caàn chuù yù moät soá ñieåm sau: + Dung dòch pha phaûi hoaø tan hoaøn toaøn. + Haït caø chua khi naåy maàm, ñöôïc ñaët caån thaän vaøo mieáng muùt, traùnh hieän töôïng dung dòch dinh döôõng ngaäp maàm caø chua. + Khi caây baét ñaàu phaùt trieån maïnh caàn chuù yù ñieàu kieän nhieät ñoä, aùnh saùng, kieåm tra vaø theâm dung dòch dinh döôõng thöôøng xuyeân. Hình 4.1 Caø chua troàng trong dung dòch dinh döôõng C sau 20 ngaøy. Hình 4.2 Caø chua troàng trong dung dòch dinh döôõng C sau 30 ngaøy, söï phaùt trieån cuûa reã toát vaø khoâng coù trieäu chöùng beänh. a b - 32 - Hình 4.1 vaø Hình 4.2 cho thaáy caây caø chua trong heä thoáng thuyû canh vôùi moâi tröôøng dinh döôõng laø dung dòch C vaø Keát quaû ño chieàu cao caây cho thaáy caây caø chua phaùt trieån toát treân moâi tröôøng naøy, söï hình thaønh reã laø bình thöôøng, khoâng coù daáu hieäu bò beänh. Noäi Dung B: ñaùnh giaù tính khaùng cuûa caây caø chua troàng trong dung dòch ñoái vôùi R. solanacearum. 4.2 Keát quaû phaân laäp, toàn tröõ maãu Theo phöông phaùp phaân laäp vaø toàn tröõ maãu ñöôïc trình baøy ôû muïc 3.4.2.1 vaø 3.4.2.2, chuùng toâi ñaõ tieán haønh phaân laäp vaø choïn loïc ñöôïc 4 doøng treân caây caø chua ôû ñòa baøn huyeän Cuû Chi thaønh phoá Hoà Chí Minh. Maãu sau khi phaân laäp ñöôïc tröõ trong moâi tröôøng LB loûng coù boå sung glycerol 70% theo tæ leä theå tích laø 850 l dòch nuoâi caáy: 150 l glycerol vaø tröõ ôû -80 o C. 4.3 Keát quaû choïn loïc treân moâi tröôøng TZC phöông phaùp xaùc ñònh vi khuaån R. solanacearum döïa vaøo caùc phaûn öùng sinh hoaù thöôøng ñôn giaûn, ít toán keùm. Moâi tröôøng thöôøng ñöôïc söû duïng ñeå phaân tích laø moâi tröôøng TTC vaø moâi tröôøng TZC (Shurfleff, 1997). Trong thí nghieäm naøy söû duïng moâi tröôøng TZC, keát quaû ghi nhaän trong baûng 4.7. Baûng 4.7 Keát quaû choïn loïc vi khuaån treân moâi tröôøng TZC Teân vi khuaån Keát quaû choïn loïc RST001 RST003 RST006 RSBog1 RSCc1 RSCc2 RSCc3 + + + - - + - - 33 - Keát quaû coù 4 doøng RST001, RST003, RST006, RSCc2. laø caùc doøng ñoäc vaø caùc doøng RSBog1, RSCc1, RSCc3. laø caùc doøng khoâng ñoäc. Treân moâi tröôøng TZC coù theå xaùc ñònh ñöôïc caû doøng vi khuaån R. solanacearum ñoäc vaø khoâng ñoäc. Caùc doøng vi khuaån R. solanacearum ñoäc thöôøng cho khuaån laïc coù rìa ngoaøi maøu traéng kem, ôû giöõa maøu hoàng coøn caùc doøng vi khuaån R. solanacearum khoâng ñoäc thì khuaån laïc chæ coù maøu hoàng, khuaån laïc thöôøng moïc sau 3 – 5 ngaøy nuoâi caáy. Hình 4.3 Vi khuaån R.solanacearum moïc treân moâi tröôøng TZC sau 4 ngaøy nuoâi caáy ôû 27 o C (a) Khuaån laïc R.solanacearum doøng khoâng ñoäc treân moâi tröôøng TZC. (b) Khuaån laïc R.solanacearum doøng ñoäc treân moâi tröôøng TZC. Ghi chuù (+) cho khuaån laïc ôû rìa ngoaøi coù maøu traéng ôû giöõa maøu hoàng (doøng ñoäc) (-) cho khuaån laïc chæ coù maøu hoàng ñaäm (doøng khoâng ñoäc). 4.4 Keát quaû kieåm tra baèng phöông phaùp PCR caëp primer PS-IS-F/PS-IS-R ñöôïc thieàt keá döïa treân chuoãi nucleotide IS1405 ñaët hieäu vôùi vi khuaån R. solanacearum thuoäc race 1. Khuaån laïc khoâng ñoäc Khuaån laïc ñoäc a b - 34 - Baûng 4.8 Keát quaû xaùc ñònh R. solonacearum baèng phöông phaùp PCR. Doøng vi khuaån Keát quaû chaïy PCR RST001 RST003 RST006 RSBog1 CCCC2 + + + - + Ghi chuù: (+) phaûn öùng PCR döông tính (-) phaûn öùng PCR aâm tính Keát quaû phaûn öùng PCR vôùi caëp primers PI-IS-F/PI-IS-R cuûa caùc doøng RST001, RST003, RST006, RSBog1, CCCC2 Hình 4.4 Keát quaû kieåm tra baèng phöông phaùp PCR Theo Martin vaø french (1997), vi khuaån R. solanacearum gaây haïi treân caø chua, khoai taây, ôùt, caø tím, thuoác laù, caø phaùo, chuû yeáu thuoäc race 1. töø keát quaû naøy chuùng ta coù theå laáy caùc doøng vi khuaån R. solanacearum coù phaûn öùng PCR döông tính, ñöôïc xem nhö laø caùc doøng R. solanacearum ñoäc, vaø caùc doøng coù phaûn öùng 1 2 3 4 5 6 (1) Ladder 100bp, (2) RST001, (3) RST003, (4) RST006, (5) RSBog1, (6) CCCC2, moãi maãu ñieän di 5 l saûn phaåm, ñieän di ôû 50V, 250mA, trong 60 phuùt. - 35 - PCR aâm tính, laø caùc doøng R. solanacearum khoâng ñoäc. Duøng xaùc dònh tính khaùng beänh heùo xanh cuûa caây caø chua. 4.5 Ñaùnh giaù tính khaùng cuûa caây caø chua ñoái vôùi R.solonacearum. Sau khi chuûng beänh vaø tieán haønh theo doõi bieåu hieän trieäu chöùng beänh, chuùng toâi ghi nhaân chöa coù trieäu chöùng heùo xanh xuaát hieän sau khi chuûng 14 ngaøy. Theo Toyoda vaø ctv (2001) caùc doøng caø chua thöông maïi khi troàng trong heä thoáng thuûy canh thöôøng xuaát hieän heùo xanh trong khoaûng 5 -9 ngaøy sau khi chuõng vi khuaån Ralstonia solanacearum. Theo Phaïm Ñaêng Minh (2003) thì 57 doøng vi khuaån R .solonacearum. gaây cheát heùo xanh treân caây kyù chuû caø chua ñieàu cho phaûn öùng döông tính khi chaïy PCR vôùi caëp primers PI-IS-F/PI-IS-R. Nhö vaäy trieäu chöùng heùo xanh chöa xuaát hieän sau 14 ngaøy chuûng trong thí nghieäm cuûa chuùng toâi, coù theå laø do chöa tìm ñöôïc maät soá chuûng ban ñaàu thích hôïp, hoaëc caùc doøng vi khuaån ñem chuûng coù tính ñoäc thaáp. 3.6 Xaùc ñònh maät soá vi khuaån R. solanacearum trong heä thoáng thuyû canh Qua thí nghieäm ñaùnh giaù tính khaùng, ñeå bieát ñöôïc caùc doøng vi khuaån ñöôïc chuûng coù khaû naêng sinh tröôûng vaø phaùt trieån trong heä thoáng thuûy canh hay khoâng, chuùng toâi ñaõ tieán haønh ñeám maät soá vi khuaån R. solanacearum sau khi chuûng vaø keát quaû thu ñöôïc nhö sau. Baûng 3.12 maät soá vi khuaån coù trong 1ml dung dòch dinh döôõng Doøng vi khuaån Khi chuûng (cfu/ml) 2NST 3NST 4NST RST001 RSCc2 RSBog1 Ñoái chöùng 2,75x10 8 2,25x10 8 2,55x10 8 0,00 1,215x10 11 0,165x10 11 0,98x10 11 0,00 1,63x10 14 0,65x10 14 0,965x10 14 0,00 0,765x10 16 0,415x10 16 0,55x10 16 0,00 - 36 - Nhö vaäy taát caû caùc doøng vi khuaån ñem chuûng beänh ñeàu coù khaû naêng sinh tröôûng vaø phaùt trieån trong dung dòch dinh döôõng thuyû canh. vì vaäy coù theå söû duïng heä thoáng vaø dung dòch naøy ñeå ñaùnh giaù tính khaùng beänh heùo xanh cuûa caây caø chua. - 37 - Chöông 5 KEÁT LUAÄN VAØ ÑEÀ NGHÒ 5.1 Keát luaän Noäi dung A: thieát laäp heä thoáng thuyû canh troàng caø chua Qua quaù trình troàng thöû nghieäm caø chua baèng heä thoáng thuyû canh ñaõ thieát laäp ôû phaàn treân vôùi 3 moâi tröôøng dinh döôõng khaùc nhau. Chuùng toâi ñaõ choïn ñöôïc moät moâi tröôøng thích hôïp cho söï phaùt trieån cuûa caây caø chua laø moâi tröôøng dinh döôõng C, vaø thieát laäp ñöôïc heä thoáng thuyû canh maø caây caø chua coù theå phaùt trieån bình thöôøng treân moâi tröôøng dinh döôõng ñoù, heä thoáng thuyû canh naøy laø heä thoáng thuyû canh khoâng hoài löu. Noäi Dung B: ñaùnh giaù tính khaùng cuûa caây caø chua troàng trong dung dòch ñoái vôùi R solanacearum. Vôùi caùc thí nghieäm veà xaùc ñònh R .solonacearum. doøng ñoäc vaø doøng khoâng ñoäc treân moâi tröôøng TZC, kieåm tra R .solonacearum baèng phöông phaùp PCR, vaø chuûng beänh. Böôùc ñaàu keát luaän: + Ralstonia solanacearum coù doøng gaây ñoäc treân caây kyù chuû caø chua, coù doøng khoâng gaây ñoäc. + caùc doøng gaây ñoäc treân caây kyù chuû caø chua thöôøng cho phaûn öùng PCR ñaët hieäu khi chaïy PCR baèng caëp primers PI-IS-F/PI-IS-R. vôùi moät band ñaëc hieäu 1,070 kb. + Ralstonia solanacearum coù theå sinh tröôûng vaø phaùt trieån ñöôïc treân moâi tröôøng dinh döôõng C. + chöa tìm ñöôïc maät soá vi khuaån chuûng thích hôïp. - 38 - 5.2 Ñeà nghò Tieáp tuïc phaùt trieån heä thoáng thuyû canh naøy thaønh heä thoáng thuyû canh hoài löu, Xem ñoái vôùi heä thoáng thuûy canh hoài löu thì coù aûnh höôûng nhö theá naøo ñeán söï phaùt trieån cuûa caây caø chua vaø khaû naêng khaùng beänh heùo xanh do Ralstonia solanacearum. so vôùi heä thoáng thuyû canh naøy Tieáp tuïc nghieân cöùu xem coù phaûi gen gaây ñoäc cuûa Ralstonia solanacearum..laø naèm treân ñoaïn cho saûn phaåm PCR ñaët hieäu vôùi caëp primer PI-IS-F/PI-IS-R. baèng heä thoáng thuyû canh naøy. Söû duïng heä thoáng naøy ñeå troàng thöû nghieäm caây caø chua cho saûn phaåm thu hoaïch. - 39 - CHÖÔNG 6 TAØI LIEÄU THAM KHAÛO 6.1 Tieáng Vieät. 1. Mai Thò Phöông Anh, 1999. kyõ thuaät troàng moät soá loaïi rau cao caáp. Nhaø xuaát baûn Noâng nghieäp, Haø Noäi, 155 trang. 2. Phaïm Hoàng Cuùc, 2002. kyõ thuaät troàng caø chua. Nhaø xuaát baûn Noâng nghieäp, Tp. Hoà Chí Minh, 51 trang. 3. Ñoã Taán Duõng, 2001. Beänh heùo ruõ haïi caây troàng caïn, bieän phaùp phoøng choáng. Nhaø xuaát baûn Noâng Nghieäp, Haø Noäi, 78 trang. 4. Hoà Huyønh Thuyø Döông, 1998. Sinh hoïc phaân töû. Nhaø xuaát baûn giaùo duïc, 301 trang. 5. Nguyeãn Vaên Heát, 1997. Khaûo saùt beänh cheát heùo caây ñaäu phuïng do vi khuaån Ralsronia solanacearum ôû huyeän Cuû Chi – Tp Hoà Chí Minh. Luaän aùn thaïc só Noâng Nghieäp. Ñaïi Hoïc Noâng Laâm Tp. Hoà Chí Minh ( chöa xuaát baûn). 6. Voõ Thò Thu Lan, 2002. Sinh hoïc phaân töû. Nhaø xuaát baûn Noâng nghieäp, Haø Noäi, 105 trang. 7. Kiraly Z,.Klement Z., Solymesy F., 1987. Nhöõng phöông phaùp nghieân cöùu beänh caây (Vuõ Khaùc Nhöôøng, Haø Minh Trung dòch). Nhaø xuaát baûn Noâng nghieäp, 80 trang. 8. Phaïm Thò Toá Lieân, 2002. Tìm hieåu moâi tröôøng dinh döôõng khoaùng cho caây caûi soong (Nasturtium officinale) baèng phöông phaùp troàng thuyû canh. Khoaù luaän cöû nhaân khoa hoïc, ngaønh sinh hoïc, Tröôøng Ñaïi Hoïc Khoa Hoïc Töï Nhieân Tp. Hoà Chí Minh. 9. Phaïm Ñaêng Minh, 2003. Caáu truùc quaàn theå vi khuaån Ralstonia solanacearum gaây haïi treân caây troàng ôû moät soá tænh phía nam Vieät Nam. Luaän vaên toát nghieäp kyû sö noâng nghieäp, . Ñaïi Hoïc Noâng Laâm Tp. Hoà Chí Minh ( chöa xuaát baûn). - 40 - 6.2Tieáng nöôùc ngoaøi 10.Yung – An L. anh Chi – Chung W.,2000. The design of specific primers for the detetion of Ralstonia solanacearum in soil samples by polymerase chain reaction. Botanical Bullentin of Academia Sinica 41:121 – 128. 11 .FOA, 1990. Soilless culture for horticulural crop production. 12 .Dr B L Ho, 2000. Hydroponics simplified. 13. Seal, S. anh Robinson – Smith, A,1999. Bacterial Wilt laboratory detection of Ralstonia (Pseudomonas) solanacearum. chatham, UK: Natural Resources Institute. 14. Nonomura T., Matsuda Y., Tsuda M., Uranaka K.,Toyoda H, 2001. Succeptibility of commercial tomato cultivars to bacterial wilt in hydroponic system.j. Gen. plant pathol. 67 : 224 – 227 . 15. Nonomura T., Matsuda Y.,Bingo M., Onishi M., Matsuda K., Harada S., Toyoda H.,2001. Algicidal effect of 3 – (3 – indolyl)butanoic acid, a control agent of bacterial wilt pathogen, Ralstonia solanacearum. Crop protection 20 : 935 – 939. 16. Forster H., Adaskaveg J. E., Kim D.H., Stanghellini M. E., 1998. Effect of phosphite on tomato and pepper plants and on susceptibility of pepper to phytophthora Root and crown rot in hydroponic culture. Plant Disease 1165 – 1170. 6.3 Internet http:/ www. Hydroponics. Com. http:/ www. Ralstonia solanacearum. com - 41 - CHÖÔNG 7 PHUÏ LUÏC Khoái löôïng phaân töû cuûa moät soá hoaù chaát söû duïng - Tris HCl (pH = 8): 157,64 g/mol - Na2EDTA; 372,24 G/MOL - SDS (Sodium Dodecyl Sulfate): 288,38 g/mol - MgCl2. 6H2O: 203,3 g/mol - NaCl: 5M - Taq DNA polymerase: 94 Kda Hoaù chaát, enzyme duøng trong ly trích DNA toång soá - TE 1X (PH = 8) - Tris HCl 10 mM - Na2EDTA 0,1 mM - nöôùc caát 2 vöøa ñuû - SDS 10%(Sodium Dodecyl Sulfate) - proeinase K 20 mg/ml - NaCl: 5M - RNAse 20mg/ml Hoaù chaát cho phöông phaùp PCR - Taq DNA polymerase (0,5 UI/ phaûn öùng) - primer F 0,25 u M/phaûn öùng - primer R 0,25 u M /phaûn öùng - DNA 1 ng/phaûn öùng - PCR buffer 10 X/ phaûn öùng - dNTP 200 uM/phaûn öùng - 42 - Hoaù chaát cho ñieän di - Agarose 1% - dung dòch Ethidium bromide - TAE + Tris ACETIC 0,9 M + Na2EDTA 20 mM - Loadding dye + Bromophenol blue 0,25 % + Sucrose 40% + Nöôùc caát voâ truøng vöøa ñuû

Các file đính kèm theo tài liệu này:

  • pdfthanh le.pdf
  • docmuc luc.doc
  • doctrang bia.doc
  • docTRANG TUA.doc
Luận văn liên quan