Bước đầu xác định đặc trưng phân tử và chức năng các gene ứng viên liên quan đến tính kháng bệnh ghẻ củ do vi khuẩn streptomyces scabies ở khoai tây bằng tin sinh học và công nghệ Mirna

Phần mêm WMD3 đã đưa ra 28 amiRNA tiềm năng cho trình tự CV470003.1. Trong đó amiRNA1 có trình tự UAUCAUUCGUGCAGUUUGCAU được lựa chọn để thực hiện các nghiên cứu tiếp theo. Sử dụng công cụ blast trong WMD3, phát hiện amiRNA-1 còn có khả năng “làm câm” một trình tự mục tiêu khác là DN589430.1 là một cDNA được tạo ra từ của khoai tây bị nhiễm bệnh mốc sương. Mức đồng nhất của trình tự CV470003.1 và DN589430.1 là 91% (BLAST). Do vậy, các trình tự này có thể cùng liên quan đến cơ chế kháng/nhiễm trước tác nhân gây bệnh bất kỳ. amiRNA-1 đã được nhân dòng và đã thiết kế thành công vector biểu hiện ở thực vật pPS1 có mang amiRNA-1. Vector này sau đó được chuyển vào cây khoai tây để đánh giá tác động của nó đến sự biểu hiện của gen TXT1.

doc4 trang | Chia sẻ: lylyngoc | Ngày: 21/11/2013 | Lượt xem: 1756 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Bước đầu xác định đặc trưng phân tử và chức năng các gene ứng viên liên quan đến tính kháng bệnh ghẻ củ do vi khuẩn streptomyces scabies ở khoai tây bằng tin sinh học và công nghệ Mirna, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
BƯỚC ĐẦU XÁC ĐỊNH ĐẶC TRƯNG PHÂN TỬ VÀ CHỨC NĂNG CÁC GENE ỨNG VIÊN LIÊN QUAN ĐẾN TÍNH KHÁNG BỆNH GHẺ CỦ DO VI KHUẨN STREPTOMYCES SCABIES Ở KHOAI TÂY BẰNG TIN SINH HỌC VÀ CÔNG NGHỆ MIRNA Nguyễn Thị Thùy Linh, Nguyễn Thị Phương Thảo*, Nguyễn Thị Thủy Đại học Nông Nghiệp Hà Nội *Liên hệ: Bộ môn Công nghệ sinh học Thực vật, Khoa CNSH, ĐH NNHN; Email: ntpthao@hua.edu.vn TÓM TẮT Gene TXR1 ở Arabidopsis thaliana mã hóa cho một protein có vai trò trong sự điều hòa vận chuyển thaxtomin A - tác nhân chính gây ra bệnh ghẻ củ khoai tây vào trong tế bào. Protein TXR1 có các trình tự tương đồng cao trên các loài thực vật khác nhau, thậm chí trên cả động vật và người. Trình tự bảo tồn của TXR1 (từ vị trí 204 đến vị trí 554 trên mRNA TXR1) đã được nhân dòng và xác định trình tự trên giống khoai tây Atlantic, đồng thời xác định trình tự này cũng có 3 intron và 4 exon. Bên cạnh đó, một trình tự khác cũng có khả năng liên quan đến cơ chế kháng/nhiễm bệnh ghẻ củ khoai tây là CV470003.1 cũng đã được nhân dòng. AmiRNA là công cụ hiệu quả cho việc làm câm gene, ứng dụng trong nghiên cứu chức năng ở thực vật. Dựa vào khung ath-miR319a precursor, cấu trúc vector mang trình tự amiRNA-1 đặc hiệu cho gene mục tiêu là CV470003.1 đã thiết kế. Cấu trúc này sau đó được chuyển vào khoai tây để đánh giá tác động của amiRNA-1 đến sự biểu hiện của gen mục tiêu. Từ khóa: amiRNA, common scab, miRNA, thaxtomin A, TXR1 gene. ĐẶT VẤN ĐỀ Trong số nhiều bệnh gây hại trên khoai tây, bệnh ghẻ gây hại bởi vi khuẩn Streptomyces scabies là một trong những bệnh nghiêm trọng, phân bố rộng và xảy ra ở hầu hết các vùng trồng khoai tây trên thế giới (Lambert và Loria, 1989). Bệnh gây ảnh hưởng nghiêm trọng đến năng suất và phẩm chất củ. Theo điều tra của Đặng Thị Dung và cộng sự (2003), hầu hết các vùng trồng khoai tây ở Việt Nam đều bị ảnh hưởng bởi bệnh này. Thaxtomin A được cho là nguyên nhân gây bệnh ghẻ củ ở khoai tây (Delserone và cộng sự, 1991; Acuna và cộng sự, 2001). Năm 2003, Scheible và cộng sự công bố phát hiện của họ về đột biến kháng với thaxtomin A ở Arabidopsis, gọi là txr1. Ông cũng tìm được gen tương ứng với đột biến này là TXR1, gen này mã hoá cho một protein mới có trình tự bảo thủ tương đồng với tất các các sinh vật nhân thật. Protein được mã hóa bởi gene TXR1 được giả thuyết là có vai trò điều hòa hoặc tham gia vào quá trình vận chuyển thaxtomins vào trong tế bào. Dựa vào các thông tin đã công bố, nghiên cứu này được tiến hành nhằm xác định ở khoai tây có gene TXR1 hay không và gene này có vai trò như thế nào trong cơ chế kháng hay nhiễm bệnh ghẻ củ ở khoai tây? Công nghệ miRNA được phát triển gần đây đã và đang tỏ ra là công cụ hiệu quả để điều hoà ức chế các gen đơn hoặc các nhóm gen khác nhau trên cơ sở các trình tự đặc hiệu. Việc sử dụng thành công các miRNA nhân tạo để điều hoà ức chế các gen cũng đã được công bố trên các cây hai lá mầm như Arabidopsis, cà chua và thuốc lá và cây một lá mầm như lúa (Parizotto và cộng sự, 2004; Alvarez và cộng sự, 2006; Schwab và cộng sự, 2006; Warthmann và cộng sự, 2008). Trong đề tài này, chúng tôi đã sử dụng các công cụ tin sinh học, nhân dòng và miRNA nhằm bước đầu tìm hiểu về trình tự và chức năng của các gen ứng viên cho TXR1. Các phát hiện về gene TXR1 ở khoai tây sẽ góp phần cung cấp thông tin về cơ sở di truyền của tính kháng, làm sáng tỏ cơ chế hoạt động của thaxtomins ở khoai tây ở mức phân tử và từ đó sẽ góp phần phát triển các chiến lược phòng chống bệnh mới trên khoai tây và các cây trồng khác. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU Vật liệu: DNA chiết tách từ mô lá giống atlantic Các vector Vector khung- pRS300 chứa ath-miR319a precursor (cung cấp bởi Detlef Weigel, Department of Molecular Biology, Max Planck Institute for Developmental Biology, Germany). Vector nhân dòng pZET1.2/blunt (Fermentas). Vector biểu hiện pPS1 (cung cấp bởi Walter de Jong, Cornell University, USA). Tìm kiếm, phân tích các trình tự tương đồng Sử dụng công cụ BLAST trên NCBI với các cơ sở dữ liệu khác nhau (EST, HTGS) và công cụ ORF Finder để phân tích các đặc trưng của trình tự. Nhân dòng gene và đọc trình tự Sử dụng vector pZET1.2/blunt (Fermentas). Xác định trình tự nhân dòng theo bộ kit Bigdye terminator v3.1 và kết quả giải trình tự được xử lý bằng phần mềm DNAstar (Lasergene v7.1). Thiết kế vector biểu hiện ở thực vật mang amiRNA (miRNA nhân tạo) Sử dụng WMD3 để thiết kế amiRNA đặc thù cho trình tự mRNA mục tiêu. Nhân dòng các amiRNA sử dụng vector RS300 theo quy trình của Rebecca Schwab và cộng sự (2006). Sản phẩm nhân dòng được tái tổ hợp vào vector pPSI để tạo nên vector biểu hiện ở thực vật KẾT QUẢ VÀ THẢO LUẬN Tìm kiếm, phân tích các trình tự tương đồng Kết quả tìm kiếm trình tự các gene ứng viên TXR1 ở khoai tây cho thấy có tính đồng nhất cao giữa CX161514.1, DN849236.1, CK852098.1 với trình tự gene TXR1 (NM_115790) ở Arabidopsis (lần lượt là 72%, 72%, 71%) và với trình tự gene ứng viên TXR1 ở cà chua (AI781901.1) (lần lượt là 96%, 96%, 95%). Kết quả căn trình tự ở mức độ nucleotide và amino acid cho thấy: vùng bảo thủ nằm ở vị trí 138-482 trên CX161514.1, vị trí 114-458 trên DN849236.1 và 112-156 trên CK852098; tương ứng với vị trí 204-554 trên trình tự mRNA của gene TXR1 (NM_115790.2) ở Arabidopsis và vị trí 158-502 trên trình tự gene ứng viên TXR1 ở cà chua (AI781901.1). Kết quả tìm kiếm trình tự gene ứng viên TXR1 ở khoai tây cũng cho thấy, trình tự CV470003.1 cũng có tính đồng nhất cao với trình tự TXR1 (NM_115790.2) ở Arabidopsis (71%) và với trình tự gene ứng viên TXR1 ở cà chua (95%). Đây là trình tự cDNA thu được khi củ khoai tây bị nhiễm bệnh ghẻ. Bởi vậy rất có thể trình tự này cũng có liên quan đến sự cảm ứng kháng/nhiễm bệnh ghẻ trên khoai tây.Từ các trình tự tương đồng trên, 2 nhóm trình tự được lựa chọn như sau: Nhóm 1: gồm các trình tự CX161514.1, DN849236.1, CK852098.1. Nhóm 2: gồm trình tự CV470003.1 Trên Arabidopsis thaliana, dựa vào sự so sánh trình tự cDNA (NM_115790.2) với trình tự genome (At3g59280, mã số genbank: AI112727.1) đã chứng tỏ rằng gene TXR1 bao gồm 3 và 4 exon (Scheible và cộng sự, 2003). Kết quả phân tích các trình tự gene ứng viên TXR1 ở khoai tây cho thấy các trình tự này cũng mang 3 intron và 4 exon. Hình 1 : Sản phẩm PCR với cặp mồi F7-R7 trên giống Atlantic Nhân dòng các gene ứng viên 11 cặp mồi khác nhau được thiết kế cho nhóm trình tự thứ nhất để thực hiện nhân dòng bằng PCR, trong đó cặp mồi F7-R7 thiết kế cho vị trí vùng bảo thủ, các cặp mồi còn lại được thiết kế nhằm nhân toàn bộ chiều dài của gene. Kết quả PCR cho thấy, chỉ có cặp mồi F1-R5, F1-R6 và F7-R7 cho sản phẩm, trong đó chỉ có sản phẩm nhân bằng cặp mồi F7-R7 cho sản phẩm có kích thước như dự đoán (900-950 bp) (Hình 1). Với kích thước này có thể trình tự nhân được có chứa 2 intron (intron số 2, 3) và 3 exon (số 2, 3, 4). Để kiểm chứng dự đoán về cấu trúc của trình tự vừa nêu, các sản phẩm này được xác định trình tự. Kết quả cho thấy, chỉ có sản phẩm được nhân lên bằng cặp mồi F7-R7 (gọi là At-F7R7) liên quan đến trình tự mục tiêu. Sản phẩm này có kích thước 917 nts, đúng như dự đoán của về kích thước của sản phẩm. Kết quả BLAST cho thấy trình tự này có tính đồng nhất cao nhất với các trình tự ứng viên TXR1 ở khoai tây là 100%. Phân tích trình tự cũng cho thấy trình tự này đồng nhất với các trình tự EST của các gene ứng viên TXR1 của khoai tây ở 3 vùng, chứng tỏ trình tự này có chứa 3 exon (exon 2, 3, 4) và 2 intron (intron 2, 3). Như vậy , có thể kết luận đoạn At-F7R7 nhân được chính là môt phần của gene TXR1 mục tiêu. Trình tự At-F7R7 được thiết kế nằm trên vùng bảo thủ và được đặt tên TXR1-potato-1. Kết quả BLAST và kết quả căn trình tự nucleotide và amino acid dự đoán, cùng với thông tin dự đoán cấu trúc polypeptide của TXR1-potato-1 cho thấy, đoạn TXR1-potato-1 có chứa 2 intron (intron 2 và 3) có kích thước lần lượt là 412, 104 nts và 3 exon (exon 2, 3, 4) có kích thước lần lượt là 91, 131, 119 nts. Chúng tôi đưa ra mô hình cấu trúc đoạn TXR1-potato-1 như hình 2. Hình 2: Mô hình cấu trúc đoạn TXR1-potato-1 nhân dòng từ Atlantic 3’ UTR: trình tự 3’ không mã hóa E2, E3, E4: exon 2, exon 3, exon 4 I2, I3: intron 2, intron 3 Các vị trí được đánh số theo trình tự TXR1-potato-1 Mục tiêu tiếp theo là thiết kế các amiRNA dựa vào thông tin chính xác về trình tự ở vùng bảo thủ của gene đã có để nghiên cứu chức năng của gene TXR1 trong tính kháng/nhiễm bệnh ghẻ ở khoai tây. Tương tự đối với trình tự CV470003.1, chúng tôi đã thiết kế cặp mồi nhân dòng F3-R3. Kết quả PCR (hình 3) cho thấy, kích thước của sản phẩm phù hợp với dự đoán là đoạn nhân dòng có thể mang cả 3 intron hoặc mang 2 intron (intron 2+3). Thiết kế vector biểu hiện mang amiRNA đặc hiệu cho trình tự CV470003.1 Hình 3: Kết quả nhân PCR trình tự CV470003.1 trên giống Atlantic bằng cặp mồi F3, R3 Phần mêm WMD3 đã đưa ra 28 amiRNA tiềm năng cho trình tự CV470003.1. Trong đó amiRNA1 có trình tự UAUCAUUCGUGCAGUUUGCAU được lựa chọn để thực hiện các nghiên cứu tiếp theo. Sử dụng công cụ blast trong WMD3, phát hiện amiRNA-1 còn có khả năng “làm câm” một trình tự mục tiêu khác là DN589430.1 là một cDNA được tạo ra từ của khoai tây bị nhiễm bệnh mốc sương. Mức đồng nhất của trình tự CV470003.1 và DN589430.1 là 91% (BLAST). Do vậy, các trình tự này có thể cùng liên quan đến cơ chế kháng/nhiễm trước tác nhân gây bệnh bất kỳ. amiRNA-1 đã được nhân dòng và đã thiết kế thành công vector biểu hiện ở thực vật pPS1 có mang amiRNA-1. Vector này sau đó được chuyển vào cây khoai tây để đánh giá tác động của nó đến sự biểu hiện của gen TXT1. KẾT LUẬN Sử dụng các công cụ tin sinh, đã mô phỏng được cấu trúc của gene ứng cử viên TXR1 ở khoai tây có chứa 4 exon với độ lớn lần lượt là 61, 91, 131, 119 nts và 3 intron với kích thước tương ứng là 3053, 412, 104 nts. Bằng thực nghiệm, đã nhân dòng và xác định trình tự thành công trình tự bảo tồn của TXR1 (từ vị trí 204 đến vị trí 554 của mRNA TXR1) trên giống khoai tây Atlantic; đoạn nhân được có kích thước 917 bp, mã hóa cho 114 aa, được dự đoán là mang 2 intron (kích thước tương ứng 412, 104 nts) và 3 exon (kích thước tương ứng 91, 131, 119 nts). Đã nhân dòng thành công bằng PCR trình tự CV470003.1 từ khoai tây giống Atlantic với kích thước khoảng 4255 bp và dự đoán gene quy định trình tự này có 4 exon và 3 intron. Thiết kế thành công vector nhân dòng mang trình tự amiRNA-1 đặc hiệu với mục tiêu là CV470003.1. TÀI LIỆU THAM KHẢO Acuna, I.A., Strobel, G.A., Jacobsen, B.L., and Corsini, D.L. (2001). Glucosylation as a mechanism of resistance to thaxtomin A in potatoes. Plant Sci. 161:77–88. Alvarez, J.P., Pekker, I., Goldshmidt, A., Blum, E., Amsellem, Z. and Eshed, Y. (2006). Endogenous and synthetic microRNAs stimulate simultaneous, efficient, and localized regulation of multiple targets in diverse species. Plant Cel. 18:1134–1151. Delserone, L.M., Loria, R., and Arias, I. (1991). Correlation between susceptibility of potato cultivars to Streptomyces scabies and sensitivity to thaxtomin A. Phytopathol. 81:1193–1200. Dung, D.T., Yoshida. H., and Suyama, K. (2003). Susceptibility of different potato varieties against potato common scab in vietnam. J. ISAAS. 9(2):40-46. Lambert, D.H., and Loria, R. (1989). Streptomyces scabies sp. nov., nom. rev. Intern. J. Syst. Bacteriol. 39:387-392. Parizotto, E.A., Dunoyer, P., Rahm, N., Himber, C., and Voinnet, O. (2004). In vivo investigation of the transcription, processing, endonucleolytic activity, and functional relevance of the spatial distribution of a plant miRNA. Genes Dev. 18:2237–2242. Scheible, W.R., Barbara, F., Kochevenko, A., Schindelasch, D., Zimmerli, L., Somerville, S., Loria, R., and Somerville, C.R. (2003). An Arabidopsis Mutant Resistant to Thaxtomin A, a Cellulose Synthesis Inhibitor from Streptomyces Species. Plant Cel. 15(8):1781–1794. Schwab, R., Ossowski, S., Riester, M., Warthmann, N., and Weigel, D. (2006). Highly specific gene silencing by artificial microRNAs in Arabidopsis. Plant Cel. 18:1121–1133. Warthmann, N., Chen, H., Ossowski, S., Weigel, D., and Herve, P. (2008). Highly Specific Gene Silencing by Artificial miRNAs in Rice. PLoS ONE 3(3):e1829. INITIALLY DETERMINE MOLECULAR CHARACTERISTICS AND FUNCTION OF CANDIDATE GENES RELATED TO RESISTANCE OF POTATOES TO COMMON SCAB CAUSED BY STREPTOMYCES SCABIES VIA BIOINFORMATICS AND MIRNA TECHNOLOGY Nguyen Thi Thuy Linh, Nguyen Thi Phuong Thao*, Nguyen Thi Thuy Hanoi university of Agriculture *For correspondence: Department of Plant Biotechnology, Faculty of Biotechnology, HUA; email: ntpthao@hua.edu.vn Summary TXR1 gene of Arabidopsis thaliana encodes a novel protein with homologs in all fully sequenced eukaryotes and this protein regulates the transport of thaxtomin A – the major toxin which causes common scab into plant cells. The conserved sequence of TXR1 gene (nucleotides 204 to 554 on mRNA of TXR1 gene) of the potato variety Atlantic was cloned and sequenced successfully. This sequence contains three introns and four exons. Additionally, another sequence potentially related to the genetic mechanism of resistance/susceptibility to common scab, CV470003.1 was amplified by PCR successfully. AmiRNAs have been proved to be an effective tool for specific gene silencing in plants and amiRNA technology has become a powerful tool for functional genomics research. An amiRNA vector that contains amiRNA-1 which is specific for CV470003.1 was generated based on the structure of ath-miR319a. This vector was used to transform to potato in order to determine the affect of designed amiRNA-1 contruct on the target TXR1 gene. Keywords: amiRNA, common scab, miRNA, thaxtomin A, TXR1 gene.

Các file đính kèm theo tài liệu này:

  • docbc_hn_nong_lam_dhnnhn_linh_1_4535.doc
Luận văn liên quan