Nghiên cứu biểu hiện gen mã hóa chất hoạt hóa plasminogen mô của người trong vi khuẩn Echerichia Coli

1. Đã tạo được hai vector biểu hiện pGEX6p1 và pET21a(+) mang cDNA mã hóa h-tPA có kích thước khoảng 1,7kb. 2. Đã xác định trình tự nucleotide của cDNA mã hóa h-tPA. So sánh trình tự nucleotide của cDNA mã hóa h-tPA với trình tự gen trên Ngân hàng Gen Quốc tế, mã số NM_000930 cho thấy độ tương đồng đạt 99%. So với NM_000930, trình tự cDNA nghiên cứu không có sự thay đổi nào đáng kể, chỉ có một sai khác nằm ở vị trí 499 của cDNA mã hóa h-tPA. Ở trình tự NM_000930, vị trí 499 nucleotitde này là C được thay thế bằng nucleotide T. Tuy nhiên, sự khác biệt này không làm thay đổi trình tự acid amin, vì vậy không ảnh hưởng tới cấu trúc và chức năng của protein. 3. Đã tiến hành biểu hiện cDNA mã hóa h-tPA trên hai vector pGEX6p1 và pET21a(+) và thu được protein h-tPA khi biểu hiện trong vector pGEX6p1.

pdf65 trang | Chia sẻ: lylyngoc | Ngày: 26/12/2013 | Lượt xem: 1999 | Lượt tải: 1download
Bạn đang xem nội dung tài liệu Nghiên cứu biểu hiện gen mã hóa chất hoạt hóa plasminogen mô của người trong vi khuẩn Echerichia Coli, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
quá trình xử lý được trình bày ở mục 2.2.4. Phản ứng được kiểm tra bằng điện di trên gel agarose 0,8%. 3.1.2.2. Xử lý vector pGEX6p1 và pET21a(+) bằng enzyme hạn chế Sau khi nghiên cứu tài liệu và điều kiện vật chất phòng thí nghiệm, chúng tôi đã tiến hành biểu hiện protein h-tPA trên vi khuẩn E. coli chủng BL21 với hai vector biểu hiện là pET21a(+) và pGEX6p1 mang cDNA mã hóa h-tPA. Vector pET21a(+) là vector mạnh để tạo dòng và biểu hiện protein tái tổ hợp trong E. coli. Gen đích được tạo dòng trong plasmid pET21a(+) được điều khiển bởi tín hiệu dịch mã tốt của phage T7, biểu hiện dưới sự tổng hợp của T7 RNA polymerase trong tế bào chủ. Vector pET21a(+) là vector mang trình tự T7 ở đầu N và trình tự đuôi His ở đầu C. Vector này mang chỉ thị chọn lọc là gen kháng kháng sinh (kháng Amp và Kanamycin). Vùng tạo dòng/ biểu hiện được điều khiển bởi T7 polymerase. Trình tự này được xác định, giải trình tự khi sử dụng mồi đầu T7. Hệ thống biểu hiện này được cảm ứng bởi IPTG hoặc lactose trong quá trình nuôi cấy. Vector pGEX6p1 điều khiển tổng hợp protein ngoại lại bởi promoter tac, promoter này được cảm ứng bởi isopropyl b-D thiogalactoside (IPTG). Vector pGEX6p1 được thiết kết gồm có một gen lacIq, sản phẩm gen lacIq là protein ức chế kết hợp với vùng operator trên promoter tac, làm ngăn cản quá trình biểu hiện cho tới khi cảm ứng bởi IPTG, qua đó điều khiển quá trình biểu hiện của gen được thêm vào. Đầu 3’ vùng đa nối có chứa đoạn gen mã hoá Glutathione S- Transferase - GST, đây là một protein giúp quá trình tinh sạch protein tái tổ hợp dễ hơn. Ngoài ra, vector pGEX6p1 có một số ưu điểm như: mức độ biểu hiện cao, điều kiện tinh sạch protein đơn giản, ảnh hưởng của kháng nguyên và chức năng của protein là nhỏ nhất. Quá trình cắt mở vòng hai vector cũng sử dụng hai cặp enzyme là NdeI/XhoI và BamHI/XhoI tương tự như đối với sản phẩm PCR. Thành phần và quá trình xử lý đối với vector pET21a(+) và pGEX6p1 được trình bày ở phần 2.2.4. Sau khi cắt với enzyme, vector được xử lý với phosphatase để loại nhóm phosphate ra khỏi đầu 5’, làm giảm quá trình tự nối của vector. Phản ứng được kiểm tra bằng điện di trên gel agarose 0,8%. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 32 Hình 3.2. Kết quả xử lý cDNA mã hóa h-tPA và các vector biểu hiện bằng enzyme hạn chế Kết quả điện di trên hình 3.2 cho thấy sản phẩm cắt tương đối sạch và đủ điều kiện tiến hành phản ứng ghép nối. 3.1.2.3. Ghép nối cDNA mã hoá h-tPA vào vector pGEX6p1 và pET21a(+) Chúng tôi đã tiến hành ghép nối cDNA mã hóa h-tPA với các vector pET21a(+) và pGEX6p1 tạo các vector tái tổ hợp mang gen mã hoá h-tPA. Do cả sản phẩm PCR và vector đều đã được xử lý bằng hai enzyme tương ứng nên dưới tác dụng của enzyme T4 ligase, sản phẩm PCR và vector có thể nối lại với nhau tạo vector tái tổ hợp. Thành phần và phản ứng ghép nối giữa vector và sản phẩm PCR đã trình bày ở phần 2.2.5. Phản ứng ghép nối được tiến hành ở 16oC, qua đêm. 3.1.3. Chọn dòng pGEX6p1 và pET21a(+) chứa cDNA mã hoá h-tPA 3.1.3.1. Biến nạp sản phẩm lai vào tế bào E. coli bằng phƣơng pháp sốc nhiệt Sản phẩm lai giữa vector và sản phẩm PCR được biến nạp vào tế bào E. coli chủng DH5α bằng phương pháp sốc nhiệt trong 70 giây ở 42oC. Các tế bào này sau đó được nuôi cấy trên môi trường LB đặc có bổ sung Amp (50g/ ml) ở 37°C qua M: Marker 1kb 1: Vector pGEX6p1/BamHI+XhoI 2: Vector pET21a(+)/NdeI+XhoI 3: cDNA h-tPA/NdeI+XhoI 4: cDNA h-tPA/BamHI+XhoI Formatted: Font: 13 pt, Do not check spelling or grammar Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 33 đêm. Kết quả, chúng tôi đã thu được rất nhiều khuẩn lạc, là các dòng tế bào vi khuẩn khác nhau. Do trong môi trường có chất kháng sinh nên chỉ có những khuẩn lạc nào mang vector mới mọc được, các dòng tế bào vi khuẩn này gồm 2 loại tế bào khác nhau: tế bào mang vector nhưng không mang đoạn chèn và tế bào mang vector và đoạn chèn. Vì vậy để xác định dòng tế bào nào mang vector tái tổ hợp, chúng tôi đã tiến hành sàng lọc thông qua tách chiết plasmid, xử lý bằng enzyme hạn chế, PCR và xác định trình tự. 3.1.3.2. Chọn dòng pGEX6p1 và pET21a(+) chứa cDNA mã hoá h-tPA  Tách chiết DNA plasmid Plasmid được tách chiết nhằm xác định vector nào mang đoạn chèn và vector nào không mang đoạn chèn. Phương pháp tách plasmid được trình bày ở mục 2.2.7. Để tách chiết DNA plasmid, một số khuẩn lạc được nuôi cấy trong môi trường LB lỏng có bổ sung Amp ở 37oC từ 12- 14h. Phương pháp tách chiết plasmid gồm 3 bước chính: thu nhận và phân giải tế bào, làm sạch plasmid và kết tủa DNA. Dung dịch I (sol I) có tác dụng rửa sạch tế bào, dung dịch II (sol II) có chứa SDS và NaOH có tác dụng phá màng tế bào và ức chế hoạt động của nuclease, không cho chúng phân giải DNA do Mg2+ (một nhân tố cần thiết cho hoạt động của các nuclease) bị liên kết với EDTA, khi cho tiếp dung dịch III (sol III) có chứa axetate và axetic acid thì pH môi trường chuyển thành acid yếu gần với điểm đẳng điện của DNA, vì vậy, DNA plasmid dễ bị kết tủa bằng cồn và dễ dàng tách được nhờ ly tâm. Do trong tế bào vi khuẩn có chứa hai dạng DNA là DNA nhiễm sắc thể và DNA plasmid nên việc tách và tinh sạch DNA plasmid là rất quan trọng, DNA plasmid được tách riêng dựa trên sự khống chế thời gian xử lý các dụng dịch I, II, III. Do DNA nhiễm sắc thể có kích thước phân tử lớn và liên kết chặt chẽ với protein nên khoảng thời gian ngắn giữa các lần thêm dung dịch không kịp thoát ra ngoài. DNA plasmid thu được sau khi tách chiết từ tế bào vi khuẩn thường tồn tại ở 3 dạng: dạng siêu xoắn được tạo ra do liên kết hydro giữa một số phần của phân tử DNA plasmid hay do lực hút tĩnh điện giữa các phần của phân tử với nhau, dạng vòng mở do bị đứt gãy một mạch đơn của chuỗi DNA mạch kép và dạng mạch Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 34 thẳng khi cả hai mạch DNA dều bị đứt gãy. Dạng siêu xoắn có cấu trúc không gian gọn nên khi điện di chúng thường chạy nhanh nhất, tiếp đến là mạch thẳng và cuối cùng là mạch vòng. DNA sau đó được hoà tan trong dung dịch RNase 0,01mg/ml nhằm loại bỏ RNA và được điện di kiểm tra trên gel agarose 0,8%. Theo lý thuyết khi một DNA plasmid mang gen ngoại lai, chúng sẽ có kích thước bằng tổng kích thước của plasmid và kích thước của gen ngoại lai. Do vậy trong điện di đồ, chúng sẽ chạy chậm hơn (thấp hơn) so với đối chứng âm (các plasmid chưa mở vòng), dựa vào đó chúng ta có thể kết luận sơ bộ được những plasmid này có kích thước lớn hơn và có thể chúng mang gen ngoại lai. Hình 3.3. Chọn dòng pGEX6p1 mang cDNA mã hóa h-tPA (pGEX6p1/h-tPA) Formatted: Font: 13 pt, Do not check spelling or grammar Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 35 ĐC: Đối chứng âm 1- 7: DNA plasmid của các dòng pGEX6p1 Kết quả điện di cho thấy ở tất cả các đường chạy đều xuất hiện 2 băng chạy trước rõ nét hơn, điều đó chứng tỏ lượng DNA plasmid của chúng tôi thu được tồn tại ở dạng siêu xoắn nhiều hơn dạng thẳng. Hình 3.3 cho thấy, đối với các dòng mang vector pGEX6p1, dòng 1 và 3 (ký hiệu pGEX/htPA p1 và pGEX/htPA p3) là hai dòng có kích thước lớn hơn các dòng khác và lớn hơn so với đối chứng âm; do vậy rất có thể các dòng này mang cDNA mã hóa h-tPA. Đối với các dòng mang vector pET21a(+), các dòng 1,2,3 có thể mang cDNA mã hóa h-tPA (ký hiệu: pET/htPA p1, pET/htPA p2, pET/htPA p3). Formatted: Centered Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 36 Hình 3.4. Chọn dòng pET21a(+) mang cDNA mã hóa h-tPA (pET21a(+)/h-tPA) ĐC: Đối chứng âm (vector pET21a(+) không mang h-tPA) 1- 5: DNA plasmid của các dòng pET21a(+) Tương tự, đối với các dòng mang vector pET21a(+), các dòng 1,2,3 có kích thước lớn hơn các dòng khác và đối chứng âm; do vậy rất có thể các dòng này mang cDNA mã hóa h-tPA (ký hiệu: pET/htPA p1, pET/htPA p2, pET/htPA p3). Formatted: Font: 13 pt, Do not check spelling or grammar Formatted: Space After: 0 pt Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 37 Để chứng minh chính xác xem đoạn xen vào plasmid có phải là đoạn gen mã hoá h- tPA hay không, chúng tôi đã tiếp tục kiểm tra bằng enzyme hạn chế, tiến hành PCR và giải trình tự.  Kiểm tra vector tái tổ hợp mang cDNA mã hóa h-tPA bằng xử lý enzyme hạn chế Hai cặp enzyme NdeI/XhoI và BamHI/XhoI đã được sử dụng để tạo đầu bổ sung cho vector và đoạn chèn nên để kiểm tra, chúng tôi cũng sử dụng hai cặp enzyme này nhằm kiểm tra các dòng được chọn có mang đoạn chèn hay không. Theo tính toán lý thuyết, sản phẩm xử lý enzyme của plasmid tái tổ hợp bao gồm hai đoạn gen, một đoạn có kích thước tương ứng với vector gốc (vector mở vòng) và một đoạn có kích thước tương ứng với đoạn chèn (cDNA mã hóa h-tPA). Thành phần và quy trình phản ứng được tiến hành như trình bày ở mục 2.2.4. Các sản phẩm xử lý enzyme được điện di trên gel agarose 0,8%. Hình 3.5. Kiểm tra các vector tái tổ hợp mang cDNA mã hóa h-tPA bằng enzyme hạn chế Kết quả trên hình 3.5 cho thấy, sau khi xử lý các vector tái tổ hợp bằng hai cặp enzyme tương ứng, chúng tôi thu được hai băng có kích thước khác nhau; đối M: Marker 1kb 1: pGEX/htPA p1 2: pGEX/htPA p3 Formatted: Space Before: 0 pt, After: 0 pt Formatted: Font: 13 pt, Do not check spelling or grammar Formatted: Space After: 0 pt Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 38 với vector pGEX6p1, chúng tôi thu được một băng có kích thước khoảng 5kb (tương ứng với kích thước của vector pGEX6p1 khi xử lý bằng hai enzyme BamHI/ XhoI) và một băng có kích thước 1,7kb (tương ứng với kích thước cDNA mã hoá h- tPA). Đối với vector pET21a(+), chúng tôi cũng thu được một băng có kích thước khoảng 5,5kb (tương ứng với kích thước vector pET21a(+)) và một băng có kích thước khoảng 1,7kb (tương ứng với kích thước cDNA mã hoá h-tPA). Như vậy, chúng tôi sơ bộ kết luận là đã chọn được một số dòng plasmid tái tổ hợp mang đoạn gen phù hợp với kích thước của sản phẩm PCR h-tPA.  Kiểm tra vector tái tổ hợp mang cDNA mã hóa h-tPA bằng kỹ thuật PCR Để khẳng định lại các dòng plasmid tái tổ hợp đã được chọn có mang đúng đoạn gen mã hóa h-tPA, chúng tôi đã tiến hành PCR với việc sử dụng các plasmid được chọn làm khuôn để nhân đoạn h-tPA với các cặp mồi đặc hiệu. DNA mẫu để chạy PCR là pGEX/htPA p3 và pET/htPA p1. Kết quả kiểm tra các vector tái tổ hợp bằng kỹ thuật PCR được trình bày trên hình 3.6. Hình 3.6. Kiểm tra các vector tái tổ hợp mang cDNA mã hóa h-tPA bằng kỹ thuật PCR M: Marker 1kb 1: PCR sử dụng khuôn là pET/htPA p1 2: PCR sử dụng khuôn là pGEX/htPA p3 Formatted: Font: 13 pt, Do not check spelling or grammar Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 39 Kết quả điện di cho thấy, sản phẩm PCR của các dòng mang kiểm tra này đều xuất hiện băng với kích thước khoảng 1,7 kb, đúng với kích thước cDNA mã hóa cho h-tPA. Như vậy, các dòng được chọn làm khuôn trong thí nghiệm PCR đều có mang cDNA mã hóa h-tPA. Các dòng này đã được chúng tôi tinh sạch phục vụ cho xác định trình tự. 3.1.4. Xác định và phân tích trình tự cDNA mã hoá h-tPA Mặc dù đã được xác định trình tự trong vector tạo dòng pUC18, tuy nhiên, khi nhân lại cDNA này bằng enzyme Taq DNA polymerase có khả năng phát sinh các điểm đột biến. Vì vậy, sau khi chọn được các dòng mang cDNA mã hoá h-tPA, trước khi tiến hành biểu hiện, chúng tôi đã tinh sạch và một lần nữa xác định trình tự cả hai chiều đoạn cDNA bằng hai cặp mồi: cặp mồi T7 đối với vector pET21a(+) và cặp mồi PEXF/PEXR đối với vector pGEX6p1 trên máy xác định trình tự tự động. Trình tự DNA sau đó được xử lý trên các phần mềm: BioEdit, Sequencing analysis 7.0. Sau khi sử lý số liệu, chúng tôi đã thu được đoạn gen có kích thước khoảng 1700bp. Phổ trình tự của các dòng plasmid đều rõ ràng, không có tín hiệu nhiễu. Kết quả phân tích và so sánh với các trình tự đã công bố trên Ngân hàng Gen Quốc tế như sau: 10 20 30 40 50 60 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 atggatgcaatgaagagagggctctgctgtgtgctgctgctgtgtggagcagtcttcgtt MetAspAlaMetLysArgGlyLeuCysCysValLeuLeuLeuCysGlyAlaValPheVal pET21a(+) ............................................................ MetAspAlaMetLysArgGlyLeuCysCysValLeuLeuLeuCysGlyAlaValPheVal pGEX6p1 ............................................................ MetAspAlaMetLysArgGlyLeuCysCysValLeuLeuLeuCysGlyAlaValPheVal 70 80 90 100 110 120 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 tcgcccagccaggaaatccatgcccgattcagaagaggagccagatcttaccaagtgatc SerProSerGlnGluIleHisAlaArgPheArgArgGlyAlaArgSerTyrGlnValIle pET21a(+) ............................................................ SerProSerGlnGluIleHisAlaArgPheArgArgGlyAlaArgSerTyrGlnValIle pGEX6p1 ............................................................ SerProSerGlnGluIleHisAlaArgPheArgArgGlyAlaArgSerTyrGlnValIle 130 140 150 160 170 180 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 tgcagagatgaaaaaacgcagatgatataccagcaacatcagtcatggctgcgccctgtg CysArgAspGluLysThrGlnMetIleTyrGlnGlnHisGlnSerTrpLeuArgProVal Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 40 pET21a(+) ............................................................ CysArgAspGluLysThrGlnMetIleTyrGlnGlnHisGlnSerTrpLeuArgProVal pGEX6p1 ............................................................ CysArgAspGluLysThrGlnMetIleTyrGlnGlnHisGlnSerTrpLeuArgProVal 190 200 210 220 230 240 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 ctcagaagcaaccgggtggaatattgctggtgcaacagtggcagggcacagtgccactca LeuArgSerAsnArgValGluTyrCysTrpCysAsnSerGlyArgAlaGlnCysHisSer pET21a(+) ............................................................ LeuArgSerAsnArgValGluTyrCysTrpCysAsnSerGlyArgAlaGlnCysHisSer pGEX6p1 ............................................................ LeuArgSerAsnArgValGluTyrCysTrpCysAsnSerGlyArgAlaGlnCysHisSer 250 260 270 280 290 300 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 gtgcctgtcaaaagttgcagcgagccaaggtgtttcaacgggggcacctgccagcaggcc ValProValLysSerCysSerGluProArgCysPheAsnGlyGlyThrCysGlnGlnAla pET21a(+) ............................................................ ValProValLysSerCysSerGluProArgCysPheAsnGlyGlyThrCysGlnGlnAla pGEX6p1 ............................................................ ValProValLysSerCysSerGluProArgCysPheAsnGlyGlyThrCysGlnGlnAla 310 320 330 340 350 360 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 ctgtacttctcagatttcgtgtgccagtgccccgaaggatttgctgggaagtgctgtgaa LeuTyrPheSerAspPheValCysGlnCysProGluGlyPheAlaGlyLysCysCysGlu pET21a(+) ............................................................ LeuTyrPheSerAspPheValCysGlnCysProGluGlyPheAlaGlyLysCysCysGlu pGEX6p1 ............................................................ LeuTyrPheSerAspPheValCysGlnCysProGluGlyPheAlaGlyLysCysCysGlu 370 380 390 400 410 420 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 atagataccagggccacgtgctacgaggaccagggcatcagctacaggggcacgtggagc IleAspThrArgAlaThrCysTyrGluAspGlnGlyIleSerTyrArgGlyThrTrpSer pET21a(+) ............................................................ IleAspThrArgAlaThrCysTyrGluAspGlnGlyIleSerTyrArgGlyThrTrpSer pGEX6p1 ............................................................ IleAspThrArgAlaThrCysTyrGluAspGlnGlyIleSerTyrArgGlyThrTrpSer 430 440 450 460 470 480 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 acagcggagagtggcgccgagtgcaccaactggaacagcagcgcgttggcccagaagccc ThrAlaGluSerGlyAlaGluCysThrAsnTrpAsnSerSerAlaLeuAlaGlnLysPro pET21a(+) ............................................................ ThrAlaGluSerGlyAlaGluCysThrAsnTrpAsnSerSerAlaLeuAlaGlnLysPro pGEX6p1 ............................................................ ThrAlaGluSerGlyAlaGluCysThrAsnTrpAsnSerSerAlaLeuAlaGlnLysPro 490 500 510 520 530 540 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 tacagcgggcggaggccagacgccatcaggctgggcctggggaaccacaactactgcaga TyrSerGlyArgArgProAspAlaIleArgLeuGlyLeuGlyAsnHisAsnTyrCysArg pET21a(+) ....................T....................................... TyrSerGlyArgArgProAspAlaIleArgLeuGlyLeuGlyAsnHisAsnTyrCysArg pGEX6p1 ....................T....................................... TyrSerGlyArgArgProAspAlaIleArgLeuGlyLeuGlyAsnHisAsnTyrCysArg Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 41 550 560 570 580 590 600 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 aacccagatcgagactcaaagccctggtgctacgtctttaaggcggggaagtacagctca AsnProAspArgAspSerLysProTrpCysTyrValPheLysAlaGlyLysTyrSerSer pET21a(+) ............................................................ AsnProAspArgAspSerLysProTrpCysTyrValPheLysAlaGlyLysTyrSerSer pGEX6p1 ............................................................ AsnProAspArgAspSerLysProTrpCysTyrValPheLysAlaGlyLysTyrSerSer 610 620 630 640 650 660 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 gagttctgcagcacccctgcctgctctgagggaaacagtgactgctactttgggaatggg GluPheCysSerThrProAlaCysSerGluGlyAsnSerAspCysTyrPheGlyAsnGly pET21a(+) ............................................................ GluPheCysSerThrProAlaCysSerGluGlyAsnSerAspCysTyrPheGlyAsnGly pGEX6p1 ............................................................ GluPheCysSerThrProAlaCysSerGluGlyAsnSerAspCysTyrPheGlyAsnGly 670 680 690 700 710 720 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 tcagcctaccgtggcacgcacagcctcaccgagtcgggtgcctcctgcctcccgtggaat SerAlaTyrArgGlyThrHisSerLeuThrGluSerGlyAlaSerCysLeuProTrpAsn pET21a(+) ............................................................ SerAlaTyrArgGlyThrHisSerLeuThrGluSerGlyAlaSerCysLeuProTrpAsn pGEX6p1 ............................................................ SerAlaTyrArgGlyThrHisSerLeuThrGluSerGlyAlaSerCysLeuProTrpAsn 730 740 750 760 770 780 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 tccatgatcctgataggcaaggtttacacagcacagaaccccagtgcccaggcactgggc SerMetIleLeuIleGlyLysValTyrThrAlaGlnAsnProSerAlaGlnAlaLeuGly pET21a(+) ............................................................ SerMetIleLeuIleGlyLysValTyrThrAlaGlnAsnProSerAlaGlnAlaLeuGly pGEX6p1 ............................................................ SerMetIleLeuIleGlyLysValTyrThrAlaGlnAsnProSerAlaGlnAlaLeuGly 790 800 810 820 830 840 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 ctgggcaaacataattactgccggaatcctgatggggatgccaagccctggtgccacgtg LeuGlyLysHisAsnTyrCysArgAsnProAspGlyAspAlaLysProTrpCysHisVal pET21a(+) ............................................................ LeuGlyLysHisAsnTyrCysArgAsnProAspGlyAspAlaLysProTrpCysHisVal pGEX6p1 ............................................................ LeuGlyLysHisAsnTyrCysArgAsnProAspGlyAspAlaLysProTrpCysHisVal 850 860 870 880 890 900 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 ctgaagaaccgcaggctgacgtgggagtactgtgatgtgccctcctgctccacctgcggc LeuLysAsnArgArgLeuThrTrpGluTyrCysAspValProSerCysSerThrCysGly pET21a(+) ............................................................ LeuLysAsnArgArgLeuThrTrpGluTyrCysAspValProSerCysSerThrCysGly pGEX6p1 ............................................................ LeuLysAsnArgArgLeuThrTrpGluTyrCysAspValProSerCysSerThrCysGly Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 42 910 920 930 940 950 960 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 ctgagacagtacagccagcctcagtttcgcatcaaaggagggctcttcgccgacatcgcc LeuArgGlnTyrSerGlnProGlnPheArgIleLysGlyGlyLeuPheAlaAspIleAla pET21a(+) ............................................................ LeuArgGlnTyrSerGlnProGlnPheArgIleLysGlyGlyLeuPheAlaAspIleAla pGEX6p1 ............................................................ LeuArgGlnTyrSerGlnProGlnPheArgIleLysGlyGlyLeuPheAlaAspIleAla 970 980 990 1000 1010 1020 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 tcccacccctggcaggctgccatctttgccaagcacaggaggtcgcccggagagcggttc SerHisProTrpGlnAlaAlaIlePheAlaLysHisArgArgSerProGlyGluArgPhe pET21a(+) ............................................................ SerHisProTrpGlnAlaAlaIlePheAlaLysHisArgArgSerProGlyGluArgPhe pGEX6p1 ............................................................ SerHisProTrpGlnAlaAlaIlePheAlaLysHisArgArgSerProGlyGluArgPhe 1030 1040 1050 1060 1070 1080 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 ctgtgcgggggcatactcatcagctcctgctggattctctctgccgcccactgcttccag LeuCysGlyGlyIleLeuIleSerSerCysTrpIleLeuSerAlaAlaHisCysPheGln pET21a(+) ............................................................ LeuCysGlyGlyIleLeuIleSerSerCysTrpIleLeuSerAlaAlaHisCysPheGln pGEX6p1 ............................................................ LeuCysGlyGlyIleLeuIleSerSerCysTrpIleLeuSerAlaAlaHisCysPheGln 1090 1100 1110 1120 1130 1140 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 gagaggtttccgccccaccacctgacggtgatcttgggcagaacataccgggtggtccct GluArgPheProProHisHisLeuThrValIleLeuGlyArgThrTyrArgValValPro pET21a(+) ............................................................ GluArgPheProProHisHisLeuThrValIleLeuGlyArgThrTyrArgValValPro pGEX6p1 ............................................................ GluArgPheProProHisHisLeuThrValIleLeuGlyArgThrTyrArgValValPro 1150 1160 1170 1180 1190 1200 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 ggcgaggaggagcagaaatttgaagtcgaaaaatacattgtccataaggaattcgatgat GlyGluGluGluGlnLysPheGluValGluLysTyrIleValHisLysGluPheAspAsp pET21a(+) ............................................................ GlyGluGluGluGlnLysPheGluValGluLysTyrIleValHisLysGluPheAspAsp pGEX6p1 ............................................................ GlyGluGluGluGlnLysPheGluValGluLysTyrIleValHisLysGluPheAspAsp 1210 1220 1230 1240 1250 1260 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 gacacttacgacaatgacattgcgctgctgcagctgaaatcggattcgtcccgctgtgcc AspThrTyrAspAsnAspIleAlaLeuLeuGlnLeuLysSerAspSerSerArgCysAla pET21a(+) ............................................................ AspThrTyrAspAsnAspIleAlaLeuLeuGlnLeuLysSerAspSerSerArgCysAla pGEX6p1 ............................................................ AspThrTyrAspAsnAspIleAlaLeuLeuGlnLeuLysSerAspSerSerArgCysAla 1270 1280 1290 1300 1310 1320 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 caggagagcagcgtggtccgcactgtgtgccttcccccggcggacctgcagctgccggac GlnGluSerSerValValArgThrValCysLeuProProAlaAspLeuGlnLeuProAsp Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 43 pET21a(+) ............................................................ GlnGluSerSerValValArgThrValCysLeuProProAlaAspLeuGlnLeuProAsp pGEX6p1 ............................................................ GlnGluSerSerValValArgThrValCysLeuProProAlaAspLeuGlnLeuProAsp 1330 1340 1350 1360 1370 1380 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 tggacggagtgtgagctctccggctacggcaagcatgaggccttgtctcctttctattcg TrpThrGluCysGluLeuSerGlyTyrGlyLysHisGluAlaLeuSerProPheTyrSer pET21a(+) ............................................................ TrpThrGluCysGluLeuSerGlyTyrGlyLysHisGluAlaLeuSerProPheTyrSer pGEX6p1 ............................................................ TrpThrGluCysGluLeuSerGlyTyrGlyLysHisGluAlaLeuSerProPheTyrSer 1390 1400 1410 1420 1430 1440 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 gagcggctgaaggaggctcatgtcagactgtacccatccagccgctgcacatcacaacat GluArgLeuLysGluAlaHisValArgLeuTyrProSerSerArgCysThrSerGlnHis pET21a(+) ............................................................ GluArgLeuLysGluAlaHisValArgLeuTyrProSerSerArgCysThrSerGlnHis pGEX6p1 ............................................................ GluArgLeuLysGluAlaHisValArgLeuTyrProSerSerArgCysThrSerGlnHis 1450 1460 1470 1480 1490 1500 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 ttacttaacagaacagtcaccgacaacatgctgtgtgctggagacactcggagcggcggg LeuLeuAsnArgThrValThrAspAsnMetLeuCysAlaGlyAspThrArgSerGlyGly pET21a(+) ............................................................ LeuLeuAsnArgThrValThrAspAsnMetLeuCysAlaGlyAspThrArgSerGlyGly pGEX6p1 ............................................................ LeuLeuAsnArgThrValThrAspAsnMetLeuCysAlaGlyAspThrArgSerGlyGly 1510 1520 1530 1540 1550 1560 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 ccccaggcaaacttgcacgacgcctgccagggcgattcgggaggccccctggtgtgtctg ProGlnAlaAsnLeuHisAspAlaCysGlnGlyAspSerGlyGlyProLeuValCysLeu pET21a(+) ............................................................ ProGlnAlaAsnLeuHisAspAlaCysGlnGlyAspSerGlyGlyProLeuValCysLeu pGEX6p1 ............................................................ ProGlnAlaAsnLeuHisAspAlaCysGlnGlyAspSerGlyGlyProLeuValCysLeu 1570 1580 1590 1600 1610 1620 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 aacgatggccgcatgactttggtgggcatcatcagctggggcctgggctgtggacagaag AsnAspGlyArgMetThrLeuValGlyIleIleSerTrpGlyLeuGlyCysGlyGlnLys pET21a(+) ............................................................ AsnAspGlyArgMetThrLeuValGlyIleIleSerTrpGlyLeuGlyCysGlyGlnLys pGEX6p1 ............................................................ AsnAspGlyArgMetThrLeuValGlyIleIleSerTrpGlyLeuGlyCysGlyGlnLys 1630 1640 1650 1660 1670 1680 ....|....|....|....|....|....|....|....|....|....|....|....| NM_000930 gatgtcccgggtgtgtacaccaaggttaccaactacctagactggattcgtgacaacatg AspValProGlyValTyrThrLysValThrAsnTyrLeuAspTrpIleArgAspAsnMet pET21a(+) ............................................................ AspValProGlyValTyrThrLysValThrAsnTyrLeuAspTrpIleArgAspAsnMet pGEX6p1 ............................................................ AspValProGlyValTyrThrLysValThrAsnTyrLeuAspTrpIleArgAspAsnMet Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 44 ....|.... NM_000930 cgaccgtga ArgProEnd pET21a(+) ......--- ArgPro pGEX6p1 ......... ArgProEnd Hình 3.7. So sánh trình tự nucleotide của h-tPA trong pGEX6p1/h-tPA và pET21a(+)/h-tPA với NM_000930 Từ kết quả so sánh trên, chúng tôi nhận thấy trình tự cDNA mã hóa h-tPA được tạo dòng trong hai vector biểu hiện hoàn toàn không thay đổi so với trình tự cDNA đã xác định được trong vector tạo dòng pUC18. So với NM_000930, trình tự cDNA của chúng tôi không có sự thay đổi nào đáng kể, chỉ có một sai khác nằm ở vị trí 499 của cDNA mã hóa h-tPA. Ở trình tự NM_000930, vị trí 499 nucleotitde này là C được thay thế bằng nucleotide T trong trình tự chúng tôi đang nghiên cứu biểu hiện. Tuy nhiên trình tự này không làm thay đổi trình tự acid amin, vì vậy không ảnh hưởng tới cấu trúc và chức năng của protein. Ở vector pET21a(+), không có trình tự kết thúc do chúng tôi thiết kế mồi PCR nhằm gắn đuôi His vào giúp quá trình tinh sạch protein h-tPA sau này được dễ hơn. 3.2. Biểu hiện gen 3.2.1. Tổng hợp protein h-tPA tái tổ hợp Trong nghiên cứu này, sau khi thu được các dòng plasmid mang gen cDNA mã hoá h-tPA, để biểu hiện trong vi khuẩn E. coli, chúng tôi đã tiến hành biến nạp hai vector tái tổ hợp (pET21a(+) và pGEX6p1) mang gen mã hoá h-tPA vào tế bào vi khuẩn E. coli chủng BL21(DE3) plysS. Các dòng tế bào này sau đó được cấy chuyển và tiếp tục nuôi lắc 200 v/p trong môi trường LB lỏng có bổ sung Amp ở 37 oC cho tới khi OD= 0,6 thì tiến hành cảm ứng IPTG 0,1mM. Đối với vector biểu hiện pGEX6p1, theo tính toán lý thuyết, protein h-tPA tái tổ hợp có khối lượng phân tử khoảng 95kDa (bằng tổng khối lượng của protein h-tPA (70 kDa) và đoạn GST (26,4 kDa)); còn đối với vector biểu hiện pET21a(+), khối lượng phân tử protein tái tổ hợp thu được khoảng 72kDa. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 45 Sau mỗi giờ từ khi cảm ứng IPTG chúng tôi đã tiến hành thu 1ml dịch tế bào nhằm kiểm tra độ biểu hiện của tế bào. Kết thúc thí nghiệm, chúng tôi thu được dịch tế bào có chứa protein tái tổ hợp. Để kiểm tra kết quả biểu hiện chúng tôi đã tiến hành điện di protein trên gel polyacrylamide 10%. 3.2.2. Kiểm tra protein bằng phƣơng pháp điện di trên SDS-PAGE Đối với vector biểu hiện pGEX6p1 mang h-tPA, kết quả phân tích SDS- PAGE cho thấy các mẫu thí nghiệm đã xuất hiện một băng protein mới có kích thước khoảng 95kDa so với các mẫu đối chứng. Đây rất có thể là dạng protein dung hợp giữa h-tPA (72kDa) với đuôi GST (26,4kDa) của vector pGEX6p1. Mẫu đối chứng âm chúng tôi sử dụng là dịch phá màng của tế bào BL21 có chứa vector pGEX6p1 gốc (giếng 5) và dịch phá màng của E.coli BL21 không mang vector (giếng 7) có cảm ứng IPTG. Các mẫu đối chứng âm này cũng xuất hiện băng nhưng kích thước nhỏ và không rõ nét. Có thể ở những mẫu này, tế bào chủ có tổng hợp một số protein có cùng kích thước nhưng hàm lượng thấp. Ở giếng 5 xuất hiện băng đậm có kích thước 26,4kDa, đây là băng GST đã được tổng hợp tuy nhiên do plasmid không mang gen cDNA mã hóa h-tPA nên trong quá trình tổng hợp protein, h-tPA không được tổng hợp. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 46 Hình 3.8. Điện di kiểm tra protein h-tPA trong pGEX/h-tPA p3 M: Marker 1, 2, 3, 4: Mẫu thu được sau 0h, 1h, 2h, 3h cảm ứng IPTG 5: Dòng tế bào mang vector pGEX6p1 6: Mẫu thu được sau 3h cảm ứng IPTG 7: Dòng tế bào không mang vector Để xác định được thời điểm tại đó lượng protein được tổng hợp là cao nhất, chúng tôi đã tiến hành thí nghiệm trong 3h sau khi cảm ứng. Sau khoảng thời gian 0h, 1h, 2h, 3h chúng tôi đã tiến hành thu mẫu. Kết quả cho thấy kích thước và độ Formatted: Font: 13 pt, Do not check spelling or grammar Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 47 đậm của băng này tăng theo thời gian sau khi cảm ứng IPTG và đậm nhất tại thời điểm 3h sau cảm ứng. Kết quả này cho thấy dòng tế bào E.coli BL21 có mang plasmid pGEX6p1 tái tổ hợp có khả năng tổng hợp protein dung hợp GST-htPA. Tuy nhiên hàm lượng protein tái tổ hợp còn thấp so với tổng lượng protein được tổng hợp. Song song với thí nghiệm biểu hiện h-tPA trong vector pGEX6p1, chúng tôi cũng tiến hành biểu hiện protein h-tPA trong vector pET21a(+) trên tế bào chủ E.coli BL21. Sau khi thu được dịch protein, chúng tôi đã điện di trên gel polyacrylamide 10% với thang protein chuẩn và các đối chứng âm. Các đối chứng âm ở đây cũng là dịch phá màng tế bào E. coli BL21 không mang vector và có mang vector pET21a(+) đều được cảm ứng IPTG. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 48 Hình 3.9. Điện di protein h-tPA trong pET21/h-tPA p1 M: Marker 1: Dòng tế bào BL21 2: Dòng tế bào BL21 mang vector pET21a(+) gốc 3, 4, 5, 6: Mẫu thu được sau 0h, 1h, 2h, 3h cảm ứng IPTG Sau khi thu được dịch protein, chúng tôi đã điện di trên gel polyacrylamide 10% với thang protein chuẩn và các đối chứng âm. Các đối chứng âm ở đây cũng là Formatted: Font: 13 pt, Do not check spelling or grammar Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 49 dịch phá màng tế bào E. coli BL21 không mang vector và có mang vector pET21a(+) đều được cảm ứng IPTG. Kết quả điện di cho thấy không có sự khác biệt nhiều về số lượng và độ đậm nhạt băng giữa các dòng E.coli BL21 mang vector pET21a(+)/h-tPAvới các đối chứng âm (giếng 1 và giếng 2). Ở vị trí 72kDa có xuất hiện băng nhưng giữa các mẫu điện di là giống nhau. Nếu h-tPA không được biểu hiện thì băng 72kDa này là protein có cùng khối lượng của tế bào E.coli được tổng hợp. Nếu gen h-tPA được tổng hợp thì hàm lượng protein được tổng hợp là rất thấp so với tổng lượng protein của tế bào chủ. Để có những kết luận chính xác về quá trình biểu hiện của cDNA mã hóa h- tPA, cần có những nghiên cứu khác như: lai Western Blot, hay kỹ thuật Elisa... nhằm khẳng định protein h-tPA được tổng hợp. Mặt khác, các điều kiện thí nghiệm khác cũng cần được nghiên cứu tối ưu để quá trình biểu hiện cho lượng protein h- tPA là lớn nhất và tiến tới ứng dụng quy trình biểu hiện. Cũng cần nhấn mạnh rằng, mặc dù hệ thống biểu hiện gen của sinh vật bậc cao trên đối tượng vi khuẩn E. coli bên cạnh nhiều ưu điểm như: môi trường nuôi cấy rẻ; dễ điều khiển quá trình biểu hiện; hàm lượng protein thu được lớn (đến 30% tổng protein tế bào).... còn tồn tại một vài nhược điểm. Đây là một quá trình phức tạp và khó thực hiện do hệ thống này chỉ biểu hiện tốt đối với protein có kích thước nhỏ hơn 80 acid amin, đối với các protein có kích thước lớn thì hệ thống biểu hiện E.coli có thể tổng hợp được protein nhưng protein này có thể không cuộn xoắn; bộ ba mã hóa ở E.coli có sự khác biệt nhiều với bộ ba mã hóa ở sinh vật bậc cao; các quá trình cải biến sau dịch mã thường không có; khả năng biểu hiện một protein đơn lẻ không tốt..... Đối với h-tPA, đã có nhiều công trình công bố biểu hiện được trên E. coli nhưng hàm lượng protein thu được chưa cao. Vì vậy, việc nghiên cứu biểu hiện trên các đối tượng khác như nấm men, tế bào côn trùng, tế bào động vật cũng được quan tâm ở nhiều phòng thí nghiệm. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 50 KẾT LUẬN VÀ ĐỀ NGHỊ Kết luận 1. Đã tạo được hai vector biểu hiện pGEX6p1 và pET21a(+) mang cDNA mã hóa h-tPA có kích thước khoảng 1,7kb. 2. Đã xác định trình tự nucleotide của cDNA mã hóa h-tPA. So sánh trình tự nucleotide của cDNA mã hóa h-tPA với trình tự gen trên Ngân hàng Gen Quốc tế, mã số NM_000930 cho thấy độ tương đồng đạt 99%. So với NM_000930, trình tự cDNA nghiên cứu không có sự thay đổi nào đáng kể, chỉ có một sai khác nằm ở vị trí 499 của cDNA mã hóa h-tPA. Ở trình tự NM_000930, vị trí 499 nucleotitde này là C được thay thế bằng nucleotide T. Tuy nhiên, sự khác biệt này không làm thay đổi trình tự acid amin, vì vậy không ảnh hưởng tới cấu trúc và chức năng của protein. 3. Đã tiến hành biểu hiện cDNA mã hóa h-tPA trên hai vector pGEX6p1 và pET21a(+) và thu được protein h-tPA khi biểu hiện trong vector pGEX6p1. Đề nghị - Tiếp tục nghiên cứu biểu hiện cDNA mã hóa h-tPA trong vector pET21a(+) trên vi khuẩn E.coli chủng BL21. - Tối ưu hoá quá trình biểu hiện đối với cDNA mã hóa h-tPA trong pGEX6p1 nhằm thu được hàm lượng protein lớn nhất. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 51 TÀI LIỆU THAM KHẢO Tiếng Việt 1. Lê Trần Bình, Cao Huyền Trang (2005), “Nghiên cứu và phát triển sản xuất vaccine ăn được trong thực vật”, Tạp chí Công nghệ Sinh học, 3(2), tr. 133- 142. 2. Nguyễn Đình Cường, Nguyễn Thùy Dương, Lê Thị Thu Hiền, Lương Thị Thu Hường, Trần Thị Phương Liên, Nguyễn Huy Hoàng, Phan Văn Chi, Nông Văn Hải (2003), “Biểu hiện gen mã hóa protein bất hoạt ribosome của cây mướp đắng ở vi khuẩn Escherichia coli”, Tạp chí Công nghệ Sinh học, 1(4), tr. 451- 460. 3. Nguyễn Thúy Hà, Nguyễn Bích Nhi, Đỗ Khắc Hiếu, Phan Văn Chi (2003), “Khả năng ức chế các dòng tế bào ung thư nuôi cấy in vitro của Trichobakin tái tổ hợp”, Y học Việt Nam, 284(5), tr. 26- 30. 4. Đặng Trần Hoàng, Vũ Minh Đức, Phùng Thu Nguyệt, Trương Nam Hải (2005), “Biểu hiện gen interleukin- 2 của người rh-LL2LL bị đột biến tại các điểm glycosyl hóa và gốc cysteine 125 trong Escherichia coli”, Tạp chí Công nghệ Sinh học, 3(2), tr. 149- 154. 5. Bùi Thị Huyền, Đặng Thành Nam, Nguyễn Nam Long, Nguyễn Bích Nhi, Hoàng Quốc Trường, Phan Văn Chi (2005), “Biểu hiện và xác định interleukin- 2 của người”, Tạp chí Công nghệ Sinh học, 3(2), tr. 143- 148. 6. Nguyễn Nam Long, Nguyễn Bích Nhi, Phan Văn Chi (2005), “Tách dòng gen mã hóa interleukin- 2 của người”, Y học Việt Nam, 310(5), tr. 26- 30. 7. Chu Kỳ Nam, Hoàng Văn Quốc Chương, Trần Linh Thước (2005), “Tạo dòng và biểu hiện mini-proinsulin của người tái tổ hợp trong Escherichia coli”, Tạp chí Công nghệ Sinh học, 3(2), tr. 155- 160. 8. Phạm Thiệp, Vũ Ngọc Thúy, Nguyễn Hữu Lộc (1992), “Thuốc, biệt dược và cách sử dụng”, Nhà xuất bản Khoa học và Kỹ thuật. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 52 Tiếng Anh 9. Axelsson F. (1995), “Plasminogen”, Product monograph. 10. Becker C., Nong V.H., Bäumlein H., Le T.X., Farouk A., Will H., Bassüner R. (1993), “Synthesis and accumulation of human tissue-type plasminogen activator (h-tPA) in transgenic tobaco seeds”, Seed storage compounds 35, pp. 326- 331. 11. Berg D.T., Burck P.J., Grinnell B.W. (1993), “Kringle glycosylation in a modified human tissue plasminogen activator improves functional properties”, Blood 81(5), pp. 1312- 1322. 12. Bhopale G.M., Nanda R.K. (2005), “Recombinant DNA expression products for human therapeutic use”, Curr. Scie. 89(4), pp. 614- 622. 13. Booyse F.M., Scheinbuks J., Lin P.H., Traylor M., Bruce R. (1988), “Isolation and interrelationships of the multiple molecular tissue-type and urokinase- type plasminogen activator forms produced by cultured human umbilical vein endothelial cells”, J. Biol. Chem. 263(29), pp. 15129- 15138. 14. Bulleid N.J., Bassel- Duby R.S., Freedman R.B., Sambrook J.F., Gething M.H. (1992), “Cell-free synthesis of enzymically active tissue-type plasminogen activator”, Biochem. J. 286, pp. 275- 280. 15. Burck P.J., Berg D.H., Warrick M.W., Berg D.T., Walls J.D., Jaskunas S.R., Crisel R.M., Weigel B., Vlahos C.J., McClure D.B., Grinnell B.W. (1990), “Characterization of a modified human tissue plasminogen activator comprising a kringle-2 and a protease domain”, J. Biol. Chem. 265(9), pp. 5170- 5177. 16. Carlie V.C., Veerman H., Pannekoek H. (1989), “Identification of the domains of tissue-type plasminogen activator involved in the augmented binding to fibrin after limited digestion with plasmin”, J. Biol. Chem. 264(21), pp. 12604- 12610. 17. Cartwright T. (1992), “Production of t-PA from animal cell culture”, Animal. Cell Biotechnol. 5, pp. 218- 245. 18. Castellio F.J. (1983), “Plasminogen activator”, BioScience 33(11), pp. 647- 650. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 53 19. Collen D., Lunen R. (2004), “Tissue- type plasminogen activator: a historical perspective and personal account”, J. Thromb. Haemost 2, pp. 541- 546. 20. Degeng S.J.F., Rajput B., Reich E. (1986), “The human tissue plasminogen activator gene”, J. Biol. Chem. 261(15), pp. 6972- 6985. 21. Demaerschalk B.M., Yip T.R. (2005), “Economic benefit of increasing utilization of intravenous tissue plasminogen activator for acute ischemic stroke in the United States”, Stroke 36, pp. 2500- 2503. 22. Demain A.L. (2005), “The Biopharmaceutical revolution”, TeknoScienze 22(11). 23. Edlund T., Ny T., Ranby M., Hedon L., Palms G., Holmgren E., Josephson S. (1983), “Isolation of cDNA sequences coding for a part of human tissue plasminogen activator”, Proc. Natl. Acad. Sci. USA 80, pp. 349- 352. 24. Fischer R., Stoger E., Schillberg S., Christou P. (2003), “The production of recombinant pharmaceutical proteins in plants”, Nat. Rev. Genet. 4, pp. 794- 805. 25. Fischer R., Stoger E., Schillberg S., Christou P., Twyman R.M. (2004), “Plant- based production of biopharmaceuticals”, Curr. Opin. Plant Biol. 7, pp. 152- 158. 26. Griffiths J.B., Electricwala A. (1987), “Production of tissue plasminogen activators from animal cells”, Adv. Biochem. Eng. Biotechnol. 34, pp. 147- 166. 27. Hoffman J.R. (2005), “Tissue plasminogen activator (tPA) for acute ischaemic stroke: Why so much has been made of so little”, Med. J. Aust. 179(7), pp. 333-334. 28. Kalyan K.S., Lee S.G., Wilhelm J., Fu K.F., Hum W.T., Rappaport R., Hartzell R.W., Urbano C., Hung P.P. (1988), “Structure-function analysis with tissue-type plasminogen activator”, Biochem. J. 263 (8), pp. 3971-3378. 29. Laemmli U.K. (1970), “Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4”, Nature 22, pp. 680- 685. 30. Leonardi A., Brun P., Sartori M.T., Cortivo R., DeDominicis C., Saggiorato G., Abatangelo G., Secchi A.G. (2005), “Urokinase plasminogen activator, Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 54 uPa receptor, and its inhibitor in Vernal keratoconjunctivitis”, Invest. Ophthalmol. Vis. Sci. 46, pp. 1364- 1370. 31. Li Z.L., An J. (2002), “Cloning and identification of human tissue - type plasminogen activator gene”, Di Yi Jun Yi Da Xue Xue Bao 22(1), pp. 22- 24. 32. Ma J.K.C., Drake P.M.W., Christou P. (2003), “The production of recombinant pharmaceutical protein in plant”, Nature 4, pp. 794- 805. 33. Ma J.K.C., Barros E., Bock R., Christou P., Dale P.J., Dix P.J., Fischer R., Irwin J., Mahoney R., Pezzotti M., Schillberg S., Sparrow P., Stoger E., Twyman R. M. (2005), “Molecular farming for new drugs and vaccines”, EMBO rep. 6(7), pp. 593- 599. 34. Markland W., Pollock D., Livingston D.J., (1989), “Structure - function analysis of tissue-type plasminogen activator by linker-insertion, point and deletion mutagenesis”, Protein Eng. 3(2), pp. 117- 125. 35. Martegani E., Forlani N., Mauri I., Porro D., Schleuning W.D., Alberghina L. (1992), “Expression of high levels of human tissue plasminogen activator in yeast under the control of an inducible GAL promoter”, Appl. Microbiol. Biotechnol. 37, pp. 601- 608. 36. Meschia J.F., Miller D.A., Brott T.G. (2002), “Thrombolytic treatment of acute ischemic stroke”, Mayo Clin. Proc. 77, pp. 254- 551. 37. Novokhatny V.V., Inghams K.C., Medved L.V. (1991), “Domain structure and domain-domain interactions of recombinant tissue plasminogen activator”, J. Biol. Chem. 266(20), pp. 12994- 13002. 38. Ny T., Elgh F., Lund B. (1984), “The structure of the human tissue-type plasminogen activator gene: Correlation of intron and exon structures to functional and structural domains”, Proc. Natl. Acad. Sci. USA 81(17), pp. 5355- 5359. 39. Otter M., Kuiper J., Bos R., Rijken D.C., Berkel J.C.V. (1992), “Characterization of the interaction both in vitro and in vivo oftissue-type plasminogen activator (t-PA) with rat liver cell”, Biochem. J. 284, pp. 545- 550. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 55 40. Pennica D., Holmes W.S., Kohr W.J., Harkins R.N., Vehar G.A., Ward C.A., Bennett W.F., Yelverton E., Seeburg P.H., Heyneker H.L., Goeddel D.V. (1983), “Cloning and expression of human tissue-type plasminogen activator cDNA in E. coli”, Nature 301, pp. 214- 221. 41. Petersen T.E., Martzen M.R., Ichinose A., Davie E.W. (1990), “Characterization of the gene for human plasminogen, a key proenzyme in the fibrinolytic system”, J. Biol. Chem. 265(11), pp. 6104- 6111. 42. Qui J., Swartz J.R., Georgiou G. (1998), “Expression of active human tissue- type plasminogen activator in Escherichia coli”, Appl. Envir. Microbiol. 64 (12), pp. 4891- 4896. 43. Reichert J.M. (2002), “Therapeutic monoclonal antibodies: trends in development and approval in the US”, Curr. Opin. Mol. Ther. 4(2), pp. 110- 118. 44. Reichert J.M., Paquette C. (2003), “Therapeutic recombinant proteins: trends in US approvals 1982- 2002”, Curr. Opin. Mol. Ther. 5(2), pp. 139- 147. 45. Rijken D.C. (1988), “Relationships between structure and function of tissue- type plasminogen activator”, Klin. Wochenschr. 66(12), pp. 33- 39. 46. Rouf S.A., Moo- Young M., Chisti Y. (1996), “Tissue- type plasminogen activator: Characteristics, applications and production technology”, Biotechnol. Adv. 14(3), pp. 239- 266. 47. Salonen E.M., Saksela O., Vatio T., Vaheri A., Nielsen L.S., Zeuthen J. (1985), “Plasminogen and tissue-type plasminogen activator bind to immobilized fibronectin”, J. Biol. Chem. 260(22), pp. 12302- 12307. 48. Sambrook J., Fritsch E.F., Maniatis T. (2001), “Molecular Cloning: A laboratory manual”. Cold Spring Harbor Lab. Press, Cold Spring Harbor. 49. Siren V., Peltonen J., Vaheri A. (2006), “Plasminogen activators and their inhibitor gene expression in cutaneous NF1- related neurofibromas”, Arch. Dermatol. Res. 297(9), pp. 421- 424. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 56 50. Twyman R.M., Stoger E., Schillberg S., Christou P., Fisher R. (2003), “Molecular farming in plants: host systems and expression technology”, Trends Biotechnol. 21, pp. 570- 578. 51. Upshall A., Kumar A.A., Bailey M.C., Parker M.D., Favreau M.A., Lewison K.P., Joseph M.L., Maraganore J.M., McKnight G.L. (1987), “Secretion of active human tissue plasminogen activator from the filamentous fungus Aspergillus nidulans”, Bio. Technol. 5, pp. 1301- 1304. 52. Van Zoneveld A.J., Veerman H., MacDonald M.E., Mourik J.A., Pannekoek H. (1986), “Structure and function of human tissue plasminogen - type plasminogen activator”, J. Cell Biol. 32, pp. 169- 178. 53. Verstraete M., Collen D. (1986), “Pharmacology of thrombolytic drugs”, J. Am. Coll. Cardiol. 8, pp. 33- 40. 54. Verstraete M. (2000), “Third-generation thrombolytic drugs”, Am. J. Med. 109, pp. 52- 58. 55. Wilhelm O.G., Jaskunas S.R., Vlahos C.J., Bang N.U. (1990), “Functional properties of the recombinant Kringle-2 domain of tissue plasminogen activator produced in Escherichia coli”, J. Biol. Chem. 265(24), pp. 14606- 14611. 56. Yepes M., Lawrence D.A. (2004), “Tissue-type plasminogen activator and neuroserpin: a well-balanced act in the nervous system?”, Trends Cardiovasc Med. 14(5), pp. 173- 179. 57. Zhu M.C., Zhan Z., Wang Y.J., Liu C.G., Shi Y., Cai Q. (2005), “Expression and activity of tissue- type plasminogen activator mutant reteplase with deletion of PAI-1 binding sites”, Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi 21 (5), pp. 565- 569. Website 58. 59. 60. Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 57 PHỤ LỤC Bảng 1. Hóa chất sử dụng Hóa chất Hãng sản xuất Các loại enzyme hạn chế MBI Fermentas (Mỹ) Taq DNA polymerase MBI Fermentas (Mỹ) T4 ligase MBI Fermentas (Mỹ) Thang DNA chuẩn, protein chuẩn MBI Fermentas (Mỹ) dNTP MBI Fermentas (Mỹ) Kit Wizard ® SV Gel and PCR Clean-up System Promega (Mỹ) Agarose Gibco (Mỹ) Phenol Merck (Đức) Chloroform Merck (Đức) Isoamylalcohol Merck (Đức) Tris acetic acid Merck (Đức) EDTA Merck (Đức) Ampicillin Serva (Đức) LB US Biological (Mỹ) BigDye ® Terminator Applied Biosciences (Mỹ) Cồn Merck (Đức) Bảng 2. Thiết bị sử dụng Thiết bị Hãng sản xuất Máy ly tâm 5415R Eppendorf (Đức) Máy PCR 9700 Applied Biosystems (Mỹ) Máy điện di Mupid- 2Plus (Nhật) Máy soi DNA Bio- Rad (Mỹ) Máy hút chân không Speed Vac Savant (Mỹ) Máy xác định trình tự tự động ABI 3100 Applied Biosystems (Mỹ) Máy chuẩn pH Mettler Toledo (Thụy Sỹ) Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 58 Bảng 3. Dung dịch cần pha Dung dịch Hóa chất Nồng độ Đệm chạy điện đi DNA TAE 1X Tris-acetate EDTA 40mM 1mM Đệm tra mẫu DNA (Loading buffer) Bromophenol blue Xylene cyanol FF Sucrose trong H2O 0,25% 0,25% 40% Đệm chạy điện di protein (1X Tris- Glycine pH 8,3) Tris base Glycine SDS H2O 3 g 14,4 g 1 g 1 l Đệm tra mẫu protein (Protein sample buffer 4X) Tris- HCl pH= 6,8 Glycerol SDS DTT Bromophenol Blue 0,5M 60% 20% 1M 0,2% Dung dịch nhuộm protein (Comasive Brilliant Blue R250) Comasive R250 Metanol Acid acetic H2O 0,3 g 120 ml 30 ml 150 ml Dung dịch tẩy gel protein Acid acetic 7% Metanol 20% H2O 35 ml 100 ml 365 ml Dung dịch I (Sol I) (Khử trùng, giữ 4oC) Tris- HCl, pH 8,0 EDTA, pH 8,0 Glucose 25mM 10mM 50mM Dung dịch II (Sol II) (Pha mới trước khi sử dụng) NaOH SDS 0,2N 1% Dung dịch III (Sol III) (Khử trùng, giữ 4oC) CH3COOK, pH 5,5 CH3COOH 3,0M 11,5% Dung dịch TE 0,01M, pH 8,0 Tris- HCl, pH 8,0 EDTA, pH 8,0 0,1mM 0,01mM Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 59 Bảng 4. Các cặp mồi sử dụng Mồi Trình tự mồi T7 promoter 5’-TAA TAC GAC TCA CTA TAG G-3’ T7 terminator 5’-GCT AGT TAT TGC TCA GCG G-3’ M13 forward 5’-TGT AAA ACG ACG GCC AGT-3’ M13 reverse 5’-CAG GAA ACA GCT ATG ACC-3’ Bảng 5. Thành phần PCR nhân cDNA mã hóa h-tPA Thành phần Nồng độ Thể tích (l) H2O - 14,25 Buffer PCR 10X 2,5 MgCl2 25mM 2,5 dNTP 10mM 2,5 Primer F(Mồi xuôi) 10pmol/ul 1,0 Primer R(Mồi ngược) 10pmol/ul 1,0 DNA 6g/ml 1,0 Taq DNA polymerase 5u/l 0,25 Tổng thể tích: 25,0 Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 60 Bảng 6. Thành phần phản ứng xử lý DNA bằng enzyme hạn chế Thành phần Nồng độ Thể tích (l) Buffer Tango 10X 1 BamHI (NdeI) 10u/µl 0,5 XhoI 10u/µl 0,5 DNA 1 µg/µl 2 H2O - 6 Tổng thể tích 10 Bảng 7. Thành phần phản ứng loại phosphate ở vector Thành phần Nồng độ Thể tích (µl) Buffer for CIAP 10X 2,0 CIAP 1u/µl 1,5 Vector (đã xử lý bằng enzyme hạn chế) 1µg/µl 15,0 H2O - 1,5 Tổng thể tích 20 Bảng 8. Thành phần phản ứng ghép nối DNA vào vector Thành phần Nồng độ Thể tích (µl) T4 Buffer 10X 1,0 Vector 10ng/µl 2 Sản phẩm PCR 10ng/µl 5 T4 ligase 5u/µl 1,0 Tổng thể tích 10,0 Số hóa bởi Trung tâm Học liệu – Đại học Thái Nguyên 61 Bảng 9. Thành phần PCR xác định trình tự Thành phần Nồng độ Thể tích (l) Big Dye - 3 Mồi 0,01 µg/µl 1,275 Buffer 2,5X 3 DNA plasmid 10ng/µl 3 H2O - 4,725 Tổng thể tích 15 Bảng 10. Thành phần gel polyacrylamide Thành phần Nồng độ Gel cô 4% (Stacking gel) Gel tách 10% (Separating gel) Tris- HCl, pH=6,8 0,5M 0,75 ml - Tris- HCl, pH= 8,8 1,5M - 2,25 ml SDS 10% 30 l 90 l Acrylamide 30% 0,4 ml 3,02 ml H2O - 1,8 ml 3,55 ml APS 10% 15 l 45 l TEMED - 3 l 4,5 l Tổng thể tích 3 ml 9 ml

Các file đính kèm theo tài liệu này:

  • pdftailieutonghop_com_doc_280_4895.pdf
Luận văn liên quan