Khóa luận Nghiên cứu hiện trạng nhiễm bệnh TSWV (Tomato spotted wilt virus) trên cây ớt bằng kỹ thuật elisa và bước đầu xây dựng phương pháp chẩn đoán bằng kỹ thuật RT - Pcr

NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƯỚC ĐẦU XÂY DỰNG PHưƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT – PCR NGUYỄN ĐÌNH TRƯỜNG MỤC LỤC Trang Trang tựa ii Cảm tạ iii Tóm tắt iv Danh sách các chữ viết tắt vi Mục lục vii Danh sách các bảng xi Danh sách các đồ thị .xi Danh sách các hình xii Danh sách các sơ đồ xii Phần I. Mở Đầu 1 1.1 Đặt vấn đề 1 1.2 Mục Đích - Yêu cầu 1 1.2.1 Mục đích nghiên cứu .1 1.2.2 Yêu cầu 1 Phần II. Tổng Quan Tài Liệu .2 2.1 Giới thiệu về cây ớt .2 2.1.1 Sơ lược về cây ớt .2 2.1.2 Nguồn gốc cây ớt .2 2.1.3 Đặc điểm thực vật học của cây ớt 2 2.1.3.1 Thân .2 2.1.3.2 Rễ .2 2.1.3.3 Lá .2 2.1.3.4 Hoa .3 2.1.3.5 Quả .3 2.1.3.6 Hạt 3 2.1.4 Giá trị dược liệu của cây ớt 3 2.1.5 Giá trị dinh dưỡng của ớt .4 2.2 Một số bệnh trên cây ớt gây ra bởi các virút khác 4 2.3 Yêu cầu điều kiện ngoại cảnh của cây ớt 9 2.3.1 Nhiệt độ 9 2.3.2 Ánh sáng 9 2.3.3 Ẩm độ 9 2.3.4 Đất và dinh dưỡng .9 2.4. Giới thiệu về Tomato spotted Wilt Virus (TSWV) .10 2.4.1 Sơ lược nguồn gốc TSWV .10 2.4.2 Cấu trúc TSWV .10 2.5 Hình thức tấn công và gây bệnh 13 2.6 Triệu chứng chung trên các loại cây trồng bị nhiễm TSWV .14 2.7 Triệu chứng cụ thể trên cây ớt .14 2.8 Con đường lây bệnh và dịch tễ học .15 2.9 Điều kiện cho bệnh phát triển .16 2.10 Khống chế bệnh TSWV .16 2.11 Chẩn đoán bệnh TSWV .18 2.11.1 Phương pháp cây chỉ thị 18 2.11.1.1 Cây nhiễm bộ phận 18 2.11.1.2 Cây nhiễm hệ thống .18 2.11.2 Phương pháp chẩn đoán bằng kính hiển vi điện tử 19 2.12 ELISA 19 2.12.1 Khái niệm về ELISA .19 2.12.2 Phân loại ELISA 20 2.12.2.1 Direct ELISA (ELISA trực tiếp) 20 2.12.2.2 ELISA gián tiếp .21 2.12.2.3 Sandwich ELISA .21 2.12.2.4 Phản ứng ức chế /cạnh tranh 22 2.12.3 Các yếu tố ảnh hưởng đến độ nhạy của phản ứng ELISA .23 2.12.4 Các yếu tố ảnh hưởng đến kết quả ELISA 23 2.13 Giới thiệu về kỹ thuật PCR 23 2.13.1 Nguyên tắc của kỹ thuật PCR 23 2.13.2.Tối ưu hóa các điều kiện cho phản ứng PCR 25 2.13.3 ưu, nhược điểm của kỹ thuật PCR 30 2.13.4 Các vấn đề thường gặp trong phản ứng PCR và hướng giải quyết .31 2.13.4.1 Có nhiều sản phẩm không chuyên biệt có kích thước dài hơn 31 2.13.4.2 Có nhiều sản phẩm không đặc hiệu với kích thước ngắn hơn .32 2.13.4.3 Không thu được bất kỳ sản phẩm nào 32 2.13.4.4 Sản phẩm quá yếu 33 2.13.4.5 Hai primer có nhiệt độ Tm khác nhau .33 2.14 Phương pháp RT-PCR .33 2.14.1 Phân loại RT – PCR .33 2.14.1.1 Phản ứng RT – PCR một bước 33 2.14.1.2 Phản ứng RT – PCR hai bước 34 2.14.2 Các phương pháp được thực hiện trong phản ứng tổng hợp cDNA 34 2.15 Những nghiên cứu trong nước và trên thế giới về mức độ gây hại của TSWV 35 2.15.1 Những nghiên cứu tại Việt Nam 35 2.15.2 Những nghiên cứu trên thế giới .35 Phần III. Vật Liệu và Phương Pháp Nghiên Cứu 36 3.1 Thời gian và địa điểm nghiên cứu .36 3.2 Phương pháp điều tra và lấy mẫu 36 3.3 Phương pháp lấy mẫu 36 3.4 Các phương pháp chẩn đoán TSWV .37 3.4.1 Chẩn đoán bằng dDAS – ELISA .37 3.4.1.1 Dụng cụ và hoá chất cần thiết cho việc chẩn đoán bằng ELISA .37 3.4.1.2 Các bước thực hiện 37 3.4.2 Chẩn đoán TSWV bằng RT – PCR .39 3.4.2.1 Giai đoạn ly trích RNA theo Kit ly trích của Biorad .39 3.4.2.2 Kiểm tra sự hiện diện của RNA bằng điện di 40 3.4.2.3 Lựa chọn cặp Primer chạy RT – PCR 40 3.4.2.4 Khuếch đại bằng RT – PCR .41 3.4.2.5 Phướng pháp đổ gel agarose điện di 43 Phần IV. Kết quả Thảo luận .45 4.1 Mức độ nhiễm bệnh TSWV ở 3 xã đại diện cho 3 huyện qua chẩn đoán ELISA .45 4.1.1 Tỷ lệ nhiễm bệnh TSWV theo địa bàn điều tra .45 4.1.2 Tỷ lệ nhiễm TSWV theo từng giống ớt .46 4.1.3 Tỷ lệ nhiễm virút TSWV theo triệu chứng 47 4.1.4 Tỷ lệ nhiễm bệnh TSWV theo độ tuổi .50 4.2 Kết quả tiến trình RT – PCR .51 4.2.1 Kết quả kiểm tra RNA .51 4.2.2 Kết quả kiểm tra Primer .52 4.2.3 Kết quả tiến trình RT – PCR 53 4.2.4 Kết quả tiến trình thiết kế primer cho Nested PCR .54 Phần V. Kết luận và đề nghị .60 5.1 Kết luận 60 5.2 Đề nghị 60 Phần VI. TÀI LIỆU THAM KHẢO 61 PHẦN VII. PHỤ LỤC .64 NGHIÊN CỨU HIỆN TRẠNG NHIỄM BỆNH TSWV (Tomato spotted wilt virus) TRÊN CÂY ỚT BẰNG KỸ THUẬT ELISA VÀ BƯỚC ĐẦU XÂY DỰNG PHưƠNG PHÁP CHẨN ĐOÁN BẰNG KỸ THUẬT RT - PCR

pdf85 trang | Chia sẻ: lvcdongnoi | Ngày: 04/06/2013 | Lượt xem: 1833 | Lượt tải: 4download
Bạn đang xem nội dung tài liệu Khóa luận Nghiên cứu hiện trạng nhiễm bệnh TSWV (Tomato spotted wilt virus) trên cây ớt bằng kỹ thuật elisa và bước đầu xây dựng phương pháp chẩn đoán bằng kỹ thuật RT - Pcr, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
theo kết quả trên thì các triệu chứng nghi ngờ đều có thể tin cậy đƣợc, bởi vì kết quả chẩn đoán bằng ELISA đều cho thấy tỉ lệ nhiễm TSWV cũng khá cao (57%). Bên cạnh đó còn một điều lƣu ý là hầu nhƣ những lá bị khảm vàng đều có thể đã bị nhiễm TSWV, nhƣng mức độ nặng hay nhẹ thì phải qua chẩn đoán mới có kết luận chính xác. Có những lá nhìn bề ngoài thì không thấy triệu chứng gì nhƣng khi kiểm tra vẫn phát hiện bệnh. Điều này có thể lý giải là bệnh chỉ ở giai đoạn đ ầu khi virút vừa xâm nhập, chƣa đủ thời gian để biểu hiện triệu chứng ra bên ngoài. 37,5 57 53 25 0 10 20 30 40 50 60 Tỷ lệ (%) Xaõ Khảm vàng xanh, lá cong Lá chấm vàng xanh, nhăn, dày Khảm nặng, chấm đen, lủng lỗ Khảm vàng nhạt trên rìa lá, lá n h ỏ Đồ thị 4.2: Tỷ lệ bệnh theo triệu chứng  Nhƣ vậy, chúng ta thấy trong tất cả các triệu chứng trên không xuất hiện triệu chứng là các đốm vòng tròn đồng tâm (đây lại là triệu chứng chính của virút TSWV), nhƣng kiểm tra vẫn phát hiện bệnh. Do đó không thể chỉ dựa vào một triệu chứng là các vòng tròn đồng tâm mà phải kết hợp với các triệu chứng nêu trên mới có thể chẩn đoán trên đồng ruộng một cách khá tốt rằng cây ớt có bị nhiễm bệnh TSWV Triệu chứng Số mẫu điều tra Số mẫu nhiễm % mẫu nhiễm Khảm vàng xanh, lá cong 8 3 37, Lá chấm vàng xanh, nhăn, dày,giòn 7 4 57 Khảm nặng, chấm đen, lủng lỗ 15 8 53 Khảm vàng nhạt trên rìa lá, lá nhỏ 8 2 25 50 hay không. Bên cạnh việc xác định bệnh trên lá, chúng tôi cũng tiến hành kiểm tra trên trái ớt, với kết quả nhƣ sau: 67% 33% Không nhiễm Trái nhiễm Đồ thị 4.3: Tỷ lệ nhiễm TSWV trên trái ớt  Từ những thực tế trên đồng ruộng cho thấy rằng: để phát hiện bệnh mà chỉ dựa vào triệu chứng là những đốm vòng tròn đồng tâm thì khó có thể phát hiện đƣợc. Bởi vì có những trái ớt có triệu chứng là những vòng tròn đồng tâm nhƣng rất giống với triệu chứng của bệnh thán thƣ, nên rất khó phân biệt. 4.1.4 Tỷ lệ nhiễm bệnh TSWV theo độ tuổi Việc đánh giá tỉ lệ bệnh theo độ tuổi là rất khó và không thực hiện đƣợc vì khi tiến hành lấy mẫu ớt thì các vƣờn ớt đều đã vào cuối vụ, đã cho trái đợt hai. Nhƣ chúng ta đã biết, bệnh virút là bệnh không điều trị đƣợc. Cây khi bị nhiễm virút thì bắt buộc phải loại bỏ, nhƣng nếu làm nhƣ vậy thì sẽ ảnh hƣởng rất lớn đến hiệu quả kinh tế của các nông hộ. Do đó tính cấp thiết của vấn đề là khi bệnh chƣa bùng phát thành dịch thì phải có biện pháp phòng ngừa kịp thời, có chiến lƣợc quản lý nguồn giống trƣớc khi đƣa vào canh tác để đem lại hiệu quả kinh tế cho bà con nông dân. 51 4.2 Kết quả tiến trình RT – PCR 4.2.1 Kết quả kiểm tra RNA Hình 4.7: Kết quả điện di RNA  Chú thích: + Giếng 1: mẫu cDNA 1 đã qua bƣớc reverse transcription + Giếng 2: mẫu cDNA 2 đã qua bƣớc reverse transcription + Giếng 3: mẫu RNA 1 tổng số vừa ly trích xong + Giếng 4: mẫu RNA 1 đã qua xử lý RNase, ủ ở 37oC trong 1 giờ + Giếng 5: mẫu RNA 2 tổng số vừa ly trích + Giếng 6: mẫu RNA 3 tổng số vừa ly trích  Nhận định chung: + Từ giếng số 3 và 4 cho thấy, cũng một mẫu RNA tổng số sau khi ly trích nhƣng khi đƣợc xử lý với RNase thì vệt băng mờ hẳn đi. Điều này có thể phần nào khẳng định rằng trong mẫu ly trích có chứa RNA tổng số nhƣng có thể chƣa khẳng định đƣợc là có tồn tại RNA của virút TSWV nhƣ mong muốn không. Ở đây sẽ có một điều khó hiểu là tại sao RNA sợi đơn lại có thể bắt đƣợc với các phân tử ethidium bromide để phát sáng dƣới tia UV, từ thắc mắt này chúng tôi đã tìm hiểu và biết rằng các phân tử ethidium bromide không có một cơ chế bắt cặp đặc hiệu với sợi đôi DNA, ethidium bromide có thể xen vào các khe hở giữa các phân tử, nó tồn tại ở đó và sẽ phát sáng dƣới tia UV (đòi hỏi hàm lƣợng các phân tử phải khá cao) 52 + Ở giếng 1 và giếng 2 chúng tôi tiến hành chạy sản phẩm cDNA, nhƣng không cho bất kỳ kết quả nào. Điều này có thể giải thích: bƣớc reverse transcription để chuyển RNA thành cDNA với tổng thể tích là 20µl nhƣng chỉ chứa 2µl RNA tổng số, rồi từ 20µl cDNA đó ta chỉ hút 4µl để chạy điện di. Nhƣ vậy có thể hàm lƣợng cDNA quá thấp chƣa tới ngƣỡng phát hiện, do đó không thể phát hiện khi nhuộm với ethidium bromide và chụp dƣới tia UV. + Ở giếng 5 và giếng 6 không thấy vệt băng xuất hiện. Điều này có thể kết luận là quá trình ly trích không thành công hoặc lƣợng RNA quá ít không thể phát hiện đƣợc. 4.2.2 Kết quả kiểm tra Primer Sau khi thực hiện Blast để kiểm tra primer thì có kết quả sau:  Chỉ có một vị trí gắn duy nhất trên gen đích và không hề có vị trí gắn nào khác trên sợi bổ sung  Ngoài cá thể cần khuếch đại thì cặp primer này chỉ có thể khuếch đại với một số cá thể sau: 1: AY070218 Tomato spotted wilt virus RNA-dependent RNA polymerase (L) gene, complete cds gi|27461077|gb|AY070218.1|[27461077] 2: AB190813 Tomato spotted wilt virus RNA segment L, complete sequence gi|52421192|dbj|AB190813.1|[52421192] 3: D10066 Tomato spotted wilt virus L RNA encoding RNA polymerase, complete cds gi|222680|dbj|D10066.1|TSWLRPOLM[222680] 4: Z66548 Puumala virus segment L, genomic RNA, strain Sotkamo gi|1292880|emb|Z66548.1|PVLSOTKMO[1292880] 5: AB198742 Tomato spotted wilt virus gene for L protein, complete cds gi|57635879|dbj|AB198742.1|[57635879] 53  Cặp primer đã chọn L1 TSWV R 5’-AAT TGC CTT GCA ACC AAT TC-3’ L2 TSWV F 5’-ATC AGT CGA AAT GGT CGG CA-3’ 4.2.3 Kết quả tiến trình RT – PCR Kết quả RT – PCR hai bƣớc Tiến trình chạy RT – PCR hai bƣớc không cho kết quả dƣơng tính đối với virút TSWV. Điều này theo chúng tôi có thể do những nguyên nhân sau:  Genome L (long) của virút TSWV không có đuôi polyA, nhƣ vậy sẽ rất khó khăn trong việc tổng hợp cDNA. Việc tổng hợp cDNA chủ yếu dựa vào các primer (mồi) ngẫu nhiên là các đoạn 6 nucleotide.  Việc tổng hợp cDNA bằng các primer nhẫu nhiên đôi khi không cho kết quả là những sản phẩm có chứa đoạn gen cần khuếch đại  Hàm lƣợng RNA quá thấp, nên lƣợng cDNA đƣợc tạo ra cũng rất thấp. Điều này có thể dẫn đến xác suất hút ra để chạy PCR đôi khi là rất thấp hoặc không có. Kết quả RT – PCR một bƣớc Hình 4.8: Kết quả chạy đối chứng dƣơng Sản phẩm đối chứng 323bp 54  Nhận định chung: Sau khi chạy RT – PCR một bƣớc có kèm đối chứng dƣơng thì chỉ có đối chứng cho sản phẩm chỉ một băng duy nhất còn mẫu bệnh ly trích thì không cho kết quả dƣơng tính. Tới đây chúng tôi mới đề xuất phƣơng án để khắc phục hiện tƣợng số lƣợng RNA khuôn mẫu quá ít là làm sao phải thiết kế đƣợc một cặp primer nữa, cặp primer này sẽ phủ bên ngoài cặp primer hiện đang dùng, mục đích là để chạy Nested PCR. 4.2.4 Kết quả tiến trình thiết kế primer cho Nested PCR  Sự cần thiết phải chọn giải pháp RT – PCR kết hợp Nested PCR Bƣớc chẩn đoán virút TSWV bằng phƣơng pháp ELISA cho kết quả dƣơng tính rất yếu, điều này có thể do lƣợng virút nhiễm (RNA khuôn mẫu) rất thấp, khó có thể phát hiện bằng PCR với một cặp Primer. Do đó phải dùng phƣơng pháp Nested PCR  Bƣớc thiết kế Primer dùng cho Nested PCR Để đảm bảo sản phẩm PCR sau cùng không thay đổi về kích thƣớc, chúng tôi tiến hành thiết kế một cặp primer mới (ứng dụng phần mềm PCGEN), cặp primer này sẽ phủ bên ngoài cặp primer cũ. Nhƣ vậy qua bƣớc PCR thứ nhất với cặp primer mới sẽ tạo ra sản phẩm có kích thƣớc lớn hơn sản phẩm mong đợi. Từ đây ta trích ra một thể tích để chạy tiếp PCR với cặp primer cũ và có thể thu đƣợc sản phẩm PCR với kích thƣớc mong đợi. Sau khi tiến hành thiết kế primer bằng phần mềm PCGEN cho việc chạy Nested PCR, chúng tôi đã thiết kế đƣợc rất nhiều primer đơn bắt vào sợi sense, primer đơn bắt vào sợi antisense, cặp primer bắt vào cả hai sợi với các thông số đòi hỏi đƣợc đƣa ra nhƣ sau:  Các thông số về primer  Chiều dài primer tối ƣu là 20bp  Chiều dài primer chấp nhận đƣợc là từ 15 – 25bp  Độ lặp lại của các base đơn tối đa là 3 lần  Số lƣợng base GC ở đầu 3’ là 2  % GC chấp nhận đƣợc: 40 – 60%  Các thông số gắn kết của primer  Số lƣợng tối đa các base đối với sự tự bắt cặp của 2 primer là 4 55  Vùng cuộn lại (stem – loop) có thể chấp nhận đƣợc tối đa là 4  % các base tối đa mà có thể bắt cặp bổ sung với các vùng trên các khuôn mẫu khác là 70%  Thông số về nhiệt độ nóng chảy (Tm)  Tm tối ƣu: 64oC  Dãy Tm chấp nhận đƣợc: 49 – 79 Các primer đơn đạt chuẩn về thành phần và vị trí gắn đối với sợi (+) |STT |Trình tự primer (5' --> 3') | bp | Tm | delG | %GC |Vùng bắt cặp | P1 | CATGTAGCGCAGAGTGATCCATCGG | 25 | 64 | -53 | 56 | 187-211 | | P2 | AGCGCAGAGTGATCCATCGGAAGC | 24 | 65 | -54 | 58 | 192-215 | | P3 | TAGCGCAGAGTGATCCATCGGAAGC | 25 | 65 | -55 | 56 | 191-215 | | P4 | TGTAGCGCAGAGTGATCCATCGG | 23 | 62 | -50 | 57 | 189-211 | | P5 | ATGTAGCGCAGAGTGATCCATCGG | 24 | 62 | -51 | 54 | 188-211 | | P6 | CGCAGAGTGATCCATCGGAAGC | 22 | 61 | -49 | 59 | 194-215 | | P7 | CATGTAGCGCAGAGTGATCCATCG | 24 | 61 | -50 | 54 | 187-210 | | P8 | GCAGAGTGATCCATCGGAAGCC | 22 | 60 | -49 | 59 | 195-216 | | P9 | AGCGCAGAGTGATCCATCGGAAGCC | 25 | 68 | -57 | 60 | 192-216 | | P10 | GTAGCGCAGAGTGATCCATCGG | 22 | 59 | -48 | 59 | 190-211 | | P11 | ATGTAGCGCAGAGTGATCCATCG | 23 | 59 | -48 | 52 | 188-210 | | P12 | TGCTTGAATTTGTCATGTCCAAGG | 24 | 59 | -49 | 42 | 26-49 | | P13 | ATGCTTGAATTTGTCATGTCCAAGG | 25 | 59 | -50 | 40 | 25-49 | | P14 | GCAGATGCTTGAATTTGTCATGTCC | 25 | 59 | -50 | 44 | 21-45 | | P15 | AGCGCAGAGTGATCCATCGG | 20 | 58 | -46 | 60 | 192-211 | | P16 | TAGCGCAGAGTGATCCATCGG | 21 | 58 | -47 | 57 | 191-211 | | P17 | TGTAGCGCAGAGTGATCCATCG | 22 | 58 | -47 | 55 | 189-210 | | P18 | CAGAGTGATCCATCGGAAGCC | 21 | 57 | -46 | 57 | 196-216 | | P19 | GCAGAGTGATCCATCGGAAGC | 21 | 57 | -46 | 57 | 195-215 | | P20 | ACGTTATCTTTGGACACAATCACG | 24 | 56 | -47 | 42 | 256-279 | | P21 | TACGTTATCTTTGGACACAATCACG | 25 | 56 | -48 | 40 | 255-279 | | P22 | CATCGGAAGCCATATCTATAAGTGG | 25 | 56 | -50 | 44 | 206-230 | | P23 | GTAGCGCAGAGTGATCCATCG | 21 | 56 | -45 | 57 | 190-210 | 56 | P24 | GCTTGAATTTGTCATGTCCAAGG | 23 | 56 | -47 | 43 | 27-49 | | P25 | CAGATGCTTGAATTTGTCATGTCC | 24 | 56 | -47 | 42 | 22-45 | | P26 | CGTTATCTTTGGACACAATCACG | 23 | 55 | -46 | 43 | 257-279 | | P27 | ATCGGAAGCCATATCTATAAGTGG | 24 | 54 | -48 | 42 | 207-230 | | P28 | AGAGTGATCCATCGGAAGCC | 20 | 54 | -44 | 55 | 197-216 | | P29 | AGCGCAGAGTGATCCATCG | 19 | 54 | -43 | 58 | 192-210 | | P30 | TAGCGCAGAGTGATCCATCG | 20 | 54 | -44 | 55 | 191-210 | | P31 | TCGGAAGCCATATCTATAAGTGG | 23 | 53 | -47 | 43 | 208-230 | | P32 | CAGAGTGATCCATCGGAAGC | 20 | 53 | -43 | 55 | 196-215 | | P33 | GAGTGATCCATCGGAAGCC | 19 | 52 | -42 | 58 | 198-216 | | P34 | CTTGAATTTGTCATGTCCAAGG | 22 | 52 | -44 | 41 | 28-49 | | P35 | GATGCTTGAATTTGTCATGTCC | 22 | 52 | -43 | 41 | 24-45 | | P36 | CATGTAGCGCAGAGTGATCC | 20 | 51 | -42 | 55 | 187-206 | | P37 | GTTATCTTTGGACACAATCACG | 22 | 50 | -42 | 41 | 258-279 | | P38 | AGTGATCCATCGGAAGCC | 18 | 50 | -41 | 56 | 199-216 | | P39 | AGAGTGATCCATCGGAAGC | 19 | 49 | -41 | 53 | 197-215 | | P40 | TGAATTTGTCATGTCCAAGG | 20 | 49 | -40 | 40 | 30-49 | | P41 | TGCTTGAATTTGTCATGTCC | 20 | 49 | -40 | 40 | 26-45 Các primer đạt chuẩn về thành phần và vị trí gắn đối với sợi (-) | STT |Trình tự primer (5' --> 3') | bp | Tm | delG | %GC |Vùng bắt cặp | M1 | GCCTGCAATAGAGAGGAATAATCGC | 25 | 59 | -53 | 48 | 923-947 | | M2 | TGCCTGCAATAGAGAGGAATAATCG | 25 | 59 | -51 | 44 | 924-948 | | M3 | TGCAATAGAGAGGAATAATCGCTCC | 25 | 58 | -51 | 44 | 920-944 | | M4 | CCTGCAATAGAGAGGAATAATCGC | 24 | 56 | -50 | 46 | 923-946 | | M5 | GCCTGCAATAGAGAGGAATAATCG | 24 | 56 | -50 | 46 | 924-947 | | M6 | GCAATAGAGAGGAATAATCGCTCC | 24 | 55 | -49 | 46 | 920-943 | | M7 | GATGTTGCATTATCATCAGAGTGC | 24 | 54 | -45 | 42 | 717-740 | | M8 | CTGCAATAGAGAGGAATAATCGC | 23 | 53 | -46 | 43 | 923-945 | | M9 | CCTGCAATAGAGAGGAATAATCG | 23 | 53 | -46 | 43 | 924-946 | | M10 | TTTATCAACCTCTCCACTGGC | 21 | 52 | -43 | 48 | 748-768 | 57 | M11 | CAATAGAGAGGAATAATCGCTCC | 23 | 52 | -46 | 43 | 920-942 | | M12 | TGCAATAGAGAGGAATAATCGC | 22 | 52 | -45 | 41 | 923-944 | | M13 | TGCACAATCCATCTAGTTTGG | 21 | 51 | -42 | 43 | 699-719 | | M14 | TGTTGCATTATCATCAGAGTGC | 22 | 51 | -42 | 41 | 717-738 | | M15 | GCTTCTAAACAACATTTCTGGC | 22 | 51 | -44 | 41 | 798-819 | | M16 | AATAGAGAGGAATAATCGCTCC | 22 | 49 | -44 | 41 | 920-941 | | M17 | GCAATAGAGAGGAATAATCGC | 21 | 49 | -43 | 43 | 923-943 | | M18 | CTGCAATAGAGAGGAATAATCG | 22 | 49 | -43 | 41 | 924-945 | | M19 | CAGTTTGCTAAATGCCTGC | 19 | 49 | -41 | 47 | 942-960 Các cặp primer đạt chuẩn về vị trí gắn và nhiệt độ Tm | STT Trình tự primer (5' --> 3') | Ta | Tm | delG | %GC |Vùng bắt cặp |---------------------------------------------------------------------------| |P18 |CAGAGTGATCCATCGGAAGCC | 54 | 57 | -46 | 57 | 196-216 | |M1 |GCCTGCAATAGAGAGGAATAATCGC | | 59 | -53 | 48 | 923-947 | | | | | | | | | |P8 |GCAGAGTGATCCATCGGAAGCC | 54 | 60 | -49 | 59 | 195-216 | |M3 |TGCAATAGAGAGGAATAATCGCTCC | | 58 | -51 | 44 | 920-944 | | | | | | | | | |P6 |CGCAGAGTGATCCATCGGAAGC | 54 | 61 | -49 | 59 | 194-215 | |M3 |TGCAATAGAGAGGAATAATCGCTCC | | 58 | -51 | 44 | 920-944 | | | | | | | | | |P28 |AGAGTGATCCATCGGAAGCC | 53 | 54 | -44 | 55 | 197-216 | |M6 |GCAATAGAGAGGAATAATCGCTCC | | 55 | -49 | 46 | 920-943 | | | | | | | | | |P19 |GCAGAGTGATCCATCGGAAGC | 53 | 57 | -46 | 57 | 195-215 | |M3 |TGCAATAGAGAGGAATAATCGCTCC | | 58 | -51 | 44 | 920-944 | | | | | | | | | |P18 |CAGAGTGATCCATCGGAAGCC | 53 | 57 | -46 | 57 | 196-216 | |M5 |GCCTGCAATAGAGAGGAATAATCG | | 56 | -50 | 46 | 924-947 | | | | | | | | | |P18 |CAGAGTGATCCATCGGAAGCC | 53 | 57 | -46 | 57 | 196-216 | |M4 |CCTGCAATAGAGAGGAATAATCGC | | 56 | -50 | 46 | 923-946 | | | | | | | | | |P18 |CAGAGTGATCCATCGGAAGCC | 53 | 57 | -46 | 57 | 196-216 | |M3 |TGCAATAGAGAGGAATAATCGCTCC | | 58 | -51 | 44 | 920-944 | | | | | | | | | |P28 |AGAGTGATCCATCGGAAGCC | 53 | 54 | -44 | 55 | 197-216 | |M5 |GCCTGCAATAGAGAGGAATAATCG | | 56 | -50 | 46 | 924-947 | | | | | | | | | |P28 |AGAGTGATCCATCGGAAGCC | 53 | 54 | -44 | 55 | 197-216 | |M4 |CCTGCAATAGAGAGGAATAATCGC | | 56 | -50 | 46 | 923-946 | | | | | | | | | |P19 |GCAGAGTGATCCATCGGAAGC | 53 | 57 | -46 | 57 | 195-215 | |M6 |GCAATAGAGAGGAATAATCGCTCC | | 55 | -49 | 46 | 920-943 | | | | | | | | | |P18 |CAGAGTGATCCATCGGAAGCC | 53 | 57 | -46 | 57 | 196-216 | |M6 |GCAATAGAGAGGAATAATCGCTCC | | 55 | -49 | 46 | 920-943 | | | | | | | | | |P18 |CAGAGTGATCCATCGGAAGCC | 53 | 57 | -46 | 57 | 196-216 | |M2 |TGCCTGCAATAGAGAGGAATAATCG | | 59 | -51 | 44 | 924-948 | | | | | | | | | 58 |P28 |AGAGTGATCCATCGGAAGCC | 53 | 54 | -44 | 55 | 197-216 | |M2 |TGCCTGCAATAGAGAGGAATAATCG | | 59 | -51 | 44 | 924-948 | | | | | | | | | |P28 |AGAGTGATCCATCGGAAGCC | 53 | 54 | -44 | 55 | 197-216 | |M1 |GCCTGCAATAGAGAGGAATAATCGC | | 59 | -53 | 48 | 923-947 | | | | | | | | | |P8 |GCAGAGTGATCCATCGGAAGCC | 53 | 60 | -49 | 59 | 195-216 | |M6 |GCAATAGAGAGGAATAATCGCTCC | | 55 | -49 | 46 | 920-943 | | | | | | | | | |P12 |TGCTTGAATTTGTCATGTCCAAGG | 54 | 59 | -49 | 42 | 26-49 | |M2 |TGCCTGCAATAGAGAGGAATAATCG | | 59 | -51 | 44 | 924-948 | | | | | | | | | |P12 |TGCTTGAATTTGTCATGTCCAAGG | 54 | 59 | -49 | 42 | 26-49 | |M1 |GCCTGCAATAGAGAGGAATAATCGC | | 59 | -53 | 48 | 923-947 | | | | | | | | | |P12 |TGCTTGAATTTGTCATGTCCAAGG | 54 | 59 | -49 | 42 | 26-49 | |M3 |TGCAATAGAGAGGAATAATCGCTCC | | 58 | -51 | 44 | 920-944 | | | | | | | | | |P24 |GCTTGAATTTGTCATGTCCAAGG | 53 | 56 | -47 | 43 | 27-49 | |M5 |GCCTGCAATAGAGAGGAATAATCG | | 56 | -50 | 46 | 924-947 | | | | | | | | | |P24 |GCTTGAATTTGTCATGTCCAAGG | 53 | 56 | -47 | 43 | 27-49 | |M4 |CCTGCAATAGAGAGGAATAATCGC | | 56 | -50 | 46 | 923-946 | | | | | | | | | |P24 |GCTTGAATTTGTCATGTCCAAGG | 53 | 56 | -47 | 43 | 27-49 | |M6 |GCAATAGAGAGGAATAATCGCTCC | | 55 | -49 | 46 | 920-943 | | | | | | | | | |P24 |GCTTGAATTTGTCATGTCCAAGG | 53 | 56 | -47 | 43 | 27-49 | |M3 |TGCAATAGAGAGGAATAATCGCTCC | | 58 | -51 | 44 | 920-944 | | | | | | | | | |P24 |GCTTGAATTTGTCATGTCCAAGG | 53 | 56 | -47 | 43 | 27-49 | |M2 |TGCCTGCAATAGAGAGGAATAATCG | | 59 | -51 | 44 | 924-948 | | | | | | | | | |P24 |GCTTGAATTTGTCATGTCCAAGG | 53 | 56 | -47 | 43 | 27-49 | |M1 |GCCTGCAATAGAGAGGAATAATCGC | | 59 | -53 | 48 | 923-947 | | | | | | | | | |P25 |CAGATGCTTGAATTTGTCATGTCC | 53 | 56 | -47 | 42 | 22-45 | |M5 |GCCTGCAATAGAGAGGAATAATCG | | 56 | -50 | 46 | 924-947 | | | | | | | | | |P25 |CAGATGCTTGAATTTGTCATGTCC | 53 | 56 | -47 | 42 | 22-45 | |M4 |CCTGCAATAGAGAGGAATAATCGC | | 56 | -50 | 46 | 923-946 | | | | | | | | | |P25 |CAGATGCTTGAATTTGTCATGTCC | 53 | 56 | -47 | 42 | 22-45 | |M6 |GCAATAGAGAGGAATAATCGCTCC | | 55 | -49 | 46 | 920-943 | | | | | | | | | |P25 |CAGATGCTTGAATTTGTCATGTCC | 53 | 56 | -47 | 42 | 22-45 | |M3 |TGCAATAGAGAGGAATAATCGCTCC | | 58 | -51 | 44 | 920-944 | | | | | | | | | |P25 |CAGATGCTTGAATTTGTCATGTCC | 53 | 56 | -47 | 42 | 22-45 | |M2 |TGCCTGCAATAGAGAGGAATAATCG | | 59 | -51 | 44 | 924-948 | | | | | | | | | |P25 |CAGATGCTTGAATTTGTCATGTCC | 53 | 56 | -47 | 42 | 22-45 | |M1 |GCCTGCAATAGAGAGGAATAATCGC | | 59 | -53 | 48 | 923-947 | | | | | | | | | |P13 |ATGCTTGAATTTGTCATGTCCAAGG | 53 | 59 | -50 | 40 | 25-49 | |M5 |GCCTGCAATAGAGAGGAATAATCG | | 56 | -50 | 46 | 924-947 | | | | | | | | | |P13 |ATGCTTGAATTTGTCATGTCCAAGG | 53 | 59 | -50 | 40 | 25-49 | |M4 |CCTGCAATAGAGAGGAATAATCGC | | 56 | -50 | 46 | 923-946 | | | | | | | | | |P12 |TGCTTGAATTTGTCATGTCCAAGG | 53 | 59 | -49 | 42 | 26-49 | |M5 |GCCTGCAATAGAGAGGAATAATCG | | 56 | -50 | 46 | 924-947 | | | | | | | | | 59 |P12 |TGCTTGAATTTGTCATGTCCAAGG | 53 | 59 | -49 | 42 | 26-49 | |M4 |CCTGCAATAGAGAGGAATAATCGC | | 56 | -50 | 46 | 923-946 | | | | | | | | | |P14 |GCAGATGCTTGAATTTGTCATGTCC | 53 | 59 | -50 | 44 | 21-45 | |M6 |GCAATAGAGAGGAATAATCGCTCC | | 55 | -49 | 46 | 920-943 | | | | | | | | | |P13 |ATGCTTGAATTTGTCATGTCCAAGG | 53 | 59 | -50 | 40 | 25-49 | |M6 |GCAATAGAGAGGAATAATCGCTCC | | 55 | -49 | 46 | 920-943 | | | | | | | | | |P12 |TGCTTGAATTTGTCATGTCCAAGG | 53 | 59 | -49 | 42 | 26-49 | |M6 |GCAATAGAGAGGAATAATCGCTCC | | 55 | -49 | 46 | 920-943 | | | | | | | | | |P32 |CAGAGTGATCCATCGGAAGC | 52 | 53 | -43 | 55 | 196-215 | |M9 |CCTGCAATAGAGAGGAATAATCG | | 53 | -46 | 43 | 924-946 | | | | | | | | | |P32 |CAGAGTGATCCATCGGAAGC | 52 | 53 | -43 | 55 | 196-215 | |M8 |CTGCAATAGAGAGGAATAATCGC | | 53 | -46 | 43 | 923-945 | | | | | | | | | |P36 |CATGTAGCGCAGAGTGATCC | 52 | 51 | -42 | 55 | 187-206 | |M12 |TGCAATAGAGAGGAATAATCGC | | 52 | -45 | 41 | 923-944 | | | | | | | | | |P32 |CAGAGTGATCCATCGGAAGC | 52 | 53 | -43 | 55 | 196-215 | |M12 |TGCAATAGAGAGGAATAATCGC | | 52 | -45 | 41 | 923-944 | | | | | | | | | |P32 |CAGAGTGATCCATCGGAAGC | 52 | 53 | -43 | 55 | 196-215 | |M11 |CAATAGAGAGGAATAATCGCTCC | | 52 | -46 | 43 | 920-942 | | | | | | | | | |P28 |AGAGTGATCCATCGGAAGCC | 52 | 54 | -44 | 55 | 197-216 | |M9 |CCTGCAATAGAGAGGAATAATCG | | 53 | -46 | 43 | 924-946 | | | | | | | | | |P28 |AGAGTGATCCATCGGAAGCC | 52 | 54 | -44 | 55 | 197-216 | |M8 |CTGCAATAGAGAGGAATAATCGC | | 53 | -46 | 43 | 923-945 | | | | | | | | | |P32 |CAGAGTGATCCATCGGAAGC | 52 | 53 | -43 | 55 | 196-215 | |M6 |GCAATAGAGAGGAATAATCGCTCC | | 55 | -49 | 46 | 920-943 | | | | | | | | | |P30 |TAGCGCAGAGTGATCCATCG | 52 | 54 | -44 | 55 | 191-210 | |M12 |TGCAATAGAGAGGAATAATCGC | | 52 | -45 | 41 | 923-944 | | | | | | | | | |P28 |AGAGTGATCCATCGGAAGCC | 52 | 54 | -44 | 55 | 197-216 | |M12 |TGCAATAGAGAGGAATAATCGC | | 52 | -45 | 41 | 923-944 | | | | | | | | | |P28 |AGAGTGATCCATCGGAAGCC | 52 | 54 | -44 | 55 | 197-216 | |M11 |CAATAGAGAGGAATAATCGCTCC | | 52 | -46 | 43 | 920-942 | | | | | | | | | |P32 |CAGAGTGATCCATCGGAAGC | 52 | 53 | -43 | 55 | 196-215 | |M5 |GCCTGCAATAGAGAGGAATAATCG | | 56 | -50 | 46 | 924-947 Từ kết quả trên chúng tôi đã chọn ra một cặp primer để chạy Nested PCR  Thông số primer:  Nhiệt độ Tm: 54oC và 55oC  % GC: 55 % và 46%  Nhiệt độ bắt cặp Ta: 53oC  Vùng bắt cặp: 197-216 và 920-943  Trình tự primer 5’ – 3’ P28 5’-AGAGTGATCCATCGGAAGCC-3’ M6 5’-GCAATAGAGAGGAATAATCGCTCC-3’ 60 Phần V Kết luận và đề nghị 5.1 Kết luận Qua điều tra và chẩn đoán, chúng tôi thu nhận đƣợc các kết quả nhƣ sau:  Tỷ lệ nhiễm TSWV theo địa bàn điều tra - Xã Nhuận Đức: 12,1% - Xã Phƣớc Thạnh: 12,5% - Xã Lộc Hƣng: 0%  Tỷ lệ nhiễm TSWV theo triệu chứng - Lá khảm vàng xanh, cong: 37,5% - Lá chấm vàng xanh, nhăn nheo, co lại, dày, giòn: 57% - Lá khảm nặng có chấm đen, lủng lỗ:53% - Khảm vàng nhạt trên cả rìa lá, lá nhỏ: 25%  Tỷ lệ nhiễm trên trái - Trái nhiễm: 33% - Không nhiễm: 67% Nhƣ vậy khi điều tra trên đồng ruộng thì chúng ta có thể đánh giá bệnh TSWV dựa trên các triệu chứng trên. Đánh giá bệnh dựa vào giống và tuổi cây thì chƣa thực hiện đƣợc vì bà con nông dân chƣa thực sự quan tâm đến giống mà họ đang trồng, và thời gian nghiên cứu thì lại rơi vào cuối vụ, tất cả đều cho trái nhƣ nhau. 5.2 Đề nghị  Tiếp tục nghiên cứu mức độ gây hại của TSWV theo giống và độ tuổi.  Nghiên cứu khả năng lây lan của TSWV trên các đối tƣợng khác.  Sử dụng cây chỉ thị để hỗ trợ cho việc chẩn đoán.  Vì mức độ nhiễm của TSWV chƣa cao, lƣợng RNA virút ly trích đƣợc còn quá thấp không thể phát hiện đƣợc bằng PCR thông thƣờng nên chúng tôi đề nghị phƣơng pháp chẩn đoán TSWV bằng Nested PCR với cặp primer đang sử dụng và cặp primer đƣợc vừa thiết kế. Hiệu quả của phƣơng pháp này sẽ đƣợc chứng minh khi chúng tôi có điều kiện để thực hiện phản ứng Nested PCR với cả hai cặp primer đã đƣợc đề cập ở phần trên.  Xây dựng quy trình xác định TSWV bằng kỹ thuật Realtime – PCR.  Thực hiện thu RNA bằng kỹ thuật siêu ly tâm theo khuynh độ đƣờng. 61 Phần VI TÀI LIỆU THAM KHẢO TIẾNG VIỆT 1. Nguyễn Ngọc Bích, 2004, Luận văn Thạc sĩ Khoa học Nông nghiệp: Bước đầu nghiên cứu một số bệnh virus trên thuốc lá của tỉnh Tây Ninh. 2. Vũ Triệu Mân, 2003, Chẩn đoán nhanh bệnh hại thực vật. Nhà xuất bản Nông nghiệp, Hà Nội, trang 46-50. 3. Vũ Triệu Mân – Lê Lƣơng Tề, 1999, Bệnh Vi khuẩn và Virus hại cây trồng. Nhà xuất bản Giáo Dục, trang 143. 4. Lƣơng Nguyễn Thu Tâm,1996-2001, Luận văn tốt nghiệp Ngành Nông học: Tìm hiểu ảnh hưởng của các loại phân bón lá đến khả năng sinh trưởng, phát triển và năng suất cây ớt (Capsicumannum L.) trồng trong vụ mùa mưa tại phường Thống Nhất-TP. Biên Hoà-Tỉnh Đồng Nai. 5. Phạm Đức Toàn, 1996-2000, Luận văn tốt nghiệp Ngành Nông học: Sử dụng kỹ thuật ELISA để chẩn đoán bệnh Tristeza trên cây cam quýt tại quận 9, Thành Phố Hồ Chí Minh. 6. Nguyễn Hữu Trúc,1995 -2000, Luận văn tốt nghiệp Ngành Nông học: Hiệu lực của một số thuốc Bảo vệ Thực vật phòng trừ bệnh thán thư (Colleto trichum spp.) trên ớt (Capsicumannum L.). Bước đầu xây dựng qui trình phòng trừ tổng hợp bệnh thán thư ớt. 7. Nguyễn Văn Tuất, 2002, Kỹ thuật chẩn đoán và giám định bệnh hại cây trồng. Nhà xuất bản Nông nghiệp, Hà nội, trang 69. 8. Bùi Cách Tuyến, 1998, Bản dịch tiếng việt, Tài liệu hướng dẫn đồng ruộng, Bệnh hại cây ớt. Nhà xuất bản Nông nghiệp, trang 42 – 56. 9. Bùi Trang Việt, 2002, Sinh học phân tử, ĐH Quốc gia TP. HCM Khoa Sinh học - Trƣờng ĐHKHTN. TIẾNG NƢỚC NGOÀI 10. Alfred Nobel Dr. Hercules, CA 94547 USA, Inc, 2000, Aurum Total RNA Mini Kit Instruction Manual Bio-Rad Laboratories, trang 26-27. 62 11. Biowave vol.6 No.23 2004, tomato spotted wilt virus. 12. Chemicon International, Inc - 28820 Single Oak Drive - Temecula, CA 92590, Introduction to Antibodies - Enzyme-Linked Immunosorbent Assay (ELISA) 13. G.A. Dafalla, Plant Pathology Centre, Faculty of Agricultural Sciences,University of Gezira, Wad Medani, Sudan. 14. Introduction to Microbiology: Virus Genomes, 2005. 15. J.Morris, Central Science Laboratory, Sand Hutton, York, Y041 1LZ, UK. 16. John R. Crowther, 2001, The Elisa Guidebook – Volume 149, trang 12 – 34. 17. Ken Pernezny-Everglades research and Education Center University of Florida, Belle Glade; Pamela D. Roberts-Southwest Florida Research and Education Center University of Florida, Immokalee; John F. Murphy-Auburn University, Auburn, Alabama; Natalie P. Goldberg-New Mexico State University, Las Cruces; Compendium of pepper Diseases; 2003; The American Phytopathological Society. 18. Lindsey Irons and Emily Sims, tomato spotted wilt virus. 19. Marcelo Eiras1, Renato O. Resende2, Alexandre A. Missiaggia2 & Antônio c. de Ávila3, Centro de Sanidade Vegetal, Instituto Biológico, CEP 04014-002, São Paulo, SP, Departamento de Biologia Celular, Universidade de Brasília, CEP 70910970,Brasília, DF; 3Centro Nacional de Pesquisas de Hortaliças - EMBRAPA, Cx. Postal 218, CEP 70359-970, Brasília, DF, RT – PCR and dot blot hybridization methods for a universal detection of tospoviruses, 2001. 20. Michael Blaber, 1998, BCH5425 Molecular Biology and Biotechnology 21. Peter Schreier, Prof. Dr. Martin Hülskamp, 2002, Molekulare Charakterisierung des Nukleokapsidaufbausvon TSWV (Tomato Spotted Wilt Virus) 63 22. P. Sreerama Kumar, ProjectDirectorate of Biological Control (ICAR), P. B. No. 2491, H. A. FarmPost, Hebbal, Bellary Road, Bangalore 560 024, Karnataka, India. PlantDis. 84:1151, 2000; published on-line as D-2000-0816-03N, 2000.Accepted for publication 30 June 2000. 23. Ray Cerkauskas, Visiting Scientist from Agriculture and Agri-Food Canada. Edited by Tom Kalb. Photos by L.L. Black and E.L.Shannon. Published by AVRDC – The World Vegetable Center; P.O. Box 42, Shanhua; Taiwan 741; ROC. 2004. 24. Sambrook và Russell, Third edition, Molecular Cloning – volume 2, trang 8.47. 25. Theo SK&ĐS, 2005, Vị thuốc từ ớt. 26. Vernon E Coyne, M Diane James, Sharon J Reid and Edward P Rybicki,Molecular Biology Techniques Manual, Third Edition, 1996. 27. . 28. . PHẦN VII PHỤ LỤC Phụ lục 1: Trình tự Nucleotide của genome TSWV 1 agagcaattg tgtcagaatt ttgttcataa tcaaacctca cttagaaaat cacaatactg 61 taataagaac acagtaccaa taaccataat gtcttcaagt gtttatgagt cgatcattca 121 gacaagagct tcagtctggg gatcaactgc atctggtaaa gctgttgtag attcttactg 181 gattcatgaa cttggtactg gttctcaact agttcagacc cagctgtatt ctgattcaag 241 aagcaaagta gtcctttggc tatactgcaa agtagggatc ttccctgtga agaagaagag 301 atttctttct cagcatgtgt atatccctat ttttgatgat attgatttta gcatcaatat 361 tgataactct gttctggcac tatctgtttg ctcaaataca gtcaatgcta acggagtgaa 421 acatcaaggt catttgaagg ttttgtctcc tgcccagctc cactctattg aatctatcat 481 gaacagatct gatattacag accgattcca gctccaagaa aaagacataa ttcccaatga 541 caaatacatt gaagctgcaa acaaaggctc tttgtcttgt gtcaaagagc atacctataa 601 gatcgagatg tgctataatc aggctttagg caaagtgaat gttctatctc ctaacagaaa 661 tgtccatgaa tggctgtaca gtttcaagcc aaatttcaat caagttgaaa gcaacaacag 721 aactgtaaat tctcttgcag tgaaatctct gctcatgtca gcagaaaaca acatcatgcc 781 taactctcaa gcttccactg attctcattt caagctgagc ctctggctaa gggttccaaa 841 ggttttgaag caggtttcca ttcagaaatt gttcaaggtt gcaggagatg aaacaaacaa 901 aacattttat ttatctattg cctgcattcc aaaccataac agtgttgaga cagctttaaa 961 cattactgtt atttgcaagc atcagctccc aattcgcaaa tgcaaagctc cttttgaatt 1021 atcaatgatg ttttctgatt taaaggagcc ttacaacatt gttcatgacc cttcataccc 1081 caaaggatcg gttccaatgc tctggctcga aactcacaca tctttgcaca agttctttgc 1141 aactaacttg caagaagatg taatcatcta cactttgaac aaccttgagc taactcctgg 1201 aaagttagat ttaggtgaaa gaaccttgaa ttacagtgaa gatgcctaca aaaggaaata 1261 tttcctttca aaaacacttg aatgtcttcc atctaacaca caaactatgt cttacttaga 1321 cagcatccaa atcccttcat ggaagataga ctttgccaga ggagaaatta aaatttctcc 1381 acaatctatt tcagttgcaa aatctttgtt aaagcttgat ttaagcggga tcaaaaagaa 1441 agaatctaag gttaaggaag cgtatgcttc aggatcaaaa taatcttgct ttgtccagct 1501 ttttctaatt atgttatgtt tattttcttt ctttacttat aattatttct ctgtttgtca 1561 tctctttcaa attcctcctg tctagtagaa accataaaaa caaaaaataa aaatgaaaat 1621 aaaattaaaa taaaataaaa tcaaaaaatg aaataaaaac aacaaaaaat taaaaaacga 1681 aaaaccaaaa agacccgaaa gggaccaatt tggccaaatt tgggttttgt ttttgttttt 1741 tgttttttgt tttttatttt ttattttatt tttattttat tttattttta ttttattttt 1801 attttattta ttttttgttt tcgttgtttt tgttatttta ttatttatta agcacaacac 1861 acagaaagca aactttaatt aaacacactt atttaaaatt taacacacta agcaagcaca 1921 agcaataaag ataaagaaag ctttatatat ttataggctt ttttataatt taacttacag 1981 ctgctttcaa gcaagttctg cgagttttgc ctgcttttta accccgaaca tttcatagaa 2041 cttgttaaga gtttcactgt aatgttccat agcaacactc cctttagcat taggattgct 2101 ggagctaagt atagcagcat actctttccc cttcttcacc tgatcttcat tcatttcaaa 2161 tgctttgctt ttcagcacag tgcaaacttt tcctaaggct tccttggtgt catacttctt 2221 tgggtcgatc ccgaggtcct tgtattttgc atcctgatat atagccaaga caacactgat 2281 catctcaaag ctatcaactg aagcaataag aggtaagcta cctcccagca ttatggcaag 2341 tctcacagac tttgcatcat cgagaggtaa tccataggct tgaatcaaag gatgggaagc 2401 aatcttagat ttgatagtat tgagattctc agaattccca gtttcttcaa caagcctgac 2461 cctgatcaag ctatcaagcc ttctgaaggt catgtcagtg cctccaatcc tgtctgaagt 2521 tttctttatg gtaattttac caaaagtaaa atcgctttgc ttaataacct tcattatgct 2581 ctgacgattc tttaggaatg tcagacatga aataacgctc atcttcttga tctggtcgat 2641 gttttccaga caaaaagtct tgaagttgaa tgctaccaga ttctgatctt cctcaaactc 2701 aaggtctttg ccttgtgtca acaaagcaac aatgctttcc ttagtgagct taaccttaga 2761 catgatgatc gtaaaagttg ttatatgctt tgaccgtatg taactcaagg tgcgaaagtg 2821 caactctgta tcccgcagtc gtttcttagg ttcttaatgt gatgatttgt aagactgagt 2881 gttaaggtat gaacacaaaa ttgacacgat tgctct Hình pl.1a: Trình tự Nucleotide genome S (Short) 1 agagcaatca gtgcatcaga aatataccta ttatacattt tgctaagaat caatcaacta 61 cattacacaa gctcctctac cttaggctgt tgaactcgaa atgttgactc ttttcggtaa 121 caagaggcct tctaagtctg taatggcagt gttgaagtct caaaaccatg gtcttcttct 181 gatgaaaagc ttgctttaac ccggaaagga tgaaggtcct ttagtttcac ttgctaaaca 241 caaagccatg gatgcatcca aaggaaagat actgttaaac attgagggaa catcttcctt 301 tggaacctat gaatctgatt ccatcacaga gtcagaaggt tatgatcttt ctgctagaat 361 gatagtagat acaaaccatc atatctcaaa ctggaaaaat gatctttttg ttggcaacgg 421 aaagcaaaat gctaataagg ttatcaagat ctgtccgact tgggacagca gaaaacaata 481 catgatgatt tccagaattg tgatatgggt ctgccccact ataccaaacc ctacaggaaa 541 acttgtggtt gctttaattg atcccaacat gccatctgga aagcaagtca tcctgaaggg 601 tcaggggaca ataactgatc ctatctgctt tgttttttat ctgaactggt ctattccgaa 661 gatgaacaac accccagaaa actgttgtca gctgcatttg atgtgtagcc aagaatacaa 721 gaaaggggtt tcttttggta gtgtcatgta ttcttggaca aaagagtttg gtgattcacc 781 cagagctgat aaagacaaaa gttgtatggt tatacctcta aacagggcca ttagagctag 841 atctcaggca ttcattgaag cctgcaagct gataattcct aaaggaaaca gtgagaagca 901 gataaaaaaa cagcttaaag aactgagctc aaatcttgag agatcagttg aagaggaaga 961 ggaaggaatt tctgacagtg ttgctcagtt atcctttgat gaaatatagt tctttaaata 1021 tcacttattt aagcttaaat ttctgtctat tttgcatttt gaatccaaaa acccaaacaa 1081 aaaacgaaaa caaaaaagag aaaaaaacaa aaaatcaaac caaaaaacaa aaacaaaata 1141 aggctgaaaa gcaaactttg gtccgaagac tttttttgtt gttttttgtt tatttttatt 1201 tttttgtttg ttttttgttt attttatatt tcgtttttat tagttaatga ttgattttaa 1261 agatttttct atatatataa tcctgctaat atagaagatt gaatcaaatt taatctgtga 1321 caagcatctt cagacaaggt gagagaaatc cataggtggc cttcttcttg tcattgtatc 1381 tttcattaac ataggggctt tgatctcagg ttcatcatca tcctctatct tggatctaga 1441 tttataagat tcattcttta catatccttt acaaatggat gtcagaatag aacagaaata 1501 agtcacaaga aaaatgaatg caataagcag taccactctg atagtatcaa aaaatgagcc 1561 aaagtaactt gcaatgaaat tgaatggact cttaatataa tcccagaagc cccatgctga 1621 agaatcagaa ttatattgtt gttcttcatg agcatactca tcattttgat ctattatatt 1681 ctctggttct tctacaataa cattattaac caaaacttcc acagagatat ccggattgcc 1741 ttctggatac aatgtcattt tcttcttgtc cggattggct gaacaaaaca ttgttatatt 1801 gtatttatta gatccttttt taacagctag ctgataagta gataaagagc aagcatctat 1861 agaaattgca gtagaaaatg tcaaatctga gaaaaattct aaaaggcaag ataaaccttg 1921 gccgcataga agacagccat tgcaatttaa gcttgttgaa gttatggaag gtttcttagg 1981 agcaacttta aaaagatcag atggaagatc aactaccatt ttcagtttcc ctagactaaa 2041 agattttgcc agaaaaaaac tagaaaaatc tttgaaacta acaggaatat ctgatatttg 2101 ctctaaacca gatctaaacc tgtatgtgtc gtatccacat gttttgatag tgactgattt 2161 tttccctatt gctgcacaat cccaagacat gtcatctcct tctagagttt tcttagtaaa 2221 aataggcact ccatcatggg tcaattgtgg atgaccaaac attttcacag gatcattcaa 2281 gtttgcaata tttccagagt aaatatgact gtcgggtcca tgagctatta gttcacctat 2341 agtgatacca tcattatgca aatctgcttg tatatcagct tgaaacaatg tattttcata 2401 aggaacctct tcagtaatcc ttgagcattg acctcccaaa ataccggaaa tacaaacatc 2461 tgctactata gttgacttaa gcactgaata aattctgtat gatttgtcca tatcataaat 2521 atttcgacag aatccgcatg tagcaccctc attaattgca aaacaccaag cttcttcaca 2581 tccccaataa gaagttggtg ttacacaaaa atcttggaaa cctgttaaag cttgattttt 2641 cctgcaagtg tcgcagtttc ctgtacaagt ggaataaaaa tccgtgtggg tgctttggat 2701 gggagctgtc gtatattttt ctgacacttc ataatgaatt cccacacttt tgatataaat 2761 cacaaatttt ttggctgttt ctgaggtctt gtcatttagc atgaatatag ttcctcctcc 2821 tcctaaaaga gattgttcta tcatatatct atatttcccg tctacaacag aatcaaagat 2881 taatgattgc ctgggcagaa tgttctctgg tatgcttgtt tcgtttttgt ttaaggagtc 2941 tccggcaacc attccagaaa ttttgccctg acggttatag gaatctatta taccatttct 3001 caatctctta gcctcataca gaccaactga tgttaaccct aaagagcttc ctgtataatc 3061 cgaaaaccca ttgtacaaag gtttgtttcg gaataaatct aggtattcgc aacctaatct 3121 gcattttata agattatcaa tagatgggcg tgcaatgcaa ttctggttct ctatgcaatc 3181 attaggacct tctataacaa tattagtgcc aaagatactc tctatgatct tatcttcttt 3241 tacattgcag taacattgat ctttttcaga gcatttttca aatttgcttg taaccaaaaa 3301 tggacagcct ggaacataaa agcatccact caaacattgg gttgtttgag ccatagacat 3361 gggcatctga gacaaaatga ctaaacctat caaaatttcg gtcacaaatt ttagcaaact 3421 caagctcagc ttagtgttca ctattagatg gaaccattcc atgctagtcc acttatgttt 3481 gttgtagtca tgatctgctt ctttggatag tatgggacac tctgaagaat gctcttttga 3541 agctttgctt ttgttgcaaa tgcagacttt agtacactca tgtgtgacta tgcacagatt 3601 gccgcagtta gaacatttta atgggaaata tttccataag caatttatga gcaataagac 3661 agggtatgta atcaagccca taagatcata ccagagaaag agaggtttag tcgtcttgtt 3721 cactaaccat cggataggga aatagatcaa caaagctatc aatatcaacc ttatccaaga 3781 aaaattgatg caggctgttt gcttataaat actttttgaa tatttgatta tgcaatctct 3841 gactcttttg tttgtttttg gtattttggc tgatttgtca ccacacaaga gattgtgttc 3901 accatccaac atttcctcag taaaagtgat acttgctgat ccagaaaaag atataacctt 3961 gtgttccaca ttttcaccag gtttttttat caaataaccc atgatcttct cagggctagt 4021 gatgcttaca gtatagggat ttgcgaagtt tgatttagtt attttgcagt caccggataa 4081 ctttacagtt tgtaatgata ctgttccatt agtggggtat gagttgtaag ttataggata 4141 attatcttgt gtcaggcttt ctgaaatgaa gaattttcct cctactgaaa agtgtctttt 4201 cttgtctagc ttggtaatgg gaataaccgg gactttggag aatctctttg gcaaatttaa 4261 agaattatca catttttcta aaccttctgc tgaatcagaa acacaggaat atatgacacc 4321 attgttttca acttgataat aaacattata agtggatatc ccttttatct cacattttaa 4381 tgaagaagca ttcaagcaat tgttgggaag atccaaaaca gagattgttt tttgcgttgt 4441 tggctcagca gaaataggga tggttgattt ttcttctcgt atctgacggg ttccaggagt 4501 ccgagattct agcatcagat tagttaaagt ctctaagata gcttcgcgtt gaatcgatgc 4561 agcagtgggt acctcattct cagcagaatc atcataaatc tcaggatgat ctccacgaat 4621 tatttctact ttagcatctg tggctctgaa gatcaagaat gccaacaaaa cagaactcag 4681 ggcaattgtg aaaagactca cttttaccac tagttctagt agttttagaa ttctcatctt 4741 agatgtctac ccagattaca atggttgtgt gattaatttc aagatgtctg gattaaggtt 4801 tttgtttgca ctgattgctc t Hình pl.1b: Trình tự Nucleotide genome M (Medium) 1 agagcaatca ggtaacaacg attttaagca aacatgaaca tccagaaaat acaaaaatta 61 atagaaaatg gaaccacttt actgttgtct attgaggatt gtgtaggttc taaccacgat 121 ctagctttgg atttacataa gagaaatagt gatgagatcc cagaagatgt gattataaat 181 aataatgcaa aaaattatga gacaatgaga gagttaattg tcaaaatcac tgctgatggt 241 gaaggactaa acaaagggat ggcaactgtg gatgtcaaaa agctaagtga gatggtctct 301 ctgtttgagc aaaaatacct agaaacagag ttagcaaggc atgacatttt tggagagctg 361 atctccaggc acctgagaat aaagcccaaa caaagaaatg aagtggagat agagcatgca 421 ctaagagaat atctggatga actcaacaaa aagtcctgca ttaacaagct ctctgatgat 481 gagtttgaga gaataaataa agaatatgta gcaactaatg ccacccctga taactatgtg 541 atatataaag aatcaaaaaa cagtgagctt tgtttaatca tttatgattg gaaaatatct 601 gtcgatgcca ggactgaaac caaacaatgg agaaatacct acaagaatat ttggaaatct 661 ttcaaagata taaaagtgaa tggaaagcca ttcctggaag agcatcctgt tttcgtttct 721 atagttatat tgaaacctat tgctgggatg ccaatcactg ttactagtag cagggttttg 781 gagaaattcg aagattctcc atcagcattg cacggagaaa gaataaagca tgctaaaaat 841 gccaaattgc taaatatttc ttatgttggg caaatagttg gaaccacacc cacagtggtg 901 agaaactatt atgcaaacac tcaaagaatc aaatctgaag tcagaggaat cttaggtgat 961 gattttggat ctaaagatgt gtttttcagt cactggacca gcaaatacaa agaaagaaat 1021 cctactgaga tagcctattc cgaagatatt gaaagaataa ttgattcact tgttacagat 1081 gaaatcccta gagaggaaat aatacatttt ttgtttggaa atttctgttt ccacattgaa 1141 acaatgaatg accagcatat agctgacaaa tttaaagggt accaaaactc ttgtatcaat 1201 ttaaaaatag agccaaaagc tgatttagct gatttgaaag accacttaat ccaaaagcag 1261 caaatatggg aatctctgta tggaaaacac cttgagaaga tcatgcttag aattagagaa 1321 aaaaagagaa aagaaaaaga gatacctgac ataaccacag cttttaacca gaatgctgct 1381 gaatatgaag aaaggtatcc taactgtttc aatgatctct ctgaactaaa actaactttc 1441 catgacttgg tccccagttt gaagatagaa ttgagctcag aggtagatta caacaacgca 1501 attattaaca agtttcggga gagcttcaaa agttcttcaa gggttattta taatagccca 1561 tatagtagca taaataacca aacaaataaa gcaagagata taacaaactt agttagactg 1621 tgtttagcag agctaagttg tgatacaacg aaaatggaaa agcaggaact tgaagatgaa 1681 atagatataa acaccgggag tatcaaagtt gagagaacaa aaaagtctaa agaatggaat 1741 aagcaaggtt cgtgtttaac cagaaacaaa aatgaatttt gcatgaaaga tacaggcagg 1801 gagaacaaaa ctacctattt taaaggctta gcagtaatga atataggaat gagttctaag 1861 aaaagaattc taaaaaaaga agaaataaaa gaaaggatct ctaaaggctt ggaatatgat 1921 acctctgaaa ggcaggctga cccaaatgat gattactcaa gtatagacat gtcttctctg 1981 actcatatga aaaaactgat aaggcatgac aatgatgata gcttaagtgg taaaagattt 2041 aagggctctt tttttctact tcataatttt aatataatag aggatggtaa gatcacatct 2101 gttttcaata attatgctaa aaatcctgaa tgcttgtaca ttcaagattc agtactgaag 2161 actgaattag agacttgcaa aaagataaac aaattatgca atgatctagc catttaccat 2221 tactctgaag acatgatgca attctccaaa ggtttaatgg tggctgacag gtacatgact 2281 aaagaaagtt tcaagatatt aaccacagca aatactagca tgatgctatt agcattcaaa 2341 ggggatggaa tgaacaccgg aggatcggga gttccttaca tagcattgca tatagtggat 2401 gaagacatgt cagatcattt taacatatgt tatactaaag aaatttatag ctatttccga 2461 agtggtagta attacattta tataatgagg ccgcagagac taaaccaggt gaggctgctg 2521 aggcttttca aaacgcctag taaagttcct gtatgttttc cacaattttc aaagaaagct 2581 aatgaaatcg gaaaatcgct gaaaaataaa gatatagaaa aagtaaatct cttttctatg 2641 acaatgactg taaaacagat attaataaat attgtgtttt catctgtcat gataggaact 2701 gtgacaaagc tcagtagaat gggaattttt gatttcatgc ggtatgcagg ttttttgcga 2761 ctatccgatt attctaacat aaaagaatac attagagaca aatctgatcc tgatataact 2821 aactgtggca gatatctatt tcgtaatgga atcaaaaaac tattgttcag aatggaagat 2881 ctcaatttaa gcacaaatgc caagcctgtt gttgtggacc acgaaaatga tattatagga 2941 gggataacaa acttgaatat aaaatgtcct ataacaggat caactctact gacacttgag 3001 gacctgtaca ataatgttta tttggctatt tatatgatgc ctaaatcact gcacaatcat 3061 gttcacaatc taacaagctt attaaatctc cctgctgagt gggagctaaa gttcagaaaa 3121 gaattaggtt tcaacatatt tgaagacata taccctaaga aagcaatgtt tgatgacaaa 3181 gacctattct ccataaatgg agctttgaac gtgaaagcat tatctgatta ctatctagga 3241 aatatagaaa atgttggttt aatgagatca gaaatagaaa ataaagaaga tttcctaagc 3301 ccttgttata aaatatctac tttaaaatct tcaaaaaaat gctcacaatc aaacattata 3361 agtactgatg agataataga gtgtcttcag gatgcaaaga ttcaagatat agaaaattgg 3421 aaaggaaata acctagctat tataaaaggg cttataagaa cctacaatga ggagaaaaat 3481 agattggtgg aattttttga agataattgt gtcaattcat tatatcttat agaaaagctt 3541 aaagagataa ttagtagtgg atcaataact gtagggaaat ctgtaacatc taaattcata 3601 agaaacaatc atcctttaac agtagaaaca tatctcaaaa caaaactata ttatagaaat 3661 aatgtaacag ttttaaagtc taaaaaagtg tcagaggagc tctatgacct tgtaaaacag 3721 ttccatgaca tgatggaaat agacctagat tctgttatga acctcgggaa aggtacagaa 3781 ggaaaaaaac tcacattctt gcagatgctt gaatttgtca tgtccaaggc taaaaatgtc 3841 accgggtctg tagattttct agtttctgtt tttgaaaaaa tgcagagaac caaaacagac 3901 agagaaatat acttgatgag catgaaagtg aaaatgatgc tttattttat agagcataca 3961 ttcaaacatg tagcgcagag tgatccatcg gaagccatat ctataagtgg agacaataaa 4021 ataagagcac tttctacgtt atctttggac acaatcacgt cttacaatga tattttaaac 4081 aaaaattcaa agaagtcaag attggctttc ctatctgcag atcagtcgaa atggtcggca 4141 tcaggcctta ccacctataa atatgtttta gctatcatat taaatccaat tttaactact 4201 ggtgaagcta gcttaatgat agaatgcatc ttaatgtatg ttaaattgaa gaaggtttgt 4261 ataccaacag atattttttt gaatctaaga aaagctcaac aaacttttgg ggaaaatgaa 4321 actgccatag gacttttgac caaaggcttg acgacaaaca cataccctgt tagcatgaat 4381 tggttgcaag gcaatttaaa ttatctgtct tctgtttatc actcttgtgc aatgaaagct 4441 tatcacaaca ctttggaatg ttacaaaaac tgtgatttcc aaactagatg gattgtgcac 4501 tctgatgata atgcaacatc attaatagcc agtggagagg ttgataaaat gctgacagac 4561 ttttcaagct catctctgcc agaaatgttg tttagaagca ttgaagctca tttcaaaagt 4621 ttttgcataa ctttgaaccc aaaaaagagt tatgcttctt catcagaagt agagtttata 4681 tctgaaagaa ttagtaaatg gagcgattat tcctctctat tgcaggcatt tagcaaactg 4741 ttgcacagaa tcttcgcata taagttattt gatgatctaa tgtcactcag tatacatgtt 4801 acaatgcttc tgagaaaagg ctgtcctaat gaagttatac cttttgctta tggggctgtg 4861 caggtacaag cgttaagcat ctattcaatg cttcctggtg aagtgaatga tagtattaga 4921 atttttaaca agcttggagt aagtttaaag tcaaacgaga ttcccacaaa catggggggc 4981 tggttgacct ctcctataga gccgttgtct atattaggtc catcatcaaa tgatcaaatc 5041 atctattaca atgtgataag agattttttg aacaaaaaaa gtttagaaga agtaaaagat 5101 agtgtctctt cttccagtta tctacagatg agattcagag agctaaaaga aaagtatgaa 5161 agaggaactc tggaagaaaa agataaaaag atgatatttc ttatcaatct gtttgagaaa 5221 gcatcagtgt ctgaagattc agacgttcta acaattggga tgaaatttca aactatgtta 5281 actcagatta taaaattacc taattttata aatgagaatg ctttaaacaa gatgtcaagt 5341 tataaagatt tttcaaaact ttatcctaat ttaaaaaaga atgaagattt atataaaagc 5401 actaagaact taaagataga cgaggatgct gttttagagg aagatgagtt atataagaag 5461 attgcatcta gcttagaaat ggaatctgtc catgacataa tgataaaaaa tcctgaaaca 5521 attctgatag caccattgaa tgatagagat tttttactta gtcagctgtt catgtacaca 5581 agcccttcta aaagaaacca gttatcgaac caatctacag agaaacttgc tttagataga 5641 gtgttaaggt caaaagctag aacatttgta aacatttctt ccactgtgaa gatgacttat 5701 gaagaaaaca tggaaaagaa aatcttagaa atgctaaaat ttgatttaga ttcatattgt 5761 tcatttaaaa catgtgtaaa tctagttatc aaggatgtta atttcagcat gctgattcca 5821 atattagatt ctgcataccc ttgtgaatct aggaaaagag ataactacaa tttcaggtgg 5881 tttcagactg agagatggat acctgttgtt gaaggctctc cgggactagt agtaatgcat 5941 gctgtctatg gatcaaatta tatagagaac ttaggtttaa aaaacatccc tctaacagac 6001 gatagtatta atgttttaac aagcacgttt ggaacaggtt taatcatgga agatgtaaaa 6061 tccctagtta atggcaaaga cagcttcgaa acagaggctt ttagcaattc taatgaatgt 6121 caaagattgg tgaaagcatg caattatatg atagcagcac aaaacaggct tttagcaatt 6181 aacacatgct ttactaggaa aagctttccc ttctattcta agttcaatct agggagaggg 6241 tttatctcaa acacattagc tctcctatcc accatctaca gtaaagaaga atcctatcat 6301 tttgtttcta cagctagtta taaattagac aaaactatca gaactgtggt aagtgctcag 6361 caagatatga acttagagaa aatactggac actgctgtat acatatcaga taaattgcag 6421 tcacttttcc caacaattac aagagaggat atagttttaa tattgcaaaa tgtttgcctt 6481 gacagtaaac ctatatggca gagtctagaa gacaaaatga aaaagattaa caattcaaca 6541 gcaagtggct tcacagtgtc aaatgtgatt ctatcacata acagtgaatt gaacacaatc 6601 cagaaacaaa ttgtctggat gtggaacatg ggtttgtgtt ctcacagaac attagatttt 6661 gttatcaggt atattagaag aagggatgta agatatgtaa aaactgaaga acaagatgaa 6721 tcaggaaatt atgtctctgg aactatgtac aaaataggga tcatgacaag aagctgctat 6781 gtggaattga tagcatctga tcaagatgta gcagtttctt tgagaacacc atttgagata 6841 ttgaatgaaa gagagtatct ttttgacaca tacagagaaa gtatagagaa attattggca 6901 gaaattatgt ttgataaagt gaacataata aatcaaacaa ccacagattg ttttcttaga 6961 accaggagat cttgcatcag aatgaccaca gacaacaaaa tgattgtaaa ggttaatgct 7021 acatcaagac aaataagact agagaatgta aaattagttg taaagataaa atatgaaaat 7081 gtgaattccg atgtatggga tattatagaa agccaaaaat ctctagtctt aaggctccct 7141 gaagtagggg aatttttctc tgatatgtat aaaactgcag actctgaaac tgaaacaatc 7201 aaaaccataa aaaacaggct tatgacttct ttaactttca tagaagcctt tggaaactta 7261 tcacagcaga tcaaagagat tgtagatgat gatatcagag aaacgatgga tgaattctta 7321 atgaacatcc gggatacctg cttagaaggt ttggaaaact gcaaaagtgt ggaagaatat 7381 gatagctatc ttgatgaaaa tggatttaat gacacagtag aactattcga aaacttgcta 7441 agaacacatg acaactttga aaatgagtat agtcctcttt tttcagagat tgttgacaaa 7501 gcaaaacagt atactagaga tttagaaggt ttcaaagaaa tactgctcat gcttaaatat 7561 tctctaataa atgatgcatc aggatttaaa agctatagag ccactggaat gcatgctgtt 7621 gagctaatgg caaaaaagca catagagata ggggaattca acttgttagg aatgatccaa 7681 ttgattaaag cttgtgaaac atgccacaac aatgactcta tattaaactt agcaagttta 7741 aggaatgttc ttagcaggac atatgccaca tttgggagga gaataagatt ggatcatgat 7801 ctggacttgc aaaacaactt aatggaaaaa agttatgatt tcaagacgct ggttttacca 7861 gaaataaaat tatcagaact atctagggaa atactgaaag aaaatgggtt tgttatatct 7921 ggagagaatc taaaaatgga taggtctgat gaagaatttg tgggtcttgc cagttttaat 7981 gtgttgaggc tagatgagga agaaatgtat gaaggtttga tcaaagaaat gaaaattaaa 8041 aggaaaaaga aagggttttt atttccagca aacacacttc tactaagtga gttgataaag 8101 ttcttgattg gaggaataaa gggaaccagc tttgatatag agacattgtt acggaacagt 8161 tttagaccag acatattttc aactgacaga ttgggaagat taagttccag tgtacctgca 8221 ctcaaagttt atgcaactgt ttatatggaa tataagaatg tcaattgtcc tttaaatgag 8281 atagctgaca gcttagaagg ttatctaaaa ctgacaaaaa gcaggtccaa ggaacatttc 8341 ttgtctggaa gagttaaaaa agctttgata caattaagag atgaacaatc gcgaactaaa 8401 aaactagagg tctataagga tatcgcaaat ttccttgcta ggcacccact atgtttatca 8461 gaaaaaacat tgtatggaag atatacctac tctgatatca atgattatat catgcaaaca 8521 agagagatta ttttgagtaa aataagtgag ttggacgagg ttgttgaaac agatgaagac 8581 aatttcttgc ttagttatct aagaggggaa gaagatgcct ttgatgaaga tgagcttgat 8641 gaagaagaag acacagatta aattgaaagt aatgactaac aatccatgaa taacagatta 8701 gatataactt agaatataaa tttattgcta ttttagaatt agattagatc tacttagcct 8761 aaaacaattt ggtgaaccaa atctatagtg tatataaatg tagagtcccg gtatagtttc 8821 actggaggga attcttatgt aatttgtaaa gtctggctgt ggagaggtta tatgttttag 8881 ttgtacctga ttgctct Hình pl.1c: Trình tự Nucleotide genome L (Long) Phụ lục 2: Kết quả bắt màu của kháng thể đơn dòng với TSWV  Bố trí thí nghiệm trên đĩa: + Bỏ hàng số 12, cột A, cột H + Hàng 1: Nƣớc cất + Ô số 2B, 2C: dung dịch đệm ly trích mẫu + Ô số 2D, 2E: đối chứng dƣơng + Ô số 2F, 2G: đối chứng âm  Những giếng có màu vàng là những giếng chứa mẫu nhiễm TSWV, ngƣợc lại những giếng không màu là những giếng chứa mẫu không bị nhiễm TSWV. Phụ lục 3: Kit ly trích RNA Phụ Lục 4: MẪU ĐIỂU TRA Mã số .................................................................................................... Nơi lấy mẫu .......................................................................................... Chủ hộ ................................................................................................... Giống cây .............................................................................................. Tuổi cây ................................................................................................ Tình trạng vƣ ờn ................................................................................... Cách trồng ............................................................................................. Phƣơng pháp trồng ............................................................................... Diện tích vƣờn, năng suất ..................................................................... Độ thuần của vƣờn ................................................................................ Có vector truyền bệnh hay không ......................................................... Mùa vụ .................................................................................................. Bệnh có thƣờng xảy ra không ............................................................... Triệu chứng ........................................................................................... Phụ lục 5: Kết quả ELISA trên các đĩa nhƣ sau: 1 2 3 4 5 6 7 8 9 10 11 12 B1 C1 _ _ _ _ _ _ _ _ _ B2 C2 _ _ _ _ _ _ _ _ _ B3 PC1 _ _ _ _ _ _ _ POS _ B4 PC2 _ _ _ _ _ _ _ POS _ B5 NC1 _ _ _ _ _ _ _ _ _ B6 NC2 _ _ _ _ _ _ _ _ _ Phụ lục 5a: Đĩa ELISA số 1 1 2 3 4 5 6 7 8 9 10 11 12 B1 C1 _ POS POS _ _ _ _ _ _ B2 C2 _ POS POS _ _ _ _ _ _ B3 PC1 POS POS _ _ POS _ _ _ _ B4 PC2 POS POS _ _ POS _ _ _ _ B5 NC1 _ POS _ _ POS _ _ _ _ B6 NC2 _ POS _ _ POS _ _ _ _ Phụ lục 5b: Đĩa ELISA số 2 1 2 3 4 5 6 7 8 9 10 11 12 B1 C1 _ _ _ _ _ _ _ _ _ B2 C2 _ _ _ _ _ _ _ _ _ B3 PC1 _ _ _ _ _ _ _ _ _ B4 PC2 _ _ _ _ _ _ _ _ _ B5 NC1 _ _ _ _ _ _ _ _ _ B6 NC2 _ _ _ _ _ _ _ _ _ Phụ lục 5C: Đĩa ELISA số 3 1 2 3 4 5 6 7 8 9 10 11 12 B1 C1 _ _ _ _ _ _ _ _ _ B2 C2 _ _ _ _ _ _ _ _ _ B3 PC1 _ _ _ _ POS _ _ _ _ B4 PC2 _ _ _ _ POS _ _ _ _ B5 NC1 _ _ _ _ _ _ _ _ _ B6 NC2 _ _ _ _ _ _ _ _ _ Phụ lục 5d: Đĩa ELISA số 4 1 2 3 4 5 6 7 8 9 10 11 12 B1 C1 _ _ _ POS _ _ _ _ _ B2 C2 _ _ _ POS _ _ _ _ _ B3 PC1 POS _ _ _ _ _ _ POS _ B4 PC2 POS _ _ _ _ _ _ POS _ B5 NC1 _ _ POS POS POS _ _ _ _ B6 NC2 _ _ POS POS POS _ _ _ _ Phụ lục 5e: Đĩa ELISA số 5 B: Nƣớc cất C: Buffer PC: Đối chứng dƣơng NC: Đối chứng âm - : Âm tính POS:Dƣơng tính

Các file đính kèm theo tài liệu này:

  • pdfNOPTHAY.pdf
Luận văn liên quan